This document describes a study that characterized the modified metabolic resistance to heavy metals, including mercury, of the Cupriavidus metallidurans strain MSR33. The study generated a bacterial strain with resistance to heavy metals and the ability to remove both organic and inorganic mercury from contaminated waters. Key findings included the detection of heavy metal resistance genes in MSR33, increased production of mercury resistance proteins MerA and MerB when exposed to mercury, and the ability of MSR33 to grow in the presence of mercury and remediate waters contaminated with mercury ions.
A.M. Soeter , F.A.A. Bakker, M. Velthuis, R.A. Verweij, M.H.S. Kraak & J.A.J. Breeuwer.
Adaptation in polluted environments has been considered as evolution in action.This study focused on the effects of metal contamination on chironomid community composition and on genetic adaptation in Chironomus riparius. Using CO-1 sequencing we demonstrated that chironomid community composition was impoverished due to metal pollution. Combining the population genetic structure of C. riparius and copper sensitivity of the F1 larvae we concluded that metal tolerance in C. riparius is most likely due to genetic adaptation.
Objectives :-
* Characterization and study of biochar.
*To examine biochar adsorption capacity.
*To determine the effect of KMnO4 as modifying agent on biochar adsorption.
Degradation of an organophosphorus insecticide (chlorpyrifos) in simulated wa...Salah Hussein
Induced degradation of chlorpyrifos insecticide in simulated wastewater with advanced oxidation processes (AOPs), using ultraviolet irradiation (UV), ozonation and chemical oxidation using (sodium hypochlorite, calcium hypochlorite, monochloride-isocyanuric acid (MCICA), dichloroiso-cyanuric acid (DCICA), trichloroisocyanuric acid (TCICA) ) was studied. Chlorpyrifos and its degradation products were extracted using solid phase extraction (SPE) method, identified using GC-MS. Results showed that the degradation of chlorpyrifos in simulated wastewater followed the first order reaction, and its half life was 3.34, 5.64, 7.13 and 10.69h under ozonation, UV, 1.5%TCICA and 1.5%DCICA respectively when chlorpyrifos solutions treated for 12 h. The concentrations of chemical oxidative substances, active chlorine content and time of treatments had a significant effect on degradation rate of chlorpyrifos, which increased with increasing of each. The most enhancement of chlorpyrifos degradation was observed in treatment with ozonation, UV, TCICA and DCICA where the dissipations % of the parent compounds were 85.70, 57.71, 43.71 and 35.07 %, respectively. The intermediates products of chlorpyrifos degradation using chemical method were identified as O,O-Diethyl thiophosphate(DEP), 3,5,6-trichloro-2-pyridinol(TCP), 3,5,6-trichloro-2-methoxypyridine(TMP) and 2,3,5,6-tetrachloro-pyridine. UV leads to formation of O,O-Diethyl phosphate, TCP and Chlorpyrifos oxon. Ozonation leads to formation of O,O-Diethyl thiophosphate beside the UV degradation products.
4. optimization of culture condition for enhanced decolorization of reactive ...Darshan Rudakiya
Many synthetic azo dyes and their metabolites are toxic, carcinogenic, and
mutagenic so removal of azo dyes using cost-effective and eco-friendly method is
major aspect.Comamonas acidovorans MTCC 3364 has been routinely reported for
different steroid bioconversion and heavy metal removal. The main purpose of this
study is to check the decolorization efficiency of Comamonas acidovorans MTCC
3364 for different dyes and to optimize the condition which gives maximum
decolorization of Reactive Orange 16 dye. The effect of various physicochemical
parameters including condition, carbon and nitrogen sources, temperature,pH and
dye concentration were studied. The % decolorization of dye was determined by
UV Visible spectroscopy. This bacterial strain efficiently decolorizes Reactive
Orange 16 at 37oC, pH 6.85 within 24 hours giving 99.03 ± 0.5 % dye
decolorization under optimum environmental conditions.
Synthesis, spectroscopic, magnetic properties and superoxide dismutase (SOD) ...IOSR Journals
Three new ternary copper(II) complexes formulated as [Cu(HIda)(bipy)] 1; [Cu(HIda)(phen)] 2; [Cu(HIda)(dmp)] 3; where HIda =N-(2-hydroxyethyl)-2- iminodiacetic acid ; bipy = 2, 2’- bipyridine; phen = 1,10- phenanthroline; dmp = 2,9-dimethyl 1,10-phenanthroline, have been synthesized and characterized by partial elemental analysis, FAB-mass (m/z), EPR, UV-visible and CV measurements. The magnetic and spectroscopic data of all these complexes 1-3 indicate distorted octahedral geometry. The EPR spectra of these complexes in frozen DMSO solutions showed a single at g ca. 2. The trend in g-value (g||>g>2.0023) suggests that the unpaired electron on copper (II) has dx2–y2 character. The SOD activities of the complexes have been investigated. Antibacterial and antifungal activity of these complexes were also measured and discussed.
2. evaluation of remediation in heavy metal tolerance and removal by comamona...Darshan Rudakiya
Comamonas acidovorans has vital role in degradation of natural as well as complex organic compounds. Comamonas acidovorans MTCC 3364 is mainly used for bioconversion of different steroids but now it is a novel approach on bioremediation. In heavy metals hexavalent chromium, mercury and lead is very toxic and carcinogenic for human health. Organism can tolerate heavy metals like hexavalent chromium, mercury, lead and aluminium with high efficiency. Removal of hexavalent chromium is major problem to textile as well as different industries. Comamonas acidovorans MTCC 3364 removed 99% of the hexavalent chromium from the medium and it can tolerate up to 600 ppm of chromium and 200 ppm of mercury in solidified medium. This organism shows high tolerance against salt i.e. it can tolerate up to 10% of salt. Chromium removal was also observed by using biosorption studies and MIC method. This bacteria increases pH during removal of chromium and makes chromium oxide which is trivalent chromium; it is a non-toxic compound. High salt tolerance, heavy metal tolerance and removal of hexavalent chromium make applicability in the treatment of waste water technology and treatment of industrial effluent which contain high amount of salt and heavy metals.
micro teaching on communication m.sc nursing.pdfAnurag Sharma
Microteaching is a unique model of practice teaching. It is a viable instrument for the. desired change in the teaching behavior or the behavior potential which, in specified types of real. classroom situations, tends to facilitate the achievement of specified types of objectives.
Title: Sense of Smell
Presenter: Dr. Faiza, Assistant Professor of Physiology
Qualifications:
MBBS (Best Graduate, AIMC Lahore)
FCPS Physiology
ICMT, CHPE, DHPE (STMU)
MPH (GC University, Faisalabad)
MBA (Virtual University of Pakistan)
Learning Objectives:
Describe the primary categories of smells and the concept of odor blindness.
Explain the structure and location of the olfactory membrane and mucosa, including the types and roles of cells involved in olfaction.
Describe the pathway and mechanisms of olfactory signal transmission from the olfactory receptors to the brain.
Illustrate the biochemical cascade triggered by odorant binding to olfactory receptors, including the role of G-proteins and second messengers in generating an action potential.
Identify different types of olfactory disorders such as anosmia, hyposmia, hyperosmia, and dysosmia, including their potential causes.
Key Topics:
Olfactory Genes:
3% of the human genome accounts for olfactory genes.
400 genes for odorant receptors.
Olfactory Membrane:
Located in the superior part of the nasal cavity.
Medially: Folds downward along the superior septum.
Laterally: Folds over the superior turbinate and upper surface of the middle turbinate.
Total surface area: 5-10 square centimeters.
Olfactory Mucosa:
Olfactory Cells: Bipolar nerve cells derived from the CNS (100 million), with 4-25 olfactory cilia per cell.
Sustentacular Cells: Produce mucus and maintain ionic and molecular environment.
Basal Cells: Replace worn-out olfactory cells with an average lifespan of 1-2 months.
Bowman’s Gland: Secretes mucus.
Stimulation of Olfactory Cells:
Odorant dissolves in mucus and attaches to receptors on olfactory cilia.
Involves a cascade effect through G-proteins and second messengers, leading to depolarization and action potential generation in the olfactory nerve.
Quality of a Good Odorant:
Small (3-20 Carbon atoms), volatile, water-soluble, and lipid-soluble.
Facilitated by odorant-binding proteins in mucus.
Membrane Potential and Action Potential:
Resting membrane potential: -55mV.
Action potential frequency in the olfactory nerve increases with odorant strength.
Adaptation Towards the Sense of Smell:
Rapid adaptation within the first second, with further slow adaptation.
Psychological adaptation greater than receptor adaptation, involving feedback inhibition from the central nervous system.
Primary Sensations of Smell:
Camphoraceous, Musky, Floral, Pepperminty, Ethereal, Pungent, Putrid.
Odor Detection Threshold:
Examples: Hydrogen sulfide (0.0005 ppm), Methyl-mercaptan (0.002 ppm).
Some toxic substances are odorless at lethal concentrations.
Characteristics of Smell:
Odor blindness for single substances due to lack of appropriate receptor protein.
Behavioral and emotional influences of smell.
Transmission of Olfactory Signals:
From olfactory cells to glomeruli in the olfactory bulb, involving lateral inhibition.
Primitive, less old, and new olfactory systems with different path
NVBDCP.pptx Nation vector borne disease control programSapna Thakur
NVBDCP was launched in 2003-2004 . Vector-Borne Disease: Disease that results from an infection transmitted to humans and other animals by blood-feeding arthropods, such as mosquitoes, ticks, and fleas. Examples of vector-borne diseases include Dengue fever, West Nile Virus, Lyme disease, and malaria.
These simplified slides by Dr. Sidra Arshad present an overview of the non-respiratory functions of the respiratory tract.
Learning objectives:
1. Enlist the non-respiratory functions of the respiratory tract
2. Briefly explain how these functions are carried out
3. Discuss the significance of dead space
4. Differentiate between minute ventilation and alveolar ventilation
5. Describe the cough and sneeze reflexes
Study Resources:
1. Chapter 39, Guyton and Hall Textbook of Medical Physiology, 14th edition
2. Chapter 34, Ganong’s Review of Medical Physiology, 26th edition
3. Chapter 17, Human Physiology by Lauralee Sherwood, 9th edition
4. Non-respiratory functions of the lungs https://academic.oup.com/bjaed/article/13/3/98/278874
- Video recording of this lecture in English language: https://youtu.be/lK81BzxMqdo
- Video recording of this lecture in Arabic language: https://youtu.be/Ve4P0COk9OI
- Link to download the book free: https://nephrotube.blogspot.com/p/nephrotube-nephrology-books.html
- Link to NephroTube website: www.NephroTube.com
- Link to NephroTube social media accounts: https://nephrotube.blogspot.com/p/join-nephrotube-on-social-media.html
ARTIFICIAL INTELLIGENCE IN HEALTHCARE.pdfAnujkumaranit
Artificial intelligence (AI) refers to the simulation of human intelligence processes by machines, especially computer systems. It encompasses tasks such as learning, reasoning, problem-solving, perception, and language understanding. AI technologies are revolutionizing various fields, from healthcare to finance, by enabling machines to perform tasks that typically require human intelligence.
Report Back from SGO 2024: What’s the Latest in Cervical Cancer?bkling
Are you curious about what’s new in cervical cancer research or unsure what the findings mean? Join Dr. Emily Ko, a gynecologic oncologist at Penn Medicine, to learn about the latest updates from the Society of Gynecologic Oncology (SGO) 2024 Annual Meeting on Women’s Cancer. Dr. Ko will discuss what the research presented at the conference means for you and answer your questions about the new developments.
MANAGEMENT OF ATRIOVENTRICULAR CONDUCTION BLOCK.pdfJim Jacob Roy
Cardiac conduction defects can occur due to various causes.
Atrioventricular conduction blocks ( AV blocks ) are classified into 3 types.
This document describes the acute management of AV block.
Basavarajeeyam is an important text for ayurvedic physician belonging to andhra pradehs. It is a popular compendium in various parts of our country as well as in andhra pradesh. The content of the text was presented in sanskrit and telugu language (Bilingual). One of the most famous book in ayurvedic pharmaceutics and therapeutics. This book contains 25 chapters called as prakaranas. Many rasaoushadis were explained, pioneer of dhatu druti, nadi pareeksha, mutra pareeksha etc. Belongs to the period of 15-16 century. New diseases like upadamsha, phiranga rogas are explained.
Knee anatomy and clinical tests 2024.pdfvimalpl1234
This includes all relevant anatomy and clinical tests compiled from standard textbooks, Campbell,netter etc..It is comprehensive and best suited for orthopaedicians and orthopaedic residents.
New Drug Discovery and Development .....NEHA GUPTA
The "New Drug Discovery and Development" process involves the identification, design, testing, and manufacturing of novel pharmaceutical compounds with the aim of introducing new and improved treatments for various medical conditions. This comprehensive endeavor encompasses various stages, including target identification, preclinical studies, clinical trials, regulatory approval, and post-market surveillance. It involves multidisciplinary collaboration among scientists, researchers, clinicians, regulatory experts, and pharmaceutical companies to bring innovative therapies to market and address unmet medical needs.
Caracterización del metabolismo modificado metal pesado resistente de cupriavidus
1. Caracterización
Metabólica Modificada
de la resistencia a
metales pesados de la
Cupriavidus
metallidurans cepa
MSR33 . Generada para
la biorremediación del
mercurio.
Rojas Luis y col.
2. El mercurio es uno de los elementos mas tóxicos en el
medio ambiente.
Para contrarrestar sus efectos se han realizados
procesos fisicoquímicos tales como: el intercambio
iónico y precipitación. A su vez procesos biológicos
para su eliminación, los cuales se han impuesto
sobre los anteriores.
En bacterias existen genes de resistencia a mercurio
conocidos como “mer” los cuales se organizan en
operones. Operones como merRTPADE confieren
resistencia solo a mercurio inorgánico y como mer
RTPAGBDE confiere resistencia tanto a mercurio
orgánico como inorgánico.
En este estudio se utilizara la cepa CH34
Metallidurans Cupriavidus, esta alberga dos grandes
plásmidos: pMOL28 y Pmol30, los cuales tienen
determinantes genéticos de resistencia a metales
pesados. Ambos poseen el operon merRTPADE, para
mejorar la resistencia se introdujo en la cepa CH34 el
plasmido Ptp6 IncP-1β, lo que originó una cepa
trasconjugante MSR33 la cual fue capaz de eliminar
el mercurio de aguas contaminada.
INTRODUCCIÓN
3. Objetivos:
• General: Caracterizar el
metabolismo modificado que
dá resistencia a metales
pesados de la Cupriavidus
Metallidurans cepa MSR33.
• Específico: Generación de una
cepa bacteriana con
resistencia a metales pesados y
a su vez a mercurio orgánico e
inorgánico.
4. HIPÓTESIS
• LA CEPA MRS33 CONTIENE LAS
CARACTERISTICAS DE UN METABOLISMO
MODIFICADO PARA LA ELIMINACIÓN DEL
MERCURIO
5.
6. Materiales
• HgCl2 (analytical grade), CuSO4?5H2O, K2CrO4, NaBH4,
• NaOH, HCl (Suprapur) and standard Titrisol solution were
• obtained from Merck (Darmstadt, Germany). CH3HgCl (analytical
• grade) were obtained from Sigma Aldrich (Saint Louis, MO,
• USA). Stock solutions of Cu2+
• (5,000 mg ml21); CrO4
• 22 (2,500 mg
• ml21); Hg2+
• (1,000 mg ml21) and CH3Hg
• +
• (100 mg ml21) were
• prepared. NaBH4 solution (0.25%) was prepared in NaOH (0.4%)
• solution. High purity hydrochloric acid was used for mercury
• dilutions before quantification by inductively coupled plasma
• optical emission spectrometer (ICP-OES). Sodium succinate and
• salts for media preparation were obtained from Merck (Darmstadt,
• Germany). Taq DNA polymerase and bovine serum albumin for
• PCR were obtained from Invitrogen (Carlsbad, CA, USA). RNA
• was extracted using an RNeasy Protect Bacteria Mini kit from
• Qiagen (Hilden, Germany). For RNA quantification the QuantiT
• TM RNA Assay kit from Invitrogen (Carlsbad, CA, USA) was
• used. RT-PCR was performed using SuperScriptTM III One-Step
7. • Tampón TAE: 0.04 M Tris, 0.04 M de acetato,
0.001 M EDTA, ph=8.
• PCA: filtro estéril sobre agar para recuento en
placa
8. Medios
LB:
• 10g de triptona
• 5g de levadura
• 10 g de NaCl
LPTMS:
• 6.06 g de tris
• 4.68 g de NaCl
• 1.49 g de KCL
• 1.07 g NH4CL
• 0.43G Na2SO4
• 0.2 MgCl2.H20
• 003g CaCl2. 2H20
• 0.23g Na2HPO4.12H2O
• 0.005g Fe(III) NH4
• 1 ml de solución de
elementos traza
10. Purificación del DNA
LISIS DE
CÉLULAS
DETERGENTES
ANIÓNICOS
CONSERVANTES QUE
IMPIDEN LA ACCIÓN
DE DNasas
RNasas
Eliminar el
RNA
PRECIPITACIÓN
SALINA
ELIMINAR
PROTEÍNAS Y
CONTAMINANTES
CELULARES
PRECIPITACIÓNALCOHOL
SOLUCIÓN
TAMPONADA EN
PRESENCIA DE
CONSERVANTES
11. Extracción del plásmido
Enzimas de restricción que cortan
lugares específicos
http://www.ncbi.nlm.nih.gov/pmc/articles/PM
C217141/pdf/jbacter00274-0253.pdf
http://www.uco.es/organiza/departamentos/b
ioquimica-biol-
mol/pdfs/43%20PURIFICACI%C3%93N%20AN%
C3%81LISIS%20DNA%20BACTERIANO.pdf
12. Estabilidad del plásmido
Una colonia de
MSR33
25 ml LB24 h a 28° C
Sembró en PCA 6 Réplicas
Se selecciono 48 colonias
Hg 2+
5 de ellas
resistentes
Y esparcidas por 70
generaciones
13. PTP6
E. coli JM 109 CH34
C. metallidurans
MSR33 PCA
Selección
LPTMS
28° c
0.3
%Succinato
Hg2+PCR
GENERACIÓN DE CEPAS BACTERIANAS TRANCONJUGANTES
Purificación de Dna
y extracción del
plásmidos
14. Presencia genes de resistencia a
metales pesados.
Gen MerB:
5’ TCGCCCCATATATTTTAGAAC 3’
5’ GTCGGGACAGATGCAAAGAAA 3’
Gen ChrB:
5’ GTCGTTAGCTTGCCAACATC 3’
5’CGGAAAGCAAGATGTCGAATCG 3’
Gen CopA:
5’ GGSABTACTGGTRBCAC 3’
5’ TGNGHCATCATSGTRTCRTT 3’
residuos de PCR
Gel de agarosa Tampón TAE
Plásmidos
15. Síntesis de MerA y MerB en MSR33
MSR33 LB
Cosechadas en fase
exponencial
Se lavó 2 veces
con tampón
fosfato
1 L/ 5 mg
Se colocó en
ebullición durante 5
minutos
Centrifugación 4°C10 min
Cuantificación
de proteínas
Electroforesis
FluorómetroTinción azul
brillante
16. Efecto de Hg2+ en el crecimiento de
las células
CH34
MSR33
LPTMS
SUCCINATO
CON Y SIN Hg 2+
EXPUESTAS A FASE
INCIAL Y A FASE
EXPONENCIAL
17. Microscopia electrónica de Trasmisión
MSR33
CH34
LTMS INCUBARON
2 H
Hg2+
Centrifugación
Lavo con
tampón
fosfato
Fijadas con
Karnowsky
en tampón
cacodilato
Tetra oxido
de osmio
Deshidratación en
alcohol y acetona
Sumergieron en
una resina epoxi
Secciones
delgadas
Cuchillo de
diamante
Contrastó con
acetato de
uranilo y
citrato de
plomo
Observo con
microscopio
electrónico Zeiss
EM900
27. CONCLUSIONES:
Se generó una cepa
resistente a metales
pesados, así como a
mercurio tanto inorgánico
como orgánico.
28. REFERENCIAS
• References
• 1. von Canstein H, Li Y, Timmis KN, Deckwer WD, Wagner-Do¨bler I (1999)
• Removal of mercury from chloralkali electrolysis wastewater by a mercuryresistant
• Pseudomonas putida strain. Appl Environ Microbiol 65: 5279–5284.
• 2. Nealson KH, Belz A, McKee B (2002) Breathing metals as a way of life:
• geobiology in action. Antonie Van Leeuwenhoek 81: 215–222.
• 3. Valls M, de Lorenzo V (2002) Exploiting the genetic and biochemical capacities
• of bacteria for the remediation of heavy metal pollution. FEMS Microbiol Rev
• 26: 327–338.
• 4. Pieper DH, Seeger M (2008) Bacterial metabolism of polychlorinated biphenyls.
• J Mol Microbiol Biotechnol 15: 121–138.
• 5. Morgante V, Lo´pez-Lo´pez A, Flores C, Gonza´lez M, Gonza´lez B, et al. (2010)
• Bioaugmentation with Pseudomonas sp. strain MHP41 promotes simazine
• attenuation and bacterial community changes in agricultural soils. FEMS
• Microbiol Ecol 71: 114–126. Erratum in FEMS Microbiol Ecol (2010) 72: 152.
• 6. Saavedra JM, Acevedo F, Gonza´lez M, Seeger M (2010) Mineralization of
• PCBs by the genetically modified strain Cupriavidus necator JMS34 and its
• application for bioremediation of PCBs in soil. Appl Microbiol Biotechnol 87:
• 1543–1554.
• 7. Nascimento AM, Chartone-Souze E (2003) Operon mer: bacterial resistance to
• mercury and potential for bioremediation of contaminated environments. Genet
• Mol Res 2: 92–101.
• 8. Oehmen A, Fradinho J, Serra S, Carvalho G, Capelo JL, et al. (2009) The effect
• of carbon source on the biological reduction of ionic mercury. J Hazard Mater
• 165: 1040–1048.
• 9. Barkay T, Miller SM, Summers AO (2003) Bacterial mercury resistance from
• atoms to ecosystems. FEMS Microbiol Rev 27: 355–384.
• 10. Wagner-Do¨bler I (2003) Pilot plant for bioremediation of mercury-containing
• industrial wastewater. Appl Microbiol Biotechnol 62: 124–133.
• 11. Fatta D, Canna-Michaelidou S, Michael C, Demetriou Georgiou E,
• Christodoulidou M, et al. (2007) Organochlorine and organophosphoric
• insecticides, herbicides and heavy metals residue in industrial wastewaters in
• Cyprus. J Hazard Mater 145: 169–179.
• 12. Ritter JA, Bibler JP (1992) Removal of mercury from wastewater: large-scale
• performance of an ion exchange process. Wat Sci Technol 25: 165–172.
• 13. Chang JS, Hong J (1994) Biosorption of mercury by the inactivated cells of
• Pseudomonas aeruginosa PU21 (Rip64). Biotechnol Bioeng 44: 999–1006.
• 14. Deckwer WD, Becker FU, Ledakowicz S, Wagner-Do¨bler I (2004) Microbial
• removal of ionic mercury in a three-phase fluidized bed reactor. Environ Sci
• Technol 38: 1858–1865.
• 15. Baldrian P, in der Wiesche C, Gabriel J, Nerud F, Zadrazil F (2000) Influence of
• cadmium and mercury on activities of ligninolytic enzymes and degradation of
• polycyclic aromatic hydrocarbons by Pleurotus ostreatus in soil. Appl Environ
• Microbiol 66: 2471–2478.
• 16. Yurieva O, Kholodii G, Minakhin L, Gorlenko Z, Kalyaeva E, et al. (1997)
• Intercontinental spread of promiscuous mercury-resistance transposons in
• environmental bacteria. Mol Microbiol 24: 321–329.
• 17. Silver S, Phung LT (2005) A bacterial view of the periodic table: genes and
• proteins for toxic inorganic ions. J Ind Microbiol Biotechnol 32: 587–605.
• 18. Kiyono M, Sone Y, Nakamura R, Pan-Hou H, Sakabe K (2009) The MerE
• protein encoded by transposon Tn21 is a broad mercury transporter in
• Escherichia coli. FEBS Lett 583: 1127–1131.
• 19. Moore MJ, Distefano MD, Zydowsky LD, Cummings RT, Walsh CT (1990)
• Organomercurial lyase and mercuric ion reductase: nature’s mercury detoxification
• catalysts. Acc Chem Res 23: 301–308.
• 20. Misra TK (1992) Bacterial resistance to inorganic mercury salts and
• organomercurials. Plasmid 27: 4–16.
• 21. Kiyono M, Pan-Hou H (1999) The merG gene product is involved in
• phenylmercury resistance in Pseudomonas strain K-62. J Bacteriol 181: 762–730.
• 22. Champier L, Duarte V, Michaud-Soret I, Cove`s J (2004) Characterization of the
• MerD protein from Ralstonia metallidurans CH34: a possible role in bacterial
• mercury resistance by switching off the induction of the mer operon. Mol
• Microbiol 52: 1475–1485.
• 23. Ni’Bhriain NN, Silver S, Foster TJ (1983) Tn5 insertion mutations in the
• mercuric ion resistance genes derived from plasmid R100. J Bacteriol 155:
• 690–703.
• 24. Permina EA, Kazakov AE, Kalinina OV, Gelfand MS (2006) Comparative
• genomics of regulation of heavy metal resistance in Eubacteria. BMC Microbiol
• 6: 49–60.
• 25. Brown NL, Stoyanov JV, Kidd SP, Hobman JL (2003) The MerR family of
• transcriptional regulators. FEMS Microbiol Rev 27: 145–163.
• 26. Smalla K, Haines AS, Jones K, Kro¨gerrecklenfort E, Heuer H, et al. (2006)
• Increased abundance of IncP-1b plasmids and mercury resistance genes in
• mercury-polluted river sediments: first discovery of IncP-1b plasmids with a
• complex mer transposon as the sole accessory element. Appl Environ Microbiol
• 72: 7253–7259.
• 27. Mergeay M, Monchy S, Vallaeys T, Auquier V, Benotmane A, et al. (2003)
• Ralstonia metallidurans, a bacterium specifically adapted to toxic metals: towards a
• catalogue of metal-responsive genes. FEMS Microbiol Rev 27: 385–410.
• 28. Mergeay M, Nies D, Schlegel HG, Gerits J, Charles P, et al. (1985) Alcaligenes
• eutrophus CH34 is a facultative chemolithotroph with plasmid-bound resistance to
• heavy metals. J Bacteriol 162: 328–334.
• 29. Monchy S, Benotmane MA, Janssen P, Vallaeys T, Taghavi S, et al. (2007)
• Plasmids pMOL28 and pMOL30 of Cupriavidus metallidurans are specialized in the
• maximal response to heavy metals. J Bacteriol 189: 7417–7425.
• 30. Don RH, Pemberton JM (1981) Properties of six pesticide degradation plasmids
• isolated from Alcaligenes paradoxus and Alcaligenes eutrophus. J Bacteriol 145:
• 681–686.
29. • 31. Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: A Laboratory
• Manual, 2nd Ed., Cold Spring Harbor, New York: Cold Spring Harbor
• Laboratory Press.
• 32. Kado CI, Liu ST (1981) Rapid procedure for detection and isolation of large
• and small plasmids. J Bacteriol 145: 1365–1373.
• 33. Top E, Mergeay M, Springael D, Verstraete W (1990) Gene escape model:
• transfer of heavy metal resistances genes from Escherichia coli to Alcaligenes eutrophus
• on agar plates and in soil samples. Appl Environ Microbiol 56: 2471–2479.
• 34. Liebert CA, Wireman J, Smith T, Summers AO (1997) Phylogeny of mercury
• resistance (mer) operons of gram-negative bacteria isolated from the fecal flora of
• primates. Appl Environ Microbiol 63: 1066–1076.
• 35. Nies A, Nies DH, Silver S (1990) Nucleotide sequence and expression of a
• plasmid-encoded chromate resistance determinant from Alcaligenes eutrophus. J Biol
• Chem 265: 5648–5653.
• 36. Abou-Shanab RA, van Berkum P, Angle JS (2007) Heavy metal resistance and
• genotypic analysis of metal resistances genes in gram-positive and gram-negative
• bacteria present in Ni-rich serpentine soil and in the rhizosphere of Alyssum
• murale. Chemosphere 68: 360–367.
• 37. Lejon DP, Nowak V, Bouko S, Pascault N, Mougel C, et al. (2007)
• Fingerprinting and diversity of bacterial copA genes in response to soil types,
• soil organic status and copper contamination. FEMS Microbiol Ecol 61:
• 424–437.
• 38. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, et al. (2007)
• Clustal W and Clustal X version 2.0. Bioinformatics 23: 2947–2948.
• 39. Ca´mara B, Herrera C, Gonza´lez M, Couve E, Hofer B, et al. (2004) From PCBs
• to highly toxic metabolites by the biphenyl pathway. Environ Microbiol 6:
• 842–850.
• 40. Seeger M, Jerez CA (1993) Phosphate-starvation induced changes in Thiobacillus
• ferrooxidans. FEMS Microbiol Lett 108: 35–42.
• 41. Summers AO, Sugarman LI (1974) Cell-free mercury (II)-reducing activity in a
• plasmid-bearing strain of Escherichia coli. J Bacteriol 119: 242–249.
• 42. Fox B, Walsh CT (1982) Mercuric reductase. Purification and characterization
• of a transposon-encoded flavoprotein containing an oxidation-reduction-active
• disulfide. J Biol Chem 257: 2498–2503.
• 43. Pukall R, Tscha¨pe H, Smalla K (1996) Monitoring the spread of broad host and
• narrow host range plasmids in soil microcosms. FEMS Microbiol Ecol 20:
• 53–66.
• 44. Schlu¨ ter A, Szczepanowski R, Pu¨hler A, Top EM (2007) Genomics of IncP-1
• antibiotic resistance plasmids isolated from wastewater treatment plants provides
• evidence for a widely accessible drug resistance gene pool. FEMS Microbiol Rev
• 31: 449–477.
• 45. Kafri R, Levy M, Pilpel Y (2006) The regulatory utilization of genetic
• redundancy through responsive backup circuits. Proc Natl Acad Sci USA 103:
• 11653–11658.
• 46. Horn JM, Brunke M, Deckwer WD, Timmis KN (1994) Pseudomonas putida
• strains which constitutively overexpress mercury resistance for biodetoxification
• of organomercurial pollutants. Appl Environ Microbiol 60: 357–362.
• 47. Vaituzis Z, Nelson JD, Jr., Wan LW, Colwell RR (1975) Effects of mercuric
• chloride on growth and morphology of selected strains of mercury-resistant
• bacteria. Appl Microbiol 29: 275–286.
• 48. Janssen PJ, van Houdt R, Moors H, Monsieurs P, Morin N, et al. (2010) The
• complete genome sequence of Cupriavidus metallidurans strain CH34, a master
• survivalist in harsh and anthropogenic environments. PLoS ONE 5: e10433.
• doi:10.1371/journal.pone.0010433.
• 49. Schottel JL (1978) The mercuric and organomercurial detoxifying enzymes from
• a plasmid-bearing strain of Escherichia coli. J Biol Chem 253: 4341–4349.
• 50. Nakamura K, Nakahara H (1988) Simplified X-ray film method for detection of
• bacterial volatilization of mercury chloride by Escherichia coli. Appl Environ
• Microbiol 54: 2871–2873.
• 51. Ray S, Gachhui R, Pahan K, Chaudhury J, Mandal A (1989) Detoxification of
• mercury and organomercurials by nitrogen-fixing soil bacteria. J Biosci 14:
• 173–182.
• 52. Nakamura K, Hagimine M, Sakai M, Furukawa K (1999) Removal of mercury
• from mercury-contaminated sediments using a combined method of chemical
• leaching and volatilization of mercury by bacteria. Biodegradation 10: 443–447.
• 53. Okino S, Iwasaki K, Yagi O, Tanaka H (2000) Development of a biological
• mercury removal-recovery system. Biotechnol Lett 22: 783–788.
• 54. Saouter E, Gillman M, Barkay T (1995) An evaluation of mer-specified reduction
• of ionic mercury as a remedial tool of mercury-contaminated freshwater pond.
• J Ind Microbiol 14: 343–348.
• Novel Mercury-Resistant C. metallidurans Strain
• PLoS