advanced level study about central dogma

1. BTE 101: Introduction to Biotechnology and
Genetic Engineering
Spring 2024 | Section 2
Central Dogma of Molecular Biology
Class Hours: Saturday and Thursday (8.00 AM to 9.20 PM)
Consultation Hours: Monday (8.00 AM to 5.00 PM)
Zinia Haidar
Adjunct Lecturer
4th Floor (cubicle)
Biotechnology Program, Department of Mathematics and Natural Sciences (MNS)
BRAC University, Dhaka
+8801521-401295
ziniaxhaidar@gmail.com

2. Contents
The concept of Central Dogma in molecular biology
Types of central dogma
 DNA Replication
 RNA Transcription
 Translation of RNA into Protein
Genetic code and expression traits

3. Central Dogma of Molecular Biology
“The central dogma of molecular biology deals with the detailed residue-by-residue transfer of
sequential information. It states that such information cannot be transferred back from protein to
either protein or nucleic acid.”
Francis Crick, 1958
 Central dogma of molecular biology is an explanation of the flow of genetic information within a
biological system
 It is a framework for understanding the transfer of sequence information between information
carrying biopolymers, DNA and RNA (both nucleic acids), and protein
 Central dogma provides the basic framework for how genetic information flows from a DNA
sequence to a protein product inside cells and thus give an insight to the important processes
going on inside the cells

4. Central Dogma of Molecular Biology…

5. Basic Concepts
 DNA serve as templates for either complementary DNA strands
during the process of replication or complementary RNA during
the process of transcription
 RNA serve as a template for ordering amino acids by ribosomes
during protein synthesis or translation
GENERAL TRANSFERS describe the normal flow of biological
information:
DNA can be copied to DNA (DNA Replication)
DNA information can be copied into mRNA (RNA
Transcription)
Proteins can be synthesized using the information in mRNA
as a template (Translation)

6. Basic Concepts…
SPECIAL TRANSFERS describe:
RNA being copied from RNA (RNA replication): in RNA virus
DNA being synthesized using an RNA template (Reverse Transcription): in retrovirus
Proteins being synthesized directly from a DNA template without the use of mRNA: cell-free
protein synthesis in synthetic biology and molecular biology research
UNKNOWN TRANSFERS describe:
Protein being copied from a protein: in synthetic biology research
Synthesis of RNA using the primary structure of a protein as a template: in synthetic biology
research
DNA synthesis using the primary structure of a protein as a template: in synthetic biology
research

7. DNA Replication
 Replication: making of an exact copy of the DNA molecule
 Replication occurs whenever a cell divides
 Replicated copy must be 100% accurate (errors = death possibly)
 Replication process comes from the idea of:
Double-helical model of DNA
Presence of specific base pairs (A=T; C=G)
 The idea is:
Both of the two complementary strands of DNA could act as a
template for replication and transmission of genetic information

8. DNA Replication…
• Replication is assisted by enzymes
• Parent DNA unzips/unwinds slightly at a
particular location (origin) by Helicase
• New nucleotides attach covalently to the free
ends of newly synthesized strands (A=T and G=C)
via phosphodiester bonds via DNA Polymerase
• More DNA unzips
• More nucleotides attach
• Process continues in a 5′ → 3′ direction until
completed
• Results is two daughter double strands of DNA
• Each strand has 50% new and 50% old DNA

9. DNA Replication…
GROUND RULES OF DNA REPLICATION
[will be discussed in following slides]
DNA Replication:
 Begins from an origin
 Proceeds bidirectionally using one strand as template to form the other strand: “semi-
conservative”
 Movement of one replication fork is overall in the same direction for both strands
 Synthesis occurs in a 5′ → 3′ direction
 DNA polymerase requires a “primer”
 Semi-discontinuous:
One strand synthesized continuously: leading strand
Another strand synthesized discontinuously: lagging strand

10. Replication requires Deoxyribonucleotide Precursors
DNA polymerases catalyze the step-by-step addition of deoxyribonucleotide units to a DNA chain
Polymerization requires all 4 activated precursors—that is, deoxynucleoside 5’-triphosphates:
dATP, dGTP, dCTP, and dTTP
DNA polymerase is a template-directed enzyme
Synthesizes a new DNA strand using one of the old complementary strands

11. Replication is Semiconservative
Proposed Models of DNA Replication
Semiconservative:
Proposed by Watson and Crick in 1953 and confirmed by Meselson-Stahl
Currently accepted model
Each strand of the original DNA serves as a template for a new complementary strand
Each daughter DNA consists of (one original parental strand + one newly synthesized strand)
Conservative:
Entire double helix serves as a template for synthesis of a completely new double helix
One daughter DNA molecule consists of entirely newly synthesized DNA, while the other
daughter molecule consists of entirely original parental DNA
Dispersive:
Parental DNA molecule is dispersed or fragmented into smaller pieces during replication
each daughter DNA molecule contains a mixture of original and newly synthesized DNA

12. Replication is Semiconservative…

13. Meselson – Stahl Experiment [EXTRA]
 Primary objective was to determine the mechanism of DNA replication
 Supported semi-conservative model of DNA replication
PROCEDURE
 Meselson and Stahl grew Escherichia coli bacteria in a medium containing a heavy isotope of
nitrogen, 15N for several generations
 Heavy isotope incorporated into nitrogenous bases of DNA during DNA synthesis
 After several generations, bacterial DNA became labeled with 15N and was heavier than normal
DNA (as normal DNA contains the lighter isotope, 14N)
 Bacteria transferred to a medium containing the lighter 14N isotope
 Samples were collected at various time points after the transfer

14. Meselson – Stahl Experiment… [EXTRA]
RESULT
After one generation of growth in the 14N-containing medium, DNA molecules showed an
intermediate density, between that of pure 15N-labeled DNA and pure 14N-labeled DNA
This intermediate density profile indicated that the DNA had been replicated in a semi-
conservative manner
Each daughter DNA molecule consisted of one 15N-labeled parental strand and one newly
synthesized 14N-labeled strand
Subsequent generations of growth in the 14N-containing medium confirmed semi-conservative
nature of DNA replication, as the DNA density continued to shift toward the 14N-labeled density

15. Meselson – Stahl Experiment… [EXTRA]

16. Replication Begins at Origin
 Replication initiates in a particular sequence in a
genome called ORIGIN OF REPLICATION, Ori
 Ori: A=T rich site
 At each origin, double-stranded DNA unwinds
and separates into two single strands, forming a
REPLICATION BUBBLE
 Two Helicases load on two separated DNA
strands
 They moves along opposite direction creating
two replication forks unwinding the helix
 One replication bubble = two REPLICATION
FORKS at each end

17. Replication Proceeds Bidirectionally
 Each helicase move along single-stranded DNA in 5’ →
3’ direction unwinding the helix
 Many single-stranded DNA-binding proteins (SSBP)
bind to + stabilize separated strands
 Topological stress induced ahead of the fork because
of helix unwinding is relieved by DNA topoisomerase II
 Replication is tightly regulated so that occurs only once
per cell cycle

18. DNA Replication is Semi-continuous
LEADING STRAND AND LAGGING STRAND
 Daughter strands on two template strands are synthesized differently since in replication DNA is
synthesized from 5´end to 3´end: free 3’ —OH as the point at which the DNA is elongated
 On the template having the 3´end – that is template that is read in 3’ → 5’ direction, the
daughter strand is synthesized continuously in the 5’ → 3’ direction
 This strand is referred leading strand – same direction synthesis as Replication Fork movement
 But the other strand (template that is read in 5’ → 3’) cannot be synthesized in this way
 This strand is synthesized discontinuously in fragments – called Okazaki fragments
 This strand consisting of Okazaki fragments is lagging strand – opposite to Replication Fork

19. DNA Replication is Semi-continuous…
 DNA REPLICATION IS DIFFERENT on the leading and lagging strands
 Continuous synthesis of the leading strand and discontinuous synthesis of the lagging strand
represent a unique feature of DNA replication referred to as the SEMI-CONTINUOUS
REPLICATION
Complexity in Coordination [Extra]
 Both leading and lagging strands are synthesized by
a dimer of DNA polymerase III that only moves in
one direction (in the direction of leading strand)
 Thus, lagging strand DNA template is looped so
that polymerization takes place steadily in lagging
strand too

20. lagging strand DNA
template is looped

21. DNA Polymerase Requires a Primer
Primers: usually a piece of RNA
 DNA polymerase III is unable to start replication
 To add one nucleotide after other, it requires a pre-existing 3’-OH group
 Pre-existing 3’-OH is supplied by a primer added to the starting point
 A primer is a short segment of RNA synthesized by another enzyme – primase:
For leading strand, the priming has to be done once
For lagging strand, priming needs to occur at the beginning of every Okazaki fragment
 DNA polymerase I removes the RNA primers and replaces RNA primers with DNA once an
Okazaki fragment has been completed
 DNA ligase then joins the two Okazaki fragments with phosphodiester bonds to produce a
continuous chain

22. The Replication Complex or Replisome
 Entire complex responsible for coordinated DNA synthesis at a replication fork is REPLISOME
 The replisome (example: bacteria) includes:
Helicase that unwinds the superhelix (additional twisting and coiling of the DNA) as well as
the double stranded DNA helix to create the replication fork
SSBPs binds with single-stranded DNA to prevent it from reassociating
RNA primase that adds a complementary RNA primer to each template strand as a starting
point for replication
DNA polymerase III that reads the existing template chain from its 3´end to its 5´end and
adds new complementary nucleotides from the 5´end to the 3´end of the daughter chain
DNA polymerase I that removes the RNA primers and replaces them with DNA
DNA ligase that joins the two Okazaki fragments with phosphodiester bonds to produce a
continuous chain

23. The Replication Complex or Replisome…

24. RNA: Structure and Types
RNA Structure:
Single-stranded
May have internal double-stranded structure called
secondary structure
 Contains ribose sugar (instead of deoxyribose in DNA)
 Four different bases: adenine (A), guanine (G), cytosine (C),
and uracil (U) (instead of thymine, T in DNA)
Three major types of RNA:
 mRNA = messenger RNA – contains the message from DNA
for the construction of the new protein molecule
 tRNA = transfer RNA – carries amino acids to ribosomes
 rRNA = ribosomal RNA – makes up the ribosome

25. RNA Transcription
 Transcription is the process by which a molecule of DNA is copied into a
complementary strand of RNA
 This is called messenger RNA (mRNA) because it acts as a messenger between DNA
and the ribosomes where protein synthesis is carried out
 DNA-dependent RNA polymerase consists requires:
DNA template: only one of the strands of DNA double helix act as a template
unlike replication
Ribonucleoside 5’-phosphates: ATP, CTP, GTP, and UTP (only found in RNA)
 Elongates RNA strand by adding ribonucleotides to 3’ free —OH group
 RNA synthesis continues in 5’ → 3’ direction
 Does not require a primer

26. RNA Transcription…
 Transcription is the special copying of one strand of the DNA molecule (the sense strand) that
results in a single strand of RNA
Strand that serve as the template: Template Strand
Strand complementary to the template strand: Non-template Strand/Coding Strand

27. RNA Transcription…
Sense strand: strand runs from 5’ to 3’
direction, containing the same base pair
sequence to the transcribing mRNA; sense
strand is called as coding strand
Antisense strand: strand that contains anti-
codons, same as tRNA called as the non-
coding/template strand
 Original DNA is not changed during transcription
 This process can be repeated
 Amount of DNA that is transcribed at a time is
usually one gene

28. RNA Transcription: Process
 DNA is unzipped by an enzyme: RNA polymerase
 RNA polymerase attaches to DNA at a special sequence that serves as a “start signal” called
PROMOTER
 DNA strands are separated and one strand serves as a template
 RNA bases temporarily attach to the complementary DNA template (RNA-DNA hybrid), thus
synthesizing mRNA
 RNA polymerase recognizes a TERMINATION SITE on the DNA molecule and releases the new
mRNA molecule
 mRNA leaves the nucleus and travels to the ribosome in the cytoplasm
 As the RNA strand separates, the DNA strands reattach as before the process started
 The result is the original DNA plus a new RNA strand

29. RNA Transcription: Process…
Promoter:
 A regulatory region of DNA located upstream (towards the 5' end) of the transcription start
site (TSS)
 Extends between positions from −70 and +30
 Serves as the binding site for RNA polymerase and other transcription factors, which
collectively initiate the transcription process
 Eukaryotic promoter region has TATA Box which is recognized by RNA Polymerase II
Transcription Start Site (TSS):
 Specific location on the DNA molecule where RNA polymerase binds to initiate transcription
Transcription factors:
 Proteins: play a key role in regulation of gene expression
 Control the rate of transcription of genetic information from DNA to RNA by binding to
specific DNA sequences in the promoter region of target genes

30. RNA Transcription: Process…
Eukaryotic promoter region has
TATA Box
Termination Site

31. RNA Transcription: Process…

32. Translation of RNA into Proteins

33. Translation
 Often called protein synthesis
 Formation of polypeptide from the mRNA: RNA-directed
synthesis of a polypeptide
 Reading of the RNA code to make proteins or polypeptides
 Involves “reading” of the nucleotide sequence, and
translating the sequence into specific amino acids,
governed by the “genetic code”

34. Translation…
 Translation is performed by ribosomes
 Accompanied by multiple different macromolecules:
mRNAs
rRNAs
tRNAs
 Aminoacyl-tRNA synthetase: enzymes that attach
the appropriate amino acid to its corresponding
tRNA molecule, forming an aminoacyl-tRNA
complex, and each aminoacyl-tRNA synthetase is
specific to one amino acid
 Different proteins in initiation, elongation, and
termination steps of the translation

35. Translation Machineries
mRNA
 Genetic code is read from the mRNA strand
 mRNA is processed and exported to cytosol before protein
synthesis
 Sequence of nucleotides in the mRNA molecule is read in
consecutive groups of three
 Each group of three consecutive nucleotides in RNA is
called a codon, and each codon specifies either one amino
acid or a stop to the translation process
 Triplet codons: groups of three bases on mRNA that code
for specific amino acids
 Genetic code is universal
DNA
molecule
Gene 1
Gene 2
Gene 3
DNA strand
(template)
TRANSCRIPTION
mRNA
Protein
TRANSLATION
A C C A A A C C G A G T
U G G U U U G G C U C A
Trp Phe Gly Ser
Codon
3 5
3
5

36. Translation Machineries…
tRNA
 Has distinctive folded structure resembling three-leafed clover –
three hairpin loops:
D-arm (dihydrouridine arm): stabilizes tRNA tertiary structure
Anti-codon loop:
• Consists of three nucleotides complementary to the
mRNA codon sequence
• Recognizes and base-pairs with the codon on the mRNA
strand during translation, ensuring that the correct amino
acid is incorporated into the growing polypeptide chain
TψC-arm (T-thymidine, ψ-pseudouridine, C-cytidine arm):
contributes to the stability and correct folding of the tRNA

37. Translation Machineries…
tRNA…
 Acceptor arm (3' end):
Contains the 3' end, which harbors the amino acid
attachment site
Specific amino acid corresponding to the tRNA's
anticodon is covalently linked via an ester bond
Contains the sequence CCA, which acts as the attachment
site for the amino acid
 Base pairing rules for RNA are similar to those of DNA:
adenine (A) pairs with uracil (U) in RNA, and cytosine (C) pairs
with guanine (G)
 A codon “UAC" on mRNA, which codes for the amino acid
Tyrosine (Tyr), will be recognized by anticodon “AUG" on the
corresponding tRNA molecule

38. Translation Machineries…
Ribosome
 Made of proteins and ribosomal RNA (rRNA)
 Two subunits:
Small subunit has mRNA binding site
Large subunit has tRNA docking site
 Have three distinct pockets that play crucial roles in
the translation process called:
A site (aminoacyl site)
P site (peptidyl site) and
E site (exit site)

39. Translation Machineries…
Ribosome…
A site: binds incoming aminoacyl tRNA molecules
carrying amino acids to be added to polypeptide
P site: facilitating peptide bond formation by
holding the tRNA with the growing polypeptide
chain
E site: deacylated tRNA exits the ribosome after it
has released its amino acid
 During translation, ribosome moves along mRNA,
reading the codons sequentially
 As each codon is read, a complementary tRNA
molecule binds to it via base pairing between the
codon and the anticodon via hydrogen bonding

40. Translation Steps…

41. Translation Steps
 Prokaryotic mRNA has Shine–Dalgarno (SD) sequence which acts as the binding site for ribosome
 Shine-Dalgarno sequence helps recruit the ribosome to mRNA to initiate protein synthesis by
aligning the ribosome with the start codon: AUG
 Once recruited, tRNA may add amino acids in sequence as dictated by the codons, moving
downstream (5’ → 3’ direction) from the translational start site
 Translation continues until ribosome encounters one of the three stop codons: UAA, UAG, or UGA
 Stop codons do not code for any amino acids but instead serve as signals to terminate translation
 When a stop codon is encountered, a protein called a release factor (RF) binds to the A site of the
ribosome and promote hydrolysis of the bond between last tRNA and final amino acid in the
polypeptide chain
 The polypeptide, ribosomal subunits, and the mRNA dissociates
 mRNA then be reused for further rounds of translation or degraded by cellular machinery

43. Genetic Code and Expression of Traits

44. Genetic Code
 Genetic information is encoded as a sequence of nonoverlapping base triplets, or codons
 The gene determines the sequence of bases along the length of an mRNA molecule
 Codons: 3 nucleotide code for the production of a specific amino acid
 Since there are 4 bases and 3 positions in each codon, there are 4 x 4 x 4 = 64 possible codons
 64 codons but only 20 amino acids, therefore most amino acid can have more than 1 codon
 Three of the 64 codons are used as STOP signals: UAA,UAG, UGA and found at the end of every
mRNA and mark the end of the protein
 One codon is used as a START signal: AUG, that codes for Methionine; it is at the start of every
protein
 Universal: in all living organisms

45. Genetic Code…
Let’s translate!
Homework:
 AUGGCUAGCGUGAGCCGACGUUGAACG
 Met-Ala-Ser-Val-Ser-… … …
 AUGGCUAGCGUGAGCUGAAAGCCU
 Met-Ala-Ser-Val-Ser
 5’-AAGCCUAUGGCUAGCGUGAGCUGA-3’
 Met-Ala-Ser-Val-Ser
 9 bases would give 3 amino acids
 27 bases would give 9 amino acids

46. Expression of Traits
 Whether a person is born with attached or detached earlobes depends on a single gene
 Each variation of a gene is called an allele
 Genetic materials are responsible for the traits

47. Expression of Traits…
Allelic Combinations
Homozygous Genotype:
Two identical alleles at a particular locus on a pair of homologous chromosomes
Individual has two copies of the same allele for a gene, such as two dominant alleles (AA) or
two recessive alleles (aa): homozygous for that gene
Heterozygous Genotype:
Two different alleles at a particular locus on a pair of homologous chromosomes
Individual has one dominant allele and one recessive allele for a gene (Aa): heterozygous for
that gene

48. Expression of Traits…
For the example of attached/detached earlobes:
 Individual inherited one allele for this gene from each parent
Dominant allele (E) specifies detached earlobes
Recessive allele (e) specifies attached lobes
 If you have attached earlobes, you inherited two copies of the recessive allele (ee)
 If you have detached earlobes, you may have either one (Ee) or two copies (EE) of the dominant
allele

49. Genotype and Phenotype
 Genotype refers to particular genes an individual carries
 Phenotype refers to an individual’s observable traits
Cannot always determine genotype by observing
phenotype!

50. References
 Chapter 25: DNA Metabolism; Principles of Biochemistry by Lehninger
 Chapter 5: Nucleic Acids, Gene Expression, and Recombinant DNA Technology; Biochemistry by Voet
 Chapter 4: DNA, RNA, and the Flow of Information; Biochemistry by Stryer