This document summarizes the discovery of duplicated VegfA and KDR receptor genes in zebrafish that mediate vascular development. Specifically: - The researchers identified a duplicated zebrafish VegfA gene (VegfAb) that encodes 171- and 210-amino acid isoforms not found in the single VegfA gene. - They also found a duplicated KDR receptor gene (Kdrb) that encodes a receptor similar to mammalian KDR. - Knockdown experiments in zebrafish showed that both VegfAb and the duplicated KDR receptor genes play important roles in vascular development. - Further experiments demonstrated that the VegfAb isoforms are poorly secreted compared to VegfA isoforms

1. HEMOSTASIS, THROMBOSIS, AND VASCULAR BIOLOGY
Duplicate VegfAgenes and orthologues of the KDR receptor tyrosine kinase
family mediate vascular development in the zebrafish
Nathan Bahary,1,2 Katsutoshi Goishi,3 Carsten Stuckenholz,2 Gerhard Weber,4 Jocelyn LeBlanc,4 Christopher A. Schafer,2
Sarah S. Berman,2 Michael Klagsbrun,3 and Leonard I. Zon4
Departments of 1Medicine and 2Molecular Genetics and Biochemistry, University of Pittsburgh School of Medicine, PA; 3Vascular Biology Program, Children’s
Hospital, Boston, MA; and 4The Howard Hughes Medical Institute and the Stem Cell Program and Division of Hematology/Oncology, Children’s Hospital Boston
and Dana-Farber Cancer Institute, Boston, MA
Vascular endothelial growth factor A
(VEGFA) and the type III receptor tyrosine
kinase receptors (RTKs) are both re-
quired for the differentiation of endothe-
lial cells (vasculogenesis) and for the
sprouting of new capillaries (angiogen-
esis). We have isolated a duplicated ze-
brafish VegfA locus, termed VegfAb, and
a duplicate RTK locus with homology to
KDR/FLK1 (named Kdrb). Morpholino-
disrupted VegfAb embryos develop a nor-
mal circulatory system until approxi-
mately 2 to 3 days after fertilization (dpf),
when defects in angiogenesis permit
blood to extravasate into many tissues.
Unlike the VegfAa121 and VegfAa165 iso-
forms, the VegfAb isoforms VegfAb171 and
VegfAb210 are not normally secreted when
expressed in mammalian tissue culture
cells. The Kdrb locus encodes a 1361–
amino acid transmembrane receptor with
strong homology to mammalian KDR.
Combined knockdown of both RTKs leads
to defects in vascular development, sug-
gesting that they cooperate in mediating
the vascular effects of VegfA in zebrafish
development. Both VegfAa and VegfAb
can individually bind and promote phos-
phorylation of both Flk1 (Kdra) and Kdrb
proteins in vitro. Taken together, our data
support a model in the zebrafish, in which
duplicated VegfA and multiple type III
RTKs mediate vascular development.
(Blood. 2007;110:3627-3636)
© 2007 by The American Society of Hematology
Introduction
Differentiation of endothelial cells to form the vascular network of
arteries and veins requires a critical mitogenic signal, vascular
endothelial growth factor A (VEGFA), which is transduced to the
nucleus through a number of functionally redundant receptors.
These receptors include the type III receptor tyrosine kinases
VEGFR1/FLT1, VEGFR2/FLK1 (human KDR), and type I nonki-
nase transmembrane receptors neuropilin 1 (NRP1) and NRP2,1
which are critical mediators of both vasculogenesis (de novo
formation of blood vessels) and angiogenesis (sprouting of vessels
from preexisting vessels).2 Mice hemizygous at their single VegfA
locus show defective vasculogenesis and die between 11 and
12 days after conception (dpc).3-5 Embryos homozygous for a
targeted disruption of Flk1 (Vegfr2) die between 8.5 and 9.5 dpc
from defects in both hematopoiesis and vasculogenesis, but
disruption of Flt1 (Vegfr1) only leads to perturbed vascular
patterning in full-term embryos.6,7 The tight regulation of VEGFA
levels and the requirement for its receptors in hematopoiesis and
vasculogenesis point to its critical role in the formation of blood
vessels during development.
Differential splicing of the single VEGFA locus in humans
gives rise to multiple protein isoforms, ranging in size from 121 to
206 amino acids (aa’s) (VEGFA121, VEGFA145, VEGFA165,
VEGFA189, and VEGF206).8,9 The VEGF isoforms differ mainly by
the presence or absence of 2 heparin-binding domains encoded
within exon 6 and 7 sequences.10-12 Expression of a single VEGFA
isoform rescues VegfA mutant mice through birth, although the
vascular networks differ with expression of different isoforms.13-16
VEGFA splicing is regulated during development and in disease,
resulting in tissue- and stage-specific isoform ratios, which allow
for distinct, context-dependent VEGFA signaling.17
Zebrafish have proven useful for dissecting vascular develop-
mental pathways.18 A single zebrafish vegfA gene has been
previously described, encoding the 121- and 165-aa isoforms.19,20
Although VegfA121 is the predominant isoform in early embryos
and VegfA165 in adults, other alternate transcripts exist in specific
tissues.21 The initial establishment of axial vasculature patterning
does not require VegfA, but the sprouting of intersegmental vessels
does.22 Together, these results show that VegfA signaling is
required in zebrafish angiogenesis.
Many genes, such as the neuropilin genes, are duplicated in the
zebrafish.23-26 The 4 zebrafish neuropilin genes, 2 orthologues each
of neuropilin-1 (nrp1a and nrp1b) and of neuropilin-2 (nrp2a and
nrp2b), are differentially expressed and play an important role in
vascular development, possibly by interacting with VegfA.27-30
Previously, we have described a putative orthologue of KDR, flk1,
that is expressed in the developing embryonic vasculature.31 A
separate and yet unpublished type III RTK with homology to Flt1
(GenBank accession number: AAS92271) has been designated flt1,
reflecting the similar structure of these receptors (Stefan Schulte-
Merker, personal oral communication, June 2006).
The utility of the zebrafish as a model organism is largely based
on the conservation of pathways involved in developmental and
human disease processes.32-36 As only 2 VegfA isoforms have been
described in the zebrafish and the previously described mutant for
Submitted April 12, 2006; accepted July 11, 2007. Prepublished online
as Blood First Edition paper, August 14, 2007; DOI 10.1182/blood-
2006-04-016378.
The online version of this article contains a data supplement.
The publication costs of this article were defrayed in part by page charge
payment. Therefore, and solely to indicate this fact, this article is hereby
marked ‘‘advertisement’’ in accordance with 18 USC section 1734.
© 2007 by The American Society of Hematology
3627BLOOD, 15 NOVEMBER 2007 ⅐ VOLUME 110, NUMBER 10
For personal use only.on October 24, 2014.by guestwww.bloodjournal.orgFrom

2. zebrafish Flk1 does not phenocopy the murine Flk1 knockout, we
searched the zebrafish genome for other VegfA genes and FLK1/
KDR homologues.37 By comparison of consensus mammalian
VEGFA and KDR sequences to the available zebrafish genome, we
indeed identified a duplicated vegfA gene (hereafter referred to as
vegfAb) and a putative KDR gene (hereafter referred to as kdrb).
Zebrafish embryos with reduced levels of VegfAb, and sepa-
rately Kdra and Kdrb, show defects in vascular development. In
addition, in vitro overexpression of either the 171- or 210-aa
isoforms of VegfAb in tissue culture cells demonstrates that both
VegfAb isoforms are poorly secreted, whereas both VegfAa121 and
VegfAa165 isoforms are highly secreted. However, both VegfAa and
VegfAb can bind Kdra and Kdrb in vitro. These data support a role
for multiple VegfA and type III RTKs in zebrafish vascular
development.
Materials and methods
Zebrafish husbandry
Zebrafish were maintained and staged as described.38
Cloning, sequencing, RT-PCR, and RACE reactions
Using versions 2 and 3 of the Sanger Center zebrafish genome assembly, we
used a standard tblastn algorithm to find the duplicated genes. We designed
primers based on search results and isolated the full-length cDNA clones
using a combination of oligo dT reverse-transcription–polymerase chain
reaction (RT-PCR; BD Clontech, Palo Alto, CA) and rapid amplification of
cDNA ends (RACE; BD Clontech). We isolated total RNA for the RT-PCR
and RACE reactions from the TU strain using Absolutely RNA (Stratagene,
La Jolla, CA) and used it for the RT-PCR and RACE reactions. RT-PCR of
the open reading frames required amplification by nested PCR to visualize a
product by agarose electrophoresis. Appropriately staged cDNA was first
amplified in an MJ thermocycler (MJ Research, Watertown, MA) for
40 cycles (denaturing: 94°C for 20 seconds; annealing: 58°C for 30 seconds; and
extension: 72°C for 1 minute) using the 5Ј primer CCCTGTGTGAAGAAGC-
CGCTACT and 3Ј primer CAACCACTTCACTTCATTCTCTCG. The result-
ant reaction was diluted 1/100 and 2 ␮L used as template for a subsequent PCR
reaction using the 5Ј primer GCTTTCTGAGACCTTTACCAATGC and
3Ј primer TCTCAAGTCAGTTCGGTTCACCTCC for 30 more cycles. The
GenBank accession numbers are DQ026828 for vegfAb210, DQ150576 for
vegfAb171, and DQ026829 for kdrb.
In situ hybridization and photography
Whole-mount in situ hybridizations were performed as previously de-
scribed.31,39 Antisense RNA probes corresponded to the complete ORF of
each of the genes. Processed embryos were photographed in 90% glycerol
on a Leica MZFLIII dissecting microscope (Leica Mikrosysteme Vertrieb,
Wetzlar, Germany), PLAN Apo 1.0 objective, 8ϫ-100ϫ magnification.
Images were acquired using a Zeiss Axiocam MNRC5 camera and
Axiovision software version 4.001(both from Carl Zeiss, Thornwood, NY).
Alkaline phosphatase and hemoglobin staining
O-dianisidine staining for hemoglobin was performed as previously de-
scribed.31 Alkaline phosphate staining of the vasculature was carried out by
4% paraformaldehyde fixation of the embryos for 2 hours at room
temperature, followed by immersion in acetone for 30 minutes at Ϫ20°C.
The embryos were rinsed twice in 1 ϫ PBST (Gibco-BRL, Carlsbad, CA)
and equilibrated in staining buffer (NTMT, 100 mM Tris pH 9.5, 50 mM
MgCl2, 100 mM NaCl, 0.1% Tween-20) 3 times for 15 minutes each. The
vasculature was visualized by staining in NTMT containing NBT and BCIP
for 5 to 20 minutes.
Morpholino injections
A 1-nL volume of a 150-␮M to 2-mM morpholino (Gene-Tools, Philomath,
OR) dissolved in 1 ϫ Danio buffer containing 100 ␮M of a fluorescein
labeled control morpholino was injected into either AB or transgenic fli-gfp
embryos at the 1- to 4-cell stage.
The sequences of the injected morpholinos were as follows: VegfAa:
GTATCAAATAAACAACCAAGTTCAT; VegfAb ATG: GGAGCACGC-
GAACAGCAAAGTTCAT; VegfAb-75: TCCGATGATAGGCGCACTT-
TAGCAA; Kdra: CCGAATGATACTCCGTATGTCACTT; Kdrb-m1: TAT-
GCTCTATTAGATGCCTGTTTAA; and Kdrb-m2: CAGTTATGCT-
CTATTAGATGCCTGT.
Rescue of the VegfAb morpholino VegfAb-75 was accomplished by
subcloning the complete open reading frames (ORFs) of both Vegfab
isoforms in PCS2ϩ, and production of capped mRNA of each isoform
separately (Ambion, Austin, TX). RNA (50 pg of each) was then simulta-
neously injected with the morpholino. All injected embryos were photo-
graphed live on a Zeiss Axiovert (fluorescence) using a Zeiss Axiocam and
Axiovision software.
Affymetrix microarrays
Embryos injected with either the VegfAa, VegfAb-75 morpholinos, or
controls were grown in standard embryo medium until 24 hours after
fertilization (hpf). Embryos were then disaggregated in Trizol. Isolation of
cDNA, hybridization, and analysis of the microarrays were accomplished
as previously described.40
Cell culture and Western blotting
Chinese hamster ovary (CHO) cells, African green monkey kidney cells
(Cos7), and human embryonic kidney cells (HEK293) were purchased from
American Type Culture Collection (ATCC, Manassas, VA). Cell culture and
transfection were performed in principal as previously described.41 After
48 hours of incubation, conditioned medium of transfected cells was
collected and the transfected cells were lysed with lysis buffer (50 mM
Tris-HCl, pH 7.4, 150 mM NaCl, 1% NP40, 0.5% sodium deoxycholate,
0.1% SDS,
1 mM EDTA) supplemented with protease inhibitor cocktail (Complete
Mini; Roche, Indianapolis, IN). The conditioned medium and total cell
lysates were resolved by 6% and 10% sodium dodecyl sulfate–
polyacrylamide gel electrophoresis (SDS-PAGE) for Flk1 and VegfA,
respectively. For detection of Flk1 or VegfA proteins, the blots were
incubated with mouse monoclonal anti-V5 antibody (1:5000 dilution;
Invitrogen, Frederick, MD)
Ligand-receptor binding
HEK 293 cells were transfected with Ig␬-HA-vegfAa165-myc/pSecTag2,
Ig␬-HA-vegfAb171-myc/pSecTag2, soluble kdra-V5/pcDNA3.1, and soluble
kdrb-V5/pcDNA3.1. After 4 days of incubation, the conditioned media
were collected. The amount of VegfA and RTK was estimated by Western
blotting with anti-Myc antibody (1:2000 dilution) and mouse monoclonal
anti-V5 antibody, respectively. The conditioned media were mixed and
incubated at 4°C overnight with agitation. VegfAproteins were pulled down
by antirabbit polyclonal V5 antibody (Novus Biologicals, Littleton, CO)
and the complexes resolved by 6% SDS-PAGE. For detection of VegfA
bound to Flk1, the membranes were incubated with mouse monoclonal
anti-Myc antibody.
Results
Cloning and analysis of VegfAb and Flk1
The zebrafish vegfA gene located on zebrafish chromosome 16 encodes
multiple isoforms, but no apparent homologues of human VEGF145,
VEGFA189, or VEGFA206. We postulated that a second, duplicate
zebrafish VegfA gene might encode the missing isoforms. Using a
3628 BAHARY et al BLOOD, 15 NOVEMBER 2007 ⅐ VOLUME 110, NUMBER 10
For personal use only.on October 24, 2014.by guestwww.bloodjournal.orgFrom

3. standard tblastn algorithm, short sequence segments with homology to
mammalian VEGFA and KDR were identified using the zebrafish
genome assembly versions 2 and 3, available at the Sanger Center
website(http://www.sanger.ac.uk/Projects/D rerio/).Wefoundadupli-
cate vegfA gene, hereafter referred to as vegfAb to distinguish it from the
previously cloned vegfA gene (now termed vegfAa). This DNA se-
quence then served as the starting point for isolating the complete cDNA
from TU fish using a combination of RACE and RT-PCR. Radiation
hybrid mapping of this gene placed vegfAb on zebrafish chromosome 4,
whereas vegfAa is located on chromosome 16 (Yi Zhou, personal
written communication), November 2003).
The full-length vegfAb cDNA contained 2814 nucleotides
(nt’s) and a predicted ORF of 233 aa’s and encoded a putative
protein with stronger homology to VEGFA than VEGFB,
VEGFC, VEGFD, or PLGF (Figure 1). Therefore, the newly
identified gene appeared to be a duplicated zebrafish vegfA gene.
By RT-PCR, expression of 2 differentially spliced mRNAs was
detected from the early embryo (8 hours after fertilization [hpf])
through 4 days after fertilization (dpf) (data not shown). The
larger of 2 bands corresponded to an isoform of 210 aa’s
(VegfAb210), the smaller to a second isoform of 171 amino acids
(VegfAb171). The 2 zebrafish VegfA proteins (VegfAa and
VegfAb) were identical in size and exon structure to human
VEGFA through the first 138 aa’s (exons 1-5), suggesting
common ancestry (Figure 2A); however, insertions and dele-
tions occurred in the C-terminus, primarily in exons
6 and 7. Analysis of the genomic structure of the vegfA isoforms
by blasting against the available zebrafish genome showed 6
exons for vegfAa121, 7 for vegfAa165 and vegfAb171, and 8 for
vegfAb210; vegfAb171 and vegfAb210 share exons 1 to 5, 6, and 7
(Figure 2A). Figure 2 shows that exon use is highly conserved
between humans and zebrafish, but also that exon 6a, which
promotes mammalian VEGF binding to the basement membrane
in VEGFA145, VEGFA189, and VEGFA206, is found only in
vegfAb210. We suggest that zebrafish vegfAb210 may be the
functional equivalent of these particular VEGFA isoforms and
that vegfAb171 is orthologous to mammalian VegfA165.
By similar methods, we also obtained a 5360-nt kdrb cDNA that
encoded a novel zebrafish KDR orthologue. Alignment of critical
tyrosine residues between the zebrafish Kdrb cytoplasmic domain
and human and mouse KDR (VEGFR2) showed that the flk1-
related RTK described here is more closely related to KDR than the
previously described flk1 gene.31 In humans, tyrosine residue
Y1175 has been reported as a binding site for PLC␥1 and
Src-homology 2 protein (Shb) in ␤-cells.42 The corresponding
tyrosine residue in the mouse, Y1173, has recently been identified
as an essential tyrosine residue for vasculogenesis and hematopoi-
esis, as knock-in mice substituting it with phenylalanine exhibited
severe vascular and hematopoietic defects, similar to KDR-null
mice.43 This critical tyrosine residue was conserved in both
zebrafish Flk1 genes (Figure 2B). However, 4 important tyrosine
residues in the C-terminal tail of KDR were conserved only in the
zebrafish RTK gene reported here (Kdrb), but not in the previously
identified RTK (Figure 2B). These residues, Y1214, Y1305,
Y1309, and Y1319, mediate binding of focal adhesion kinase
(FAK), which in turn interacts with PI3 kinase and paxillin.44-47 By
radiation hybrid mapping (Yi Zhou, personal communication), the
newly identified KDR gene was located on chromosome 20 near
the zebrafish orthologues of KIT and PDGFRA, thereby establish-
ing synteny between the zebrafish, human, and mouse KDR
chromosomal regions (Figure 1C). Based on structural conserva-
tion, synteny, and biochemical data, we suggest that this RTK gene
(Kdrb) is a duplicate of the previously cloned gene flka, which we
suggest should be called Kdra. Another duplicated zebrafish type
III RTK with homology to human FLT1 (Figure 1) is located on
zebrafish chromosome 24, near the zebrafish orthologue of IPF and
CDK8 (Yi Zhou, personal communication). Although this gene is
not the subject of this paper, we suggest that it be called flt1
henceforth. The cloning and function of this FLT1 gene will be
Figure 1. Evolutionary relationship between human
and zebrafish Vegfa isoforms and receptors. Protein
sequences were aligned using ClustalW (European Bioin-
formatics Institute, Cambridge, United Kingdom) with the
complete open reading frames. Species are indicated
as follows: zf, zebrafish; m, mouse; and h, human.
(A) Alignment of VegfA proteins shows a closer relation-
ship of the newly isolated gene to VEGFA than VEGFB,
VEGFC, VEGFD, and PLGF. (B) Alignment of RTK
sequences. The zebrafish gene (Kdra) formerly referred
to as flk1 shows a closer relationship to hFLT1 and mFlt1
than to hKDR (hFLK1) and mKDR (mFlk1). (C) Radiation
hybrid mapping of zebrafish kdra, flt1, and kdrb and
synteny comparison. Zebrafish kdrb is located on chromo-
some 20 in a region syntenic to human KDR, nearby the
zebrafish orthologues of kit and pdgfra, which map near
human KDR on human chromosome 4q12. Zebrafish
kdra is on chromosome 14, and flt1 near cdk8 and ipf1 in
a region on chromosome 24, which is syntenic to the
human 13q12 region where FLT1, CDK8, and IPF1 are
located.
DUPLICATED VEGF AND KDR GENES IN ZEBRAFISH 3629BLOOD, 15 NOVEMBER 2007 ⅐ VOLUME 110, NUMBER 10
For personal use only.on October 24, 2014.by guestwww.bloodjournal.orgFrom

4. described elsewhere (Stefan Schulte-Merker, personal written
communication, February 2005).
Expression of vegfAb and kdrb during embryogenesis
To analyze the temporal and spatial expression of the zebrafish
vegfAb gene, we used whole-mount in situ hybridizations of
wild-type embryos (Figure 3A). Both vegfAa isoforms were
diffusely expressed at 12 somites, whereas at 24 hpf, although still
broadly expressed, vegfAa165 was more evident in the somites
compared with vegfAa121. At 2 dpf, expression of vegfAa165 was
nearly absent, whereas vegfAa121 is still expressed in the develop-
ing heart and associated vasculature, head, and around the develop-
ing eye. There was no clear expression of vegfAa165 at 4 dpf, and
vegfAa121 was restricted to developing pharyngeal structures and a
subset of the developing CNS. A probe detecting both isoforms of
vegfAb demonstrated significantly less expression at 12 somites
compared with either vegfAa isoform. At 24 hpf, there was
significant expression throughout the CNS and detectable, although
significantly less than seen with vegfAa165, expression within the
developing somites. At 2 dpf, expression was greatest surrounding
the developing eye and retina, the pharyngeal arches, and glo-
meruli. At 4 dpf, expression persisted in vasculature surrounding
the eye, and the glomeruli.
The expression of kdrb was indistinguishable from the expres-
sion of kdra (Figure 3B). Kdra was first expressed at about 7 to
8 somites in the bilateral stripes that contain the developing
angioblasts (data not shown) and then localized to the intermediate
cell mass (ICM) and the developing vasculature. By 30 hpf, kdra
was expressed in the major trunk, head, and intersomitic vessels
and persisted through 4 dpf. The expression patterns of kdra and
kdrb in the major vessels are consistent with roles for both
receptors in vascular development.
VegfAb morphants show defects in angiogenesis
To determine whether VegfAb is required for vasculogenesis,
angiogenesis, and hematopoiesis, either wild-type AB or transgenic
fli1-gfp embryos were injected with morpholinos against vegfAb,
and development of their vasculature and hematopoiesis was
assayed. Injection of a vegfAb morpholino either against the start
codon or the 5Ј untranslated region (UTR) caused defects in
angiogenesis evident at 2 dpf (Figure 4A), with extravasation of
blood into the surrounding tissue beginning at about 3 to 4 dpf
(Figure 4E,F,J), but had no effect on vasculogenesis, as judged by
direct fluorescent visualization and alkaline phosphatase staining
(data not shown). Indeed, red blood cells (RBCs) circulated
unimpeded through the axial vasculature. The regular expression
patterns of markers of early hematopoiesis in injected embryos,
gata1 at 15 hpf and ␤E3 globin at 30 hpf (data not shown), suggest
blood development is normal in VegfAb morphants.48
Beginning at 3 dpf, the number of circulating RBCs gradually
decreased in 63% (162/255) of the embryos injected with 4.5 ng of
the vegfAb start codon morpholino and in 47% (74/156) with 9 ng
of the vegfAb 5ЈUTR morpholino. At the same time, RBCs were
directly seen accumulating in the perivascular tissues, especially in
the brain and in the eyes (Figure 4J), accounting for the drop in
circulating RBCs. This loss was accompanied by increasing
pericardial edema and death of the injected embryos between 5 to
7 dpf. Beginning at 2 dpf, injected embryos also showed defects in
angiogenesis, particularly in the formation of intersegmental
vessels and subintestinal veins (Figure 4B,G). The subintestinal
Figure 2. Expression and structure of zebrafish VegfA genes
and receptors. (A) Zebrafish vegfA exon/intron boundaries were
predicted by blasting against the zebrafish genome. The structural
similarities between vegfAb171, vegfAa165, and human VEGFA165
suggest that vegfAb171 is an orthologue of human VEGFA165 and
similarly, that vegfAb210 is orthologous to human VEGFA189 and/or
VEGFA206. (B) Alignment of the cytoplasmic domain of zebrafish
Flk1 and human and mouse KDR. Conservation of critical tyrosine
residues (arrows) shows that the flk1 RTK described here (Kdrb)
is more closely related to KDR than the previously described
putative flk1 gene (referred to now as kdra). See “Cloning and
analysis of VegfAb and Flk1” for a full description of the critical
residues and their function.
3630 BAHARY et al BLOOD, 15 NOVEMBER 2007 ⅐ VOLUME 110, NUMBER 10
For personal use only.on October 24, 2014.by guestwww.bloodjournal.orgFrom

5. vein defects ranged from near total absence to an erratically placed
and thin vasculature (Figure 4I), the intersegmental vessels often
missing or prematurely terminated (Figure 4B,D). These defects
were more pronounced anteriorly, especially near the developing
head and perhaps accounting for the tendency for blood accumula-
tion in this area.
The VegfAa morphant phenotype differs significantly from that
of VegfAb morphants. Whereas VegfAb morphants have normal
vasculature and hematopoiesis until 2 dpf, VegfAa morphants have
a nearly complete absence of the major intersegmental vessels at
2 dpf and reduced hematopoiesis (data not shown and Nasevicius et
al22). Because injecting morpholinos against vegfAb should not
alter the VegfAa121 and VegfAa165 isoforms, we wanted to test if
coinjection of morpholinos against vegfAa and vegfAb might result
in a more severe phenotype than that seen in VegfAa morphants.
However, coinjection of morpholinos against vegfAa and vegfAb
caused a vascular phenotype indistinguishable from that of VegfAa
morphants (data not shown) and identical to the phenotype
previously described for VegfAa morphants.20,22 These data suggest
that that the role of VegfAa in angiogenesis is distinct from that of
VegfAb.
Kdrb acts synergistically with Kdra
Targeted deletion of the Flk1 gene in the mouse leads to death
around E9.5 with severe defects in both vasculogenesis and
hematopoiesis.6 Because developmental pathways are often con-
served between mice and zebrafish, we sought to determine
whether the zebrafish Kdrb receptor, alone or in combination with
Kdra, might also play a role in vasculogenesis or hematopoiesis.
Embryos were first injected with 2 independent morpholinos
directed against the 5Ј UTR of kdrb. Injection of 4.5 ng of either
morpholino did not lead to any demonstrable defect in angiogen-
esis. Variable defects in angiogenesis seen in 45 (40%) of
112 embryos injected at higher doses (Ͼ 9 ng/embryo) were also
visualized in approximately 8% of an equal amount of 5-bp
mismatch control morphants (14/184), suggesting this might due to
nonspecific toxicity of the morpholinos. Hematopoiesis was unaf-
fected in Kdrb morphants, as shown by whole-mount in situ
hybridization with gata1 at 18 hpf and with ␤E3 globin at 30 hpf
(data not shown).
Coinjecting kdrb and kdra morpholinos resulted in embryos in
variable defects in the formation of the posterior vasculature, and
most dramatically the intersegmental arteries (Figure 5C,F,I).
These coinjection experiments suggested that Kdra and Kdrb
cooperate in the growth, proliferation, and remodeling of the
developing zebrafish embryonic vasculature, and particularly for-
mation of the arteries. Compared with the murine Flk1 knockout
phenotype, however, the phenotype of zebrafish coinjected with
kdra and kdrb morpholinos was less severe and did not appear to
affect hematopoiesis. Because of the large numbers of receptors
mediating the VegfA signal and technical limitations on how many
can be knocked down by morpholino injections, it is currently not
possible to analyze vasculogenesis and angiogenesis in embryos
lacking all VegfA activity. We therefore cannot determine whether
the weaker phenotype resulted from residual Kdr-like activity or
from species-dependent differences in receptor function.
Microarray analysis of VegfAa and VegfAb morphants
Although the expression patterns and morpholino analysis of
vegfAa and vegfAb suggest that the 2 genes may function through
different pathways, the magnitude of the differences is unclear. To
help compare and contrast the pathways affected by the 2 genes, we
determined the transcriptional profile of the 2 morphants by gene
expression analysis. Affymetrix zebrafish GeneChips, containing
approximately 14 900 zebrafish transcripts were used to examine
the transcript expression of vegfAa and separately vegfAb mor-
phants at 24 hpf, when the vegfAa morpholino phenotype is clearly
evident and the embryos viable, and vegfAb was expressed. Two
individual injections of vegfAb and vegfAa morphants compared
with injected morpholino controls were made.
There was excellent correlation between the 2 injections of each
morpholino (data not shown), and no obvious nonspecific toxicities
were noted. We based further analyses on 302 genes in vegfAa
morphants, 301 genes in vegfAb morphants, and 39 genes common
to both morphants that were significantly regulated (Tables S1-S3,
available on the Blood website; see the Supplemental Materials
link at the top of the online article). When available through Zfin
(http://zfin.org/cgi-bin/webdriver?MIvalϭaa-xpatselect.apg), the
whole-mount in situ expression of the regulated gene is noted.
Figure 3. Expression of the zebrafish VegfA and Kdra genes in the developing
embryo. (A) Whole-mount in situ hybridization with probes to vegfAa121, vegfAa165,
or vegfAb. Both vegfAa121 and vegfAa165 are diffusely expressed at 12 somites,
whereas vegfAb is not appreciably expressed at this time point. At 24 hours after
fertilization (hpf), both isoforms of vegfAa were broadly expressed, although veg-
fAa165 was more clearly seen in the somites. VegfAa165 is more highly expressed in
the developing CNS than vegfAb, whereas in the lens vegfAb is more highly
expressed, and both are expressed in the developing somites (˜). At 2 dpf, vegfAa121
is expressed in the developing heart vasculature and pectoral fins. The aortic
vasculature is also identified in vegfAb in situs, but in contrast, only vegfAb is
expressed in the developing pronephros (Š). At 4 dpf, significant expression is
restricted to vegfAb in the vasculature surrounding the eye. (B) Wild-type embryos
were analyzed by whole-mount in situ hybridization with a probe to either kdrb (top
panels) or kdra (bottom panels) at 16 somites (left panels), 2 dpf (middle panels), and
4 dpf (right panels). At 16 somites, expression is limited to the inner cell mass. By 2
dpf, the developing intersomitic vasculature expresses both kdrb and kdra. At 4 dpf,
both genes are expressed in the developing subintestinal veins (SIVs) and in the
remaining vasculature. See “In situ hybridization and photography” for image
acquisition information.
DUPLICATED VEGF AND KDR GENES IN ZEBRAFISH 3631BLOOD, 15 NOVEMBER 2007 ⅐ VOLUME 110, NUMBER 10
For personal use only.on October 24, 2014.by guestwww.bloodjournal.orgFrom

6. A large number of genes affected in the vegfAa morphant that had a
specific expression pattern were found to be expressed in the
developing somites, myotomes, and CNS, while similarly, a
number of genes expressed in the pharyngeal arches, CNS, eye, and
lens were noted in vegfAb morphants. No clear expression pattern
consensus emerged from the analyses of the commonly regulated
vegfAa and vegfAb morphant genes.
We subsequently mapped our zebrafish expression values to
human genes and then uploaded the mapped expression values for
analysis with Ingenuity’s Pathway Analysis program (IPA; Ingenu-
ity Systems, Redwood City, CA), a human curated database of gene
interactions. For the vegfAa morphant, the largest numbers of genes
(37) have been implicated in “small molecule biochemistry,”
followed by 30 in “skeletal and muscular system development and
function.” In contrast, in vegfAb morphants the largest number of
genes (71) are implicated in “cellular growth and proliferation.”
A similar analysis of the 39 genes commonly altered in both vegfAa
and vegfAb morphants did not clearly reveal particular pathway
associations (data not shown).
Secretion and binding of VegfA and Flk1
VegfAa and vegfAb constructs encoding the entire ORF and fused to
a 3Ј terminal V5 tag were independently transfected into Chinese
hamster ovary (CHO), COS7 (monkey kidney), and PAE (porcine
aortic endothelial) cell lines (Figure 6). Although all 4 VegfA
isoforms could be detected in cell lysates using a V5 antibody
(Figure 6A), neither VegfAb171 nor VegfAb210 were secreted into
the conditioned medium (Figure 6B), despite a well-defined signal
peptide. Both Kdra and Kdrb can be detected in PAE cell lysates
after transfection (Figure 6C).
To determine the ligand-receptor specificity, we analyzed the
binding of soluble receptors tagged with V5 to VegfA isoforms
tagged with Myc using the Ig␬ signal peptide in place of the
VegfAb signal peptide, by which secretion of VegfAb in mamma-
lian cells occurs (Figure 6D). HEK 293 cells were separately
transfected with Ig␬-HA-vegfAa165-Myc, Ig␬-HA-vegfAb171-Myc,
soluble kdra-V5, and soluble kdrb-V5. The conditioned VegfA and
sRTK medias were pairwise mixed, incubated overnight, and then
immunoprecipitated with anti-V5 antibody. Bound protein was
detected by Western blot using an anti-Myc antibody (data not
shown). Soluble Kdra bound to both VegfAa165 and VegfAb171;
however, Kdrb did not appear to bind VegfAb171 as well as
VegfAa165 in this assay. As human VegfA has been shown to bind
multiple RTKs, we wanted to analyze if the different zebrafish
VegfA genes and isoforms acted similarly.49 The zebrafish VegfA
isoforms with an Ig␬ signal peptide and both HA and V5 tags were
transfected into COS7 cells, and their expression was confirmed by
blotting with an anti-V5 antibody (Figure 6F). Kdra and kdrb were
Figure 4. Vascular defects in VegfAb morphants.
(A) Photomicrograph of a 5-bp mismatch vegfAb morpho-
lino–injected (4.5 ng) fli1-gfp embryo at 2 dpf demon-
strates no vascular defects (only one shown, although no
phenotype was seen with either). (B) Defects in the
formation of the ISVs anteriorly are clearly visible begin-
ning at 2 dpf. (C) Photomicrograph of a 5-bp mismatch
vegfAb control morpholino–injected (4.5 ng) fli1-gfp em-
bryo at 4 dpf for comparison. (D-F) Beginning at 3 dpf, the
number of circulating RBCs gradually decreased in 63%
(162/255) of the embryos injected with 4.5 ng of the
vegfAb ATG morpholino and in 47% (74/156) with 9 ng of
the vegfAb-75 (5ЈUTR) morpholino (day-4 embryos are
shown). Injection of an equivalent amount of 5-bp mis-
match morpholinos did not affect vasculogenesis, and
coinjection of the active vegfAb-75 (5ЈUTR) morpholino
together with 50 pg each of vegfAb171 and vegfAb210 RNA
reduced the number of embryos with defects in vasculo-
genesis by more than 50% (8/32 vs 22/40 abnormal
embryo). VegfAb morphants showed decreased interseg-
mental vessel number and size (˜, Š in panels D and F)
and aberrant head vascular development. SIVs were
severely reduced in number, size, and branching that was
more pronounced anteriorly. (E) At 4 dpf, blood is appar-
ent in the head and anterior embryos (˜), which
(F) corresponds to the areas with defects in angiogen-
esis. (G) Control morpholino–injected embryos demon-
strate normal subintestinal vein (SIV) architecture by
alkaline phosphatase staining, and (H) RBCs are shown
by staining with o-dianisidine that stains hemoglobin
reddish/brown. However, (I) injection of either morpholino
targeting VegfAb leads to SIVs that are erratically placed
and thin or nearly completely absent (only the start codon
morpholino is shown) and (J) extravasation of RBCs in
various structures, which is more pronounced anteriorly
where the angiogenic defects are most visible (B-F). The
results are combined from at least 3 separate experi-
ments, and the photomicrographs are representative of
the visible defects.
3632 BAHARY et al BLOOD, 15 NOVEMBER 2007 ⅐ VOLUME 110, NUMBER 10
For personal use only.on October 24, 2014.by guestwww.bloodjournal.orgFrom

7. separately transfected into these same cell lines with and without
vegfAa165 or vegfAb171. Both vegfAa165 and vegfAb171 were able to
activate both RTKs as demonstrated by antiphosphotyrosine anti-
body staining (Figure 6E). Therefore, the zebrafish VegfAa and
VegfAb isoforms can both bind and activate Kdra and Kdrb.
Discussion
We report here the cloning and characterization of duplicated
zebrafish genes that regulate vasculogenesis and angiogenesis. In
addition to the reported VegfA locus, now renamed vegfAa, we find
a second locus, vegfAb, which contains homologues of some of the
mammalian VegfA isoforms not encoded by vegfAa. We also
identified a second zebrafish RTK (Kdrb) with homology to
mammalian KDR.
Expression of VegfAa and VegfAb during embryonic
development
Whole-mount in situ hybridization of vegfAa and vegfAb revealed
differing expression patterns of these 2 genes (Figure 3A). Whereas
both vegfAa splice variants were broadly expressed at 12 somites,
by 24 hpf, vegfAa165 was expressed in the CNS and the somites,
whereas VegfAa121 RNA was more broadly distributed, although at
48 hpf it was expressed within/near the developing heart and
vasculature. These data differ from the reported expression of
VegfA during zebrafish embryogenesis. In that study, an unspecified
probe that detected both splice variants was similarly seen in the
prospective cardiac vasculature and somites but also in the
pronephros (seen in the present studies with vegfAb165) and was not
seen as diffusely within the CNS. The reasons for these differences
are unclear but might be related to the differing time points
analyzed and the probe chosen for use in these analyses. In the
present studies, we separately used the ORF of each isoform,
whereas the previous studies were done with an unspecified probe
that recognized both alleles, and that perhaps included 3ЈUTR
sequences as well. Our whole-mount in situ hybridization data also
correlated with our microarray data. The expression of genes
whose known embryonic whole-mount in situ pattern is within the
developing CNS and myotomes was more likely to be altered in
vegfAa morphants, whereas expression of genes in the CNS, eyes,
lens, and pharyngeal arches was altered in vegfAb morphants.
Interestingly, Hiratsuka et al (2005) examined the localization of
VegfA by immunohistochemistry during murine development and
found expression throughout the developing embryo, but especially
in the anterior part of the embryo.50 This pattern more closely, but
not completely, resembles the cumulative expression of both
zebrafish VegfA genes than any one gene or splice variant. These
expression patterns suggest that the various functions of mamma-
lian VEGFA may be encompassed within more than just these
2 zebrafish VegfA genes.
The role of zebrafish Vegf and Kdr in vascular development
In VegfAb morphants, early vascular and hematopoietic development
appeared normal at first, however as early as 2 dpf, morphants had
defects in angiogenesis. Concomitant with the vascular phenotype,
blood began to extravasate into the surrounding tissues beginning at 3
dpf (Figure 4). This extravasation of blood into the tissues surrounding
the eye and CNS in vegfAb morphants is consistent with the later
expression of vegfAb RNA in the vasculature surrounding the eye
(Figure 3A), and CNS. Similar defects in angiogenesis are seen in Kdra
morphants and the previously described zebrafish Kdra mutant.37 The
intersomitic vascular defects seen in Kdra morphants appeared to
encompass more of the embryo (Figure 5H) than those in either VegfAb
Figure 5. Kdra and Kdrb cooperate to mediate vasculogenesis during zebrafish embryogenesis. Fli-gfp transgenic embryos were injected with combinations of
morpholinos against kdra and kdrb or 5-bp mismatch control morpholinos. (A) Twenty-eight hpf embryos injected with either of 2 5-bp mismatch control morpholinos (4.5 ng
each) corresponding to separate 5ЈUTR kdrb morpholinos (m1-kdrb [n ϭ 32] and m2-kdrb [n ϭ 44]) or the previously published kdra morpholino (m-kdra [n ϭ 38]) had no
vascular abnormalities. (B) Injection of 4.5 ng kdra or kdrb morpholino has no demonstrable effect on vasculogenesis at 28 hpf (107 embryos). Vascular defects were seen at
higher concentrations of kdrb morpholinos; however, similar defects, but at a reduced penetrance, were also seen with equivalent amounts of the mismatched controls,
suggesting these effects were not directly related to Kdrb function. (C) Coinjection of either 4.5 ng m1-kdrb or m2-kdrb with 4.5ng kdra morpholino caused variable loss of
intersegmental arteries in 42 (24%) of 178 kdra/m1-kdrb or 53 (38%) of 138 kdra/m2-kdrb morpholino–injected embryos. (D) RBCs are seen in the anterior axial vasculature but
cannot circulate. (E,F) Kdra/kdrb double morphant defects are still seen at 2 dpf. (G-I) At 4 dpf, injection of 4.5 ng kdra morpholino led to defects in the angiogenesis (Š, ˜) in
34 (33%) of 101 injected embryos. Embryos coinjected with morpholinos targeting both kdra/b had severe axial vessel defects, although some subintestinal vasculature is
apparent. The results are combined from at least 4 separate experiments and the photomicrographs are representative of the visible defects.
DUPLICATED VEGF AND KDR GENES IN ZEBRAFISH 3633BLOOD, 15 NOVEMBER 2007 ⅐ VOLUME 110, NUMBER 10
For personal use only.on October 24, 2014.by guestwww.bloodjournal.orgFrom

8. morphant, whose defects were more pronounced anteriorly (Figure
4B,D). Whether this result is secondary to redundant signals activating
Kdra or variable penetration of the VegfAb and Kdra morpholino
phenotype is uncertain. Reducing all known VegfA signals by coinjec-
tion of morpholinos against vegfAa (previously described in Nasevicius
et al22) and vegfAb resulted in the same vascular phenotype seen in
VegfAa morphants. Loss of VegAa and VegfAb signaling in the
zebrafish does not cause death in the developing embryo in the first
few days of development, unlike in mice where hemizygous VegfA
mutants show defective vasculogenesis and die between 11 and 12 days
after conception (dpc).3-5 These differences are likely secondary to the
ability of oxygen to diffuse directly into the embryo. Homozygous
cloche embryos, which lack all endothelium and circulating erythro-
cytes do not die until 4 to 5 dpf.31,51,52 These results may also be due to
activity of other molecules, such as Vegfc, that retain activity in these
studies.53 However, these data are consistent with a model in which
VegfAa and VegfAb have functionally diverged since arising from a
common ancestor.
Beginning at 3 dpf, a delay in further maturation was seen in
VegfAb morphants compared with controls (Figure 4C,D). How-
ever, 2 lines of evidence support our contention that the defects in
vascular development were not caused by a general developmental
delay in VegfAb morphants. The first is that the angiogenic defects
were seen in both active VegfAb morpholinos, and not in their 5-bp
mismatch injected controls. The second is that the defects in
angiogenesis were visible at 2 dpf, when no overall differences in
appearance were seen between the morphants and their controls.
We further believe these defects are specific to the loss of VegfAb
functioning in the injected embryos. Injection of equivalent
amounts of 5-bp mismatch morpholinos did not affect vascular
development, and coinjection of the active VegfAb-75 morpholino
that targets the 5ЈUTR upstream of the start codon, with 50 pg each
vegfAb171 and vegfAb210 RNA, reduced the number of embryos with
severe defects in angiogenesis by more than 50% (8/32 vs 22/40
abnormal embryo).
Multiple RTK receptors are required for normal zebrafish
vascular development
Morpholinos targeting both Kdra and Kdrb resulted in defects in
vasculogenesis, especially of the intersegmental arteries, support-
ing a common pathway resulting from RTK activation leading to
embryonic zebrafish vascular development. Yet compared with the
knockout mouse, the phenotype of the combined morphant is less
severe, possibly because of residual activity of the zebrafish flt1
gene, or possibly because other zebrafish genes may have acquired
roles in vasculogenesis and angiogenesis. Lending support to these
possibilities is that zebrafish treated with the type III RTK VEGF
receptor inhibitor PTK787/ZK222584, which blocks all VEGF
receptor activity, lack all major blood vessels.54
An alternative explanation for the differences seen between the
murine KDR knockout and the zebrafish KDR morphant pheno-
types is because of evolutionary changes to the molecular function
of zebrafish RTKs and other genes. For example, the zebrafish
phospholipase C ␥-1 (plc␥1) mutant displays only a subset of the
defects seen in Plc␥1 knockout mice. Significantly, the zebrafish
plc␥1 mutant fails to replicate the complete defect of
erythropoiesis.55,56
The overlapping expression patterns of Kdra and Kdrb, com-
bined with the differential knockdown phenotypes seen in these
studies, suggest that it is not the expression of these RTKs that
generates differential development of the vascular system. We
instead speculate that differences in ligand expression and/or other
not yet described RTKs in the zebrafish account for these differ-
ences. These data are essentially similar to those seen by Covassin
et al in their studies of these 2 RTK receptors.57 In their report, they
described the morphant phenotypes of Kdra and Kdrb and extended
their observations of the interaction between these 2 RTKs to their
differing interactions in the formation of veins and arteries. With
these experiments, we have extended their findings to demonstrate
that multiple Vegfs can bind and activate these 2 RTKs. The
successful in vitro expression and activation of both zebrafish Kdrs
by both VegfA genes support a model in which both VegfA loci
may signal through multiple RTKs. We can further hypothesize that
these interactions may account for some of the complexities of
VegfA signaling seen in developmental and pathological studies.
Transfection of native zebrafish vegfA constructs into mamma-
lian cell lines showed that VegfAa121 and VegfAa165 are secreted,
but VegfAb171 and VegfAb210 are not, even though a well-defined
signal peptide is present. Although it is possible to speculate that
the VegfAb isoforms are secreted by a novel zebrafish-specific
mechanism in vivo, this effect may be due to the nature of zebrafish
signal peptide recognition in a mammalian cell culture system.
Because of the ease with which zebrafish genes can be targeted
and studied, we believe that the zebrafish will make important
contributions to understanding these pathways. In addition, newly
available mutant alleles and chemical inhibitors will enable a more
Figure 6. VegfAb secretion and binding. Full-length vegfAa121, vegfAa165, veg-
fAb171, and vegfAb210 tagged with a V5 epitope at the N-termini were transfected into
COS7 cells. (A) Western blot with a V5 antibody showed that although all 4 proteins
are detectable in cell lysates (B) only VegfAa121 and VegfAa165 were secreted.
(C) Transfected full-length kdra and kdrb fused to a V5 epitope were detectable in cell
lysates of COS7 cells. (D) Replacing the endogenous signal peptide on all isoforms
with the Ig␬ signal peptide resulted in secretion of both VegfAa and VegfAb. HEK 293
cells were transfected individually with Ig␬-HA-vegfAa165-Myc, Ig␬-HA-vegfAb171-
Myc, soluble kdra-V5, and soluble kdrb-V5. Transfected cells were grown for 4 days,
and conditioned media were collected, mixed, and incubated overnight. Immunopre-
cipitation (IP) with a V5 antibody (RTKs), blotting with Myc antibody (VegfAs),
demonstrates that soluble Kdra bound to both VegfAa165 and VegfAb171; however,
Kdrb did not appear to bind VegfAb171 as well as VegfAa165 in this assay.
(E) Ig␬-HA-vegfA-V5 constructs and Kdra-V5/pcDNA3.1 or Kdrb-V5/pcDNA3.1 were
cotransfected into COS7 cells blotted with antiphosphotyrosine antibody, indicating
activation of both RTKs by both VegfAa and VegfAb or (F) anti-V5 antibody
demonstrating expression of the Kdra or Kdrb proteins.
3634 BAHARY et al BLOOD, 15 NOVEMBER 2007 ⅐ VOLUME 110, NUMBER 10
For personal use only.on October 24, 2014.by guestwww.bloodjournal.orgFrom

9. complete block of VegfA signaling and identify the individual
contributions of the different, redundant signal molecules and their
receptors to vasculogenesis and hematopoiesis. As it becomes
increasingly clear that vasculogenesis and angiogenesis act not
only in embryonic development, but also in the adult to modulate
wound healing, tissue regeneration, and progression of human
diseases, the VegfA signaling pathway will become an important
target for new molecular medicines.58-60 Because of its unique
characteristics, the zebrafish system is an excellent system to model
human development and disease and a detailed understanding of
vasculogenesis and angiogenesis in the zebrafish will help make
new medicines in this area a reality.
Acknowledgments
This work was supported in part by grants from the Crohn’s and
Colitis Foundation of America, March of Dimes, National Insti-
tutes of Health (NIH) K08 HL03777 (N.B.), and NIH/National
Cancer Institute 45548 (M.K.).
Authorship
Contribution: N.B. designed and performed research, analyzed
data, and wrote the paper; K.G. designed and performed research
and analyzed data; C.S. performed research, analyzed data, and
wrote the paper; G.W. performed research and analyzed data; J.L.,
C.A.S., and S.S.B. performed research; and M.K. and L.I.Z.
designed research.
Conflict-of-interest disclosure: The authors declare no compet-
ing financial interests.
Correspondence: Nathan Bahary, University of Pittsburgh,
3501 5th Ave, 5058 BST3, Pittsburgh, PA 15260; e-mail:
bahary@pitt.edu.
References
1. Klagsbrun M, Takashima S, Mamluk R. The role
of neuropilin in vascular and tumor biology. Adv
Exp Med Biol. 2002;515:33-48.
2. Risau W. Mechanisms of angiogenesis. Nature.
1997;386:671-674.
3. Ferrara N, Carver-Moore K, Chen H, et al. Het-
erozygous embryonic lethality induced by tar-
geted inactivation of the VEGF gene. Nature.
1996;380:439-442.
4. Carmeliet P, Ferreira V, Breier G, et al. Abnormal
blood vessel development and lethality in em-
bryos lacking a single VEGF allele. Nature. 1996;
380:435-439.
5. Carmeliet P, Moons L, Dewerchin M, et al. In-
sights in vessel development and vascular disor-
ders using targeted inactivation and transfer of
vascular endothelial growth factor, the tissue fac-
tor receptor, and the plasminogen system. Ann N
Y Acad Sci. 1997;811:191-206.
6. Shalaby F, Rossant J, Yamaguchi TP, et al. Fail-
ure of blood-island formation and vasculogenesis
in Flk-1-deficient mice. Nature. 1995;376:62-66.
7. Fong GH, Zhang L, Bryce DM, Peng J. Increased
hemangioblast commitment, not vascular disor-
ganization, is the primary defect in flt-1 knock-out
mice. Development. 1999;126:3015-3025.
8. Ng YS, Rohan R, Sunday ME, Demello DE,
D’Amore PA. Differential expression of VEGF iso-
forms in mouse during development and in the
adult. Dev Dyn. 2001;220:112-121.
9. Robinson CJ, Stringer SE. The splice variants of
vascular endothelial growth factor (VEGF) and
their receptors. J Cell Sci. 2001;114:853-865.
10. Tischer E, Mitchell R, Hartman T, et al. The hu-
man gene for vascular endothelial growth factor:
multiple protein forms are encoded through alter-
native exon splicing. J Biol Chem. 1991;266:
11947-11954.
11. Folkman J, Shing Y. Control of angiogenesis by
heparin and other sulfated polysaccharides. Adv
Exp Med Biol. 1992;313:355-364.
12. Neufeld G, Cohen T, Gengrinovitch S, Poltorak Z.
Vascular endothelial growth factor (VEGF) and its
receptors. Faseb J. 1999;13:9-22.
13. Stalmans I, Ng YS, Rohan R, et al. Arteriolar and
venular patterning in retinas of mice selectively
expressing VEGF isoforms. J Clin Invest. 2002;
109:327-336.
14. Carmeliet P, Ng YS, Nuyens D, et al. Impaired
myocardial angiogenesis and ischemic cardiomy-
opathy in mice lacking the vascular endothelial
growth factor isoforms VEGF164 and VEGF188.
Nat Med. 1999;5:495-502.
15. Mattot V, Moons L, Lupu F, et al. Loss of the
VEGF(164) and VEGF(188) isoforms impairs
postnatal glomerular angiogenesis and renal ar-
teriogenesis in mice. J Am Soc Nephrol. 2002;13:
1548-1560.
16. Zelzer E, McLean W, Ng YS, et al. Skeletal de-
fects in VEGF(120/120) mice reveal multiple roles
for VEGF in skeletogenesis. Development. 2002;
129:1893-1904.
17. Ruhrberg C. Growing and shaping the vascular
tree: multiple roles for VEGF. Bioessays. 2003;
25:1052-1060.
18. Goishi K, Klagsbrun M. Vascular endothelial
growth factor and its receptors in embryonic ze-
brafish blood vessel development. Curr Top Dev
Biol. 2004;62:127-152.
19. Liang D, Xu X, Chin AJ, et al. Cloning and charac-
terization of vascular endothelial growth factor
(VEGF) from zebrafish, Danio rerio. Biochim Bio-
phys Acta. 1998;1397:14-20.
20. Liang D, Chang JR, Chin AJ, et al. The role of
vascular endothelial growth factor (VEGF) in vas-
culogenesis, angiogenesis, and hematopoiesis in
zebrafish development. Mech Dev. 2001;108:29-
43.
21. Gong B, Liang D, Chew TG, Ge R. Characteriza-
tion of the zebrafish vascular endothelial growth
factor A gene: comparison with vegf-A genes in
mammals and Fugu. Biochim Biophys Acta.
2004;1676:33-40.
22. Nasevicius A, Larson J, Ekker SC. Distinct re-
quirements for zebrafish angiogenesis revealed
by a VEGF-A morphant. Yeast. 2000;17:294-301.
23. Force A, Lynch M, Pickett FB, Amores A, Yan YL,
Postlethwait J. Preservation of duplicate genes
by complementary, degenerative mutations. Ge-
netics. 1999;151:1531-1545.
24. Shimeld SM. Gene function, gene networks and
the fate of duplicated genes. Semin Cell Dev Biol.
1999;10:549-553.
25. Jozefowicz C, McClintock J, Prince V. The fates
of zebrafish Hox gene duplicates. J Struct Funct
Genomics. 2003;3:185-194.
26. Furutani-Seiki M, Wittbrodt J. Medaka and ze-
brafish, an evolutionary twin study. Mech Dev.
2004;121:629-637.
27. Bovenkamp DE, Goishi K, Bahary N, et al. Ex-
pression and mapping of duplicate neuropilin-1
and neuropilin-2 genes in developing zebrafish.
Gene Expr Patterns. 2004;4:361-370.
28. Martyn U, Schulte-Merker S. Zebrafish neuropi-
lins are differentially expressed and interact with
vascular endothelial growth factor during embry-
onic vascular development. Dev Dyn. 2004;231:
33-42.
29. Yu HH, Houart C, Moens CB. Cloning and embry-
onic expression of zebrafish neuropilin genes.
Gene Expr Patterns. 2004;4:371-378.
30. Lee P, Goishi K, Davidson AJ, Mannix R, Zon L,
Klagsbrun M. Neuropilin-1 is required for vascular
development and is a mediator of VEGF-depen-
dent angiogenesis in zebrafish. Proc Natl Acad
Sci U S A. 2002;99:10470-10475.
31. Thompson MA, Ransom DG, Pratt SJ, et al. The
cloche and spadetail genes differentially affect
hematopoiesis and vasculogenesis. Dev Biol.
1998;197:248-269.
32. Bahary N, Zon LI. Use of the zebrafish (Danio
rerio) to define hematopoiesis. Stem Cells. 1998;
16(suppl 2):67-78.
33. Barut BA, Zon LI. Realizing the potential of ze-
brafish as a model for human disease. Physiol
Genomics. 2000;2:49-51.
34. Thisse C, Zon LI. Organogenesis: heart and
blood formation from the zebrafish point of view.
Science. 2002;295:457-462.
35. Trede NS, Langenau DM, Traver D, Look AT, Zon
LI. The use of zebrafish to understand immunity.
Immunity. 2004;20:367-379.
36. Stuckenholz C, Ulanch PE, Bahary N. From guts
to brains: using zebrafish genetics to understand
the innards of organogenesis. Curr Top Dev Biol.
2005;65:47-82.
37. Habeck H, Odenthal J, Walderich B, Maischein H,
Schulte-Merker S, Tu¨bingen 2000 screen consor-
tium. Analysis of a zebrafish VEGF receptor mu-
tant reveals specific disruption of angiogenesis.
Curr Biol. 2002;12:1405–1412.
38. Westerfield M. The Zebrafish Book: A Guide for
the Laboratory Use of Zebrafish (Danio rerio). 4th
ed. Eugene, OR: University of Oregon Press;
2000.
39. Galloway JL, Wingert RA, Thisse C, Thisse B,
Zon LI. Loss of gata1 but not gata2 converts
erythropoiesis to myelopoiesis in zebrafish em-
bryos. Dev Cell. 2005;8:109-116.
40. Weber GJ, Choe SE, Dooley KA, Paffett-Lugassy
NN, Zhou Y, Zon LI. Mutant-specific gene pro-
grams in the zebrafish. Blood. 2005;106:521-530.
41. Goishi K, Lee P, Davidson AJ, Nishi E, Zon LI,
Klagsbrun M. Inhibition of zebrafish epidermal
growth factor receptor activity results in cardio-
vascular defects. Mech Dev. 2003;120:811-822.
42. Holmqvist K, Cross MJ, Rolny C, et al. The adap-
tor protein shb binds to tyrosine 1175 in vascular
endothelial growth factor (VEGF) receptor-2 and
DUPLICATED VEGF AND KDR GENES IN ZEBRAFISH 3635BLOOD, 15 NOVEMBER 2007 ⅐ VOLUME 110, NUMBER 10
For personal use only.on October 24, 2014.by guestwww.bloodjournal.orgFrom

10. regulates VEGF-dependent cellular migration.
J Biol Chem. 2004;279:22267-22275.
43. Sakurai Y, Ohgimoto K, Kataoka Y, Yoshida N,
Shibuya M. Essential role of Flk-1 (VEGF recep-
tor 2) tyrosine residue 1173 in vasculogenesis in
mice. Proc Natl Acad Sci U S A. 2005;102:1076-
1081.
44. Takahashi T, Yamaguchi S, Chida K, Shibuya M.
A single autophosphorylation site on KDR/Flk-1 is
essential for VEGF-A-dependent activation of
PLC-gamma and DNA synthesis in vascular en-
dothelial cells. EMBO J. 2001;20:2768-2778.
45. Avraham HK, Lee TH, Koh Y, et al. Vascular en-
dothelial growth factor regulates focal adhesion
assembly in human brain microvascular endothe-
lial cells through activation of the focal adhesion
kinase and related adhesion focal tyrosine ki-
nase. J Biol Chem. 2003;278:36661-36668.
46. Takahashi N, Seko Y, Noiri E, et al. Vascular en-
dothelial growth factor induces activation and
subcellular translocation of focal adhesion kinase
(p125FAK) in cultured rat cardiac myocytes. Circ
Res. 1999;84:1194-1202.
47. Kliche S, Waltenberger J. VEGF receptor signal-
ing and endothelial function. IUBMB Life. 2001;
52:61-66.
48. Brownlie A, Hersey C, Oates AC, et al. Character-
ization of embryonic globin genes of the ze-
brafish. Dev Biol. 2003;255:48-61.
49. Waltenberger J, Claesson-Welsh L, Siegbahn A,
Shibuya M, Heldin CH. Different signal transduc-
tion properties of KDR and Flt1, two receptors for
vascular endothelial growth factor. J Biol Chem.
1994;269:26988-26995.
50. Hiratsuka S, Kataoka Y, Nakao K, et al. Vascular
endothelial growth factor A (VEGF-A) is involved
in guidance of VEGF receptor-positive cells to the
anterior portion of early embryos. Mol Cell Biol.
2005;25:355-363.
51. Goishi K, Shimizu A, Najarro G, et al. {alpha}A-
crystallin expression prevents {gamma}-crystallin
insolubility and cataract formation in the zebrafish
cloche mutant lens. Development. 2006;133:
2585-2593.
52. Dooley KA, Davidson AJ, Zon LI. Zebrafish scl
functions independently in hematopoietic and en-
dothelial development. Dev Biol. 2005;277:522-
536.
53. Ober EA, Olofsson B, Makinen T, et al. Vegfc is
required for vascular development and endoderm
morphogenesis in zebrafish. EMBO Rep. 2004;5:
78-84.
54. Chan J, Bayliss PE, Wood JM, Roberts TM. Dis-
section of angiogenic signaling in zebrafish using
a chemical genetic approach. Cancer Cell. 2002;
1:257-267.
55. Liao HJ, Kume T, McKay C, Xu MJ, Ihle JN, Car-
penter G. Absence of erythrogenesis and vascu-
logenesis in Plcg1-deficient mice. J Biol Chem.
2002;277:9335-9341.
56. Lawson ND, Mugford JW, Diamond BA, Wein-
stein BM. Phospholipase C gamma-1 is required
downstream of vascular endothelial growth factor
during arterial development. Genes Dev. 2003;
17:1346-1351.
57. Covassin LD, Villefranc JA, Kacergis MC, Wein-
stein BM, Lawson ND. Distinct genetic interac-
tions between multiple Vegf receptors are re-
quired for development of different blood vessel
types in zebrafish. Proc Natl Acad Sci U S A.
2006;103:6554-6559.
58. Franson PJ, Lapka DV. Antivascular endothelial
growth factor monoclonal antibody therapy: a
promising paradigm in colorectal cancer. Clin J
Oncol Nurs. 2005;9:55-60.
59. van Wijngaarden P, Coster DJ, Williams KA. In-
hibitors of ocular neovascularization: promises
and potential problems. JAMA. 2005;293:1509-
1513.
60. Carmeliet P, Jain RK. Angiogenesis in cancer and
other diseases. Nature. 2000;407:249-257.
3636 BAHARY et al BLOOD, 15 NOVEMBER 2007 ⅐ VOLUME 110, NUMBER 10
For personal use only.on October 24, 2014.by guestwww.bloodjournal.orgFrom