This document discusses genome annotation using the Apollo annotation editor. It provides instructions for logging into Apollo servers using assigned usernames and passwords. It demonstrates Apollo's features for editing gene models, such as changing coordinates, folding introns, and altering sequences to indicate substitutions, insertions, deletions, or impacts. Ontological descriptions are shown for representing genotypes and genomic variants.
The document discusses various aspects of conducting research including:
- Defining research as the act of carefully searching for or investigating a subject through consideration or scientific inquiry.
- Outlining some key steps in the research process such as formulating hypotheses, making predictions, and empirically testing predictions through experiments.
- Emphasizing the importance of evaluating sources and considering what happens when answers cannot be found.
Designing a community resource - Sandra OrchardEMBL-ABR
The document discusses designing a new community resource called the Complex Portal to describe protein complexes. It emphasizes conducting user studies, using community standards to enable data sharing and tool interoperability, and obtaining community input to ensure the resource meets researcher needs. Standards like PSI-MI and controlled vocabularies allow the resource to integrate data from other sources and enable sophisticated searches. Outreach is important to establish the resource as the primary reference.
APOLOGETICS APPLICATION PAPER – PART 1 SUBMISSION FORMMake sur.docxfestockton
APOLOGETICS APPLICATION PAPER – PART 1 SUBMISSION FORM
Make sure you read and understand the Apologetics Application Paper Instructions document (available in Blackboard) before you attempt to complete any part of this form.
Do not change any aspect of this form; and do not delete anything from this form. Instead, just type your content in the spaces provided, below. Before typing your content, you should review the entire document to be sure you understand what is required.
Type your name here: Rachelle Pope
Type the submission date here: February 3, 2020
Instructions for this submission
The purpose of Part 1 is to provide you with a few major building blocks that can be incorporated into your final paper. In the sections provided below, you will name the worldview you will be writing about, you will list a few sources you will use in your research, and you will begin building the foundation for what will become the first two major sections in the body of your final paper.
1. Worldview Selection
The Apologetics Application Paper Instructions indicate three choices: secular humanism, scientific naturalism, or postmodernism. Of these three, which will you write your paper about?
Type your selected worldview here: Scientific Naturalism
2. Preliminary List of Sources
Not including your course textbooks, list 3–4 sources that you will use in the paper. At this stage of the project, you should focus on sources that help you understand and evaluate the worldview you have selected to write about. You should do your best to focus on “scholarly” sources (see the Apologetics Application Paper instructions for a definition and explanation of what “scholarly” means). Format each according to current Turabian and LUSD requirements for a bibliography.
Griffin, David R. Religion and Scientific Naturalism: Overcoming the Conflicts. Albany, NY: SUNY Press, (2000).
Moreland, James P. What is Scientific Naturalism? Accessed March 4, 2004. https://www.boundless.org/faith/what-is-scientific-naturalism/
Papineau, David. Naturalism (Stanford Encyclopedia of Philosophy). https://plato.stanford.edu/entries/naturalism/, (2017).
Planck, Max. Can science explain everything? Scientific Naturalism and the, death of Science by Denis Alexander. Accessed September 8, 2014. http://www.jubilee-centre.org/can-science-explain-everything-scientific-naturalism-and-the-death-of-science-by-denis-r-alexander/
The remainder of this form will help you begin working on what will become the first two major sections of your final paper – the summary and evaluation of the worldview you are writing about.
The Apologetics Application Paper Instructions indicate that the basic outline for your final paper should follow this structure:
I. Introduction
II. Summary of the Worldview
III. Evaluation of the Worldview
IV. Evaluation of Christianity
V. Defense of Christianity
VI. Conclusion
In what follows, you will be crafting the building blocks that will eventually become sections II and ...
Astronomy is primarily an observational science where scientists cannot actively experiment on celestial objects. Scientists use large surveys to collect data on many objects to look for variations. Population studies examine limited groups that share properties to see how features relate. Coordinate systems like altitude-azimuth and right ascension-declination are used to precisely map the positions of stars and other objects in the sky.
Can there be such a thing as Ontology Engineering?robertstevens65
- Ontology engineering aims to apply principles of engineering such as predictability, reproducibility, and strict semantics to the development of ontologies.
- Current ontology development relies heavily on craft and individual expertise rather than established engineering processes.
- For ontology engineering to be established, methods are needed to standardize development practices, evaluate ontologies, and demonstrate that independent groups can engineer ontologies to meet requirements in a consistent manner. The field is still in its early stages of applying engineering rigor.
DRUGS New agreement to tackle pharmaceutical pollution p.1AlyciaGold776
DRUGS New agreement to
tackle pharmaceutical
pollution p.164
WORLD VIEW Vaccination
the best way to measure
health care p.165
DUNG OVER Rolling beetles
fooled by look-alike
seeds p.167
Let’s think about cognitive bias
The human brain’s habit of finding what it wants to find is a key problem for research. Establishing
robust methods to avoid such bias will make results more reproducible.
“Ever since I first learned about confirmation bias I’ve been see-ing it everywhere.” So said British author and broadcaster Jon Ronson in So You’ve Been Publicly Shamed (Picador, 2015).
You will see a lot of cognitive bias in this week’s Nature. In a series
of articles, we examine the impact that bias can have on research, and
the best ways to identify and tackle it. One enemy of robust science
is our humanity — our appetite for being right, and our tendency to
find patterns in noise, to see supporting evidence for what we already
believe is true, and to ignore the facts that do not fit.
The sources and types of such cognitive bias — and the fallacies they
produce — are becoming more widely appreciated. Some of the prob-
lems are as old as science itself, and some are new: the IKEA effect, for
example, describes a cognitive bias among consumers who place artifi-
cially high value on products that they have built themselves. Another
common fallacy in research is the Texas sharp-shooter effect — fir-
ing off a few rounds and then drawing a bull’s eye around the bullet
holes. And then there is asymmetrical attention: carefully debugging
analyses and debunking data that counter a favoured hypothesis, while
letting evidence in favour of the hypothesis slide by unexamined.
Such fallacies sound obvious and easy to avoid. It is easy to think that
they only affect other people. In fact, they fall naturally into investiga-
tors’ blind spots (see page 182).
Advocates of robust science have repeatedly warned against cogni-
tive habits that can lead to error. Although such awareness is essential,
it is insufficient. The scientific community needs concrete guidance on
how to manage its all-too-human biases and avoid the errors they cause.
That need is particularly acute in statistical data analysis, where
some of the best-established methods were developed in a time before
data sets were measured in terabytes, and where choices between tech-
niques offer abundant opportunity for errors. Proteomics and genom-
ics, for example, crunch millions of data points at once, over thousands
of gene or protein variants. Early work was plagued by false positives,
before the spread of techniques that could account for the myriad
hypotheses that such a data-rich environment could generate.
Although problems persist, these fields serve as examples of commu-
nities learning to recognize and curb their mistakes. Another example is
the venerable practice of double-blind studies. But more effort is needed,
particularly in what some have called evidence- ...
Berlin Summer School Presentation Olsen Data Epistemology and Methods Paradig...Wendy Olsen
Berlin Summer School in Social Science. Presentation by Wendy Olsen on Epistemology (Aspects of Knowing) in Methodological Paradigms (Schools of Thought)
Realism, Constructivism, Positivism, Empiricism
Data, Epistemology, Methodology, and Methods Paradigms. Data Collection [book] London: Sage 2012 Date of presentation, July 23, 2014.
Why I am Not a Philosopher (October 2006)Barry Smith
Forms part of a training course in ontology given in Buffalo in 2009. For details and accompanying video see http://ontology.buffalo.edu/smith/IntroOntology_Course.html
The document discusses various aspects of conducting research including:
- Defining research as the act of carefully searching for or investigating a subject through consideration or scientific inquiry.
- Outlining some key steps in the research process such as formulating hypotheses, making predictions, and empirically testing predictions through experiments.
- Emphasizing the importance of evaluating sources and considering what happens when answers cannot be found.
Designing a community resource - Sandra OrchardEMBL-ABR
The document discusses designing a new community resource called the Complex Portal to describe protein complexes. It emphasizes conducting user studies, using community standards to enable data sharing and tool interoperability, and obtaining community input to ensure the resource meets researcher needs. Standards like PSI-MI and controlled vocabularies allow the resource to integrate data from other sources and enable sophisticated searches. Outreach is important to establish the resource as the primary reference.
APOLOGETICS APPLICATION PAPER – PART 1 SUBMISSION FORMMake sur.docxfestockton
APOLOGETICS APPLICATION PAPER – PART 1 SUBMISSION FORM
Make sure you read and understand the Apologetics Application Paper Instructions document (available in Blackboard) before you attempt to complete any part of this form.
Do not change any aspect of this form; and do not delete anything from this form. Instead, just type your content in the spaces provided, below. Before typing your content, you should review the entire document to be sure you understand what is required.
Type your name here: Rachelle Pope
Type the submission date here: February 3, 2020
Instructions for this submission
The purpose of Part 1 is to provide you with a few major building blocks that can be incorporated into your final paper. In the sections provided below, you will name the worldview you will be writing about, you will list a few sources you will use in your research, and you will begin building the foundation for what will become the first two major sections in the body of your final paper.
1. Worldview Selection
The Apologetics Application Paper Instructions indicate three choices: secular humanism, scientific naturalism, or postmodernism. Of these three, which will you write your paper about?
Type your selected worldview here: Scientific Naturalism
2. Preliminary List of Sources
Not including your course textbooks, list 3–4 sources that you will use in the paper. At this stage of the project, you should focus on sources that help you understand and evaluate the worldview you have selected to write about. You should do your best to focus on “scholarly” sources (see the Apologetics Application Paper instructions for a definition and explanation of what “scholarly” means). Format each according to current Turabian and LUSD requirements for a bibliography.
Griffin, David R. Religion and Scientific Naturalism: Overcoming the Conflicts. Albany, NY: SUNY Press, (2000).
Moreland, James P. What is Scientific Naturalism? Accessed March 4, 2004. https://www.boundless.org/faith/what-is-scientific-naturalism/
Papineau, David. Naturalism (Stanford Encyclopedia of Philosophy). https://plato.stanford.edu/entries/naturalism/, (2017).
Planck, Max. Can science explain everything? Scientific Naturalism and the, death of Science by Denis Alexander. Accessed September 8, 2014. http://www.jubilee-centre.org/can-science-explain-everything-scientific-naturalism-and-the-death-of-science-by-denis-r-alexander/
The remainder of this form will help you begin working on what will become the first two major sections of your final paper – the summary and evaluation of the worldview you are writing about.
The Apologetics Application Paper Instructions indicate that the basic outline for your final paper should follow this structure:
I. Introduction
II. Summary of the Worldview
III. Evaluation of the Worldview
IV. Evaluation of Christianity
V. Defense of Christianity
VI. Conclusion
In what follows, you will be crafting the building blocks that will eventually become sections II and ...
Astronomy is primarily an observational science where scientists cannot actively experiment on celestial objects. Scientists use large surveys to collect data on many objects to look for variations. Population studies examine limited groups that share properties to see how features relate. Coordinate systems like altitude-azimuth and right ascension-declination are used to precisely map the positions of stars and other objects in the sky.
Can there be such a thing as Ontology Engineering?robertstevens65
- Ontology engineering aims to apply principles of engineering such as predictability, reproducibility, and strict semantics to the development of ontologies.
- Current ontology development relies heavily on craft and individual expertise rather than established engineering processes.
- For ontology engineering to be established, methods are needed to standardize development practices, evaluate ontologies, and demonstrate that independent groups can engineer ontologies to meet requirements in a consistent manner. The field is still in its early stages of applying engineering rigor.
DRUGS New agreement to tackle pharmaceutical pollution p.1AlyciaGold776
DRUGS New agreement to
tackle pharmaceutical
pollution p.164
WORLD VIEW Vaccination
the best way to measure
health care p.165
DUNG OVER Rolling beetles
fooled by look-alike
seeds p.167
Let’s think about cognitive bias
The human brain’s habit of finding what it wants to find is a key problem for research. Establishing
robust methods to avoid such bias will make results more reproducible.
“Ever since I first learned about confirmation bias I’ve been see-ing it everywhere.” So said British author and broadcaster Jon Ronson in So You’ve Been Publicly Shamed (Picador, 2015).
You will see a lot of cognitive bias in this week’s Nature. In a series
of articles, we examine the impact that bias can have on research, and
the best ways to identify and tackle it. One enemy of robust science
is our humanity — our appetite for being right, and our tendency to
find patterns in noise, to see supporting evidence for what we already
believe is true, and to ignore the facts that do not fit.
The sources and types of such cognitive bias — and the fallacies they
produce — are becoming more widely appreciated. Some of the prob-
lems are as old as science itself, and some are new: the IKEA effect, for
example, describes a cognitive bias among consumers who place artifi-
cially high value on products that they have built themselves. Another
common fallacy in research is the Texas sharp-shooter effect — fir-
ing off a few rounds and then drawing a bull’s eye around the bullet
holes. And then there is asymmetrical attention: carefully debugging
analyses and debunking data that counter a favoured hypothesis, while
letting evidence in favour of the hypothesis slide by unexamined.
Such fallacies sound obvious and easy to avoid. It is easy to think that
they only affect other people. In fact, they fall naturally into investiga-
tors’ blind spots (see page 182).
Advocates of robust science have repeatedly warned against cogni-
tive habits that can lead to error. Although such awareness is essential,
it is insufficient. The scientific community needs concrete guidance on
how to manage its all-too-human biases and avoid the errors they cause.
That need is particularly acute in statistical data analysis, where
some of the best-established methods were developed in a time before
data sets were measured in terabytes, and where choices between tech-
niques offer abundant opportunity for errors. Proteomics and genom-
ics, for example, crunch millions of data points at once, over thousands
of gene or protein variants. Early work was plagued by false positives,
before the spread of techniques that could account for the myriad
hypotheses that such a data-rich environment could generate.
Although problems persist, these fields serve as examples of commu-
nities learning to recognize and curb their mistakes. Another example is
the venerable practice of double-blind studies. But more effort is needed,
particularly in what some have called evidence- ...
Berlin Summer School Presentation Olsen Data Epistemology and Methods Paradig...Wendy Olsen
Berlin Summer School in Social Science. Presentation by Wendy Olsen on Epistemology (Aspects of Knowing) in Methodological Paradigms (Schools of Thought)
Realism, Constructivism, Positivism, Empiricism
Data, Epistemology, Methodology, and Methods Paradigms. Data Collection [book] London: Sage 2012 Date of presentation, July 23, 2014.
Why I am Not a Philosopher (October 2006)Barry Smith
Forms part of a training course in ontology given in Buffalo in 2009. For details and accompanying video see http://ontology.buffalo.edu/smith/IntroOntology_Course.html
Things to consider with websitesAuthority -- what are the autho.docxOllieShoresna
Things to consider with websites:
Authority
-- what are the author's experience, credentials, or affiliations? What are their affiliations? look for sources with named authors who have the experience and knowledge
Credibility
-- where is the author getting their information? Do they list their sources?
Audience/Purpose
-- is the author speaking to a particular audience? Do they have a particular perspective, or agenda? Are they trying to sell you something?
Currency
-- does the website have a date? Is it maintained and updated?
PROMPT 1
Most characteristics in humans are not Mendelian but a few of them are. Using reliable websites, find information about Mendelian characteristics in humans (or other animals). You might also look for information about traits that we used to think were Mendelian but now know are polygenic. Include the URL for any sites you use.
PROMPT 2
Epigenetics is an exciting emerging field in genetics that has the promise of helping us finally put to rest the so-called "nature v. nurture" debate. The Carey article mentions several examples of epigenetics in humans. Using reliable websites, find information about other examples of epigenetics in humans or other animals. Include the URL for any sites you use.
PROMPT 3
Darwin did not know about Mendel's work with pea plants while he was developing the theory of evolution by natural selection, which means that, although he elegantly described natural selection and provided a great deal of evidence for it, he did not know how traits were passed from parents to offspring. In the 20th century, as more was learned about DNA and genetics, Darwin's work and Mendel's work were finally put together and the
mechanism
for how traits were passed from parents to offspring became understood. This is what we call the Modern Synthesis, which was a significant expansion in evolutionary theory, building on Darwin's ideas. The modern synthesis largely focused on how variation is produced and distributed in populations. What are the 4 main mechanisms for the production and distribution of variation in populations? Using course materials and the Internet, find some specific examples of each kind.
PROMPT 4
Evolutionary theory predicts that deleterious genetic diseases, like Tay-Sachs, will be selected out of populations and, therefore, occur at a very low rate. However, Tay-Sachs is a disease that occurs at a surprisingly high rate among Ashkenazi Jews. Diamond's article, "Curse and Blessing of the Ghetto", demonstrates how evolutionary theory can help explain why some genetic diseases are more common in some populations than others. Diamond presents 4 possible hypotheses to explain why Tay-Sachs is more common among Ashkenazi Jews than other populations. What are the 4 hypotheses he proposes? Which is the hypothesis he argues is the most plausible explanation?
In discussing this question, you can also integrate information about the genetics of TS and protein synthesis to help demons.
Environmental Science Essay
Scientific Method Step Essay
Science Essay
Scientific Theory Essay
Essay on Forensic Science
Forensic Science Essay example
scientific literacy Essay
Scientific Method
Is Psychology a Science? Essay
The Scientific Method Essay
My Passion For Science
Structure Of A Research Essay. The Research Paper Structure - How to Write a ...Becky Strickland
How to Write a Research Paper - Step by Step Guide - Peachy Essay. How to Structure an Essay: A Guide for College Students. Model Basic Essay Structure Guideline Secure High Grades In Essay. How to Structure an Essay: A Guide for College Students - Peachy Essay. 15+ Essay Format Templates - PDF. Things To Consider For Writing A Great Essay - EssayWritingGuides. Research Paper Format - Fotolip. The Research Paper Structure - How to Write a Research Paper. How to Write an Academic Essay – News – IQ: Research and Education .... Guidelines on How to Properly Write and Structure a Research Paper; Get .... Sample Research Argumentative Essay | Templates at allbusinesstemplates.com. Analytical Essay Introduction Structure – Telegraph. Essay writing Structure - ESSAY WRITING. History Essay: Structure of essay. How to Write a Research Paper. Essay Structure - Area of Study: Discovery. Essay structure overview. 5 Clear and Easy Ways to Write an Academic Essay - wikiHow - IELTS .... (PDF) Analysis of the structure of original research papers: An aid to .... Writing an essay introduction - Research & Learning Online - How to .... Essay structure – English 102: Reading, Research, and Writing. Academic essay writing structure - The Oscillation Band. High School Essay Writing Sample on Topics and Structure. 005 Argumentative Essay Sample Research Paper ~ Museumlegs. The research paper structure - How Can An Admission Essay Service Help .... Examples Of Research Essays - ghostwritingrates.web.fc2.com. Research – Essay Structure – Photography 2 – Landscape, Place and .... Annotated Bibliographies - Extended Essay Guide - LibGuides at .... essay write my marketing research paper. Discussion Essay Structure Worksheets : RECENT ESL EXERCISES. Sample Literary Research Essay - How to create a Literary Research .... Argumentative Essay Topics for College Assignments - Blog BuyEssayClub.com. 7 Must Have Paragraphs In Your Theory Of Knowledge Essay Structure Of A Research Essay
Scientific Method is a process used to build and organize knowledge in the form of testable explanations and predictions about the natural world. It involves making observations, asking questions, formulating hypotheses, making predictions, conducting experiments, and analyzing the results. While science is constantly evolving as new discoveries are made, the scientific method helps ensure research is objective, evidence-based, and peer-reviewed.
The scientific method is important because it allows for a systematic process of exploring the natural world to build understanding. By making detailed observations and asking questions, researchers can form hypotheses to explain phenomena. Experiments are then designed to test these hypotheses, either supporting or dis
The document provides instructions for students to complete various classroom activities related to evolution, including a Venn diagram comparing mitosis and meiosis, defining science, completing surveys on the nature of science and evolution, modeling natural selection through an activity, and taking notes on key concepts like natural selection, fitness, and evidence for evolution such as homologous structures.
A good response to others is not something like I agree. Please .docxransayo
This document provides instructions for an assignment analyzing team dynamics and conflict management in two films depicting crisis situations at sea - The Perfect Storm and The Finest Hours. Students are asked to write a 3000-word essay addressing: the nature of the crisis in each film, the teams involved and their roles, examples of conflict and team behaviors, which teams demonstrated positive behaviors and had successful outcomes, which teams failed at positive conflict management and their outcomes, lessons learned about teamwork and conflict management, and how the student can improve as a team member and help engineering design teams. Students are encouraged to watch and discuss the films with others to gain different perspectives.
Presentation to the J. Craig Venter Institute, Dec. 2014Mark Wilkinson
This is largely a compilation of various other talks that I have posted here - a summary of the past 3+ years of work on SADI/SHARE. It includes the (now well-worn!!) slides about SHARE, as well as some of the more contemporary stuff about how we extended GALEN clinical classes with richer semantic descriptions, and then used them to do automated clinical phenotype analysis. Also includes the slide-deck related to automated Measurement Unit conversion (related to our work on semantically representing Framingham clinical risk assessment rules)
So... for anyone who regularly follows my uploads, there isn't much "new" in here, but at least it's all in one place now! :-)
This document provides an introduction to the concept of a resource-based economy (RBE) by discussing human behavior and how it is shaped by environmental factors. It explains that genes alone do not determine human phenotypes and behaviors, but rather there is an interaction between genes and the environment. Studies are cited showing that traits like aggression and depression are more influenced by traumatic environmental experiences than genetic factors alone. The introduction argues that creating a society and system that does not actively reward behaviors like violence and crime through things like poverty would be important for reducing such behaviors. The rest of the document outlines how an RBE model based on scientific principles could provide an alternative social and economic system unlike any tried before.
High School Biology Instructional Unit_Jordan HamptonJordan Hampton
This document provides an overview and analysis of a high school biology textbook chapter on evolution. It examines the chapter's content, vocabulary, instructional strategies, and alignment with state standards. The chapter focuses on Darwin's theory of natural selection and evidence for evolution. Key instructional strategies highlighted include a vocabulary self-collection strategy, PreP pre-reading procedure, and Reading for Meaning organizer to support comprehension during reading.
1 Running head THE ETHICS OF ELEPHANTS IN CIRCUSES .docxhoney725342
1
Running head: THE ETHICS OF ELEPHANTS IN CIRCUSES
The Ethics of Elephants in Circuses
Dr. Christopher Foster
PHI103: Informal Logic
Ashford University
Annotated example for Week One Assignment
2
THE ETHICS OF ELEPHANTS IN CIRCUSES
This is the argument in
Standard Form.
Standard Form means
putting each premise
and conclusion on a
separate line, as
observed here. Labeling
the premises P1, P2, etc.
is also helpful to be able
to refer to them later.
The next four
paragraphs
provide
support for
each premise
of the
argument.
The topic of
each
paragraph is
clear from the
opening
sentence.
It is good to
provide
clarification of
the meaning of
premises as well
(as indicated in
the instructions).
P1: Elephants are highly intelligent animals.
P2: Putting elephants in circuses requires them to live their
lives in extreme confinement.
P3: Anything that requires highly intelligent animals to
live their lives in extreme confinement is wrong unless it serves
a purpose that outweighs the suffering involved.
P4: Putting elephants in circuses does not serve a purpose that
outweighs the suffering involved.
C: Therefore, putting elephants in circuses is wrong.
The first premise has been widely known for decades by those who
have studied elephants. Scientific studies have shown that elephants are
able to independently discover novel methods to figure out how to retrieve
food, and they have recently been shown to be able to enlist the help of
other elephants in situations that require cooperation (Jabr, 2014).
The second premise is justified by looking at how elephants are
treated in circuses. When not performing or being transported, circus
elephants are kept on a short chain that prevents them from being able
to move around or even lie down normally. This is what is meant by
‘extreme confinement’: captivity so severe that the animal is not able
to get proper exercise and stimulation. In addition to the captivity, there
3
THE ETHICS OF ELEPHANTS IN CIRCUSES
have been many reports, and footage, of abuse of circus elephants with bullhooks, electrocution, and
other forms of cruelty (Nelson, 2011).
The third premise makes a strong moral claim. Given the intelligence of elephants, and their
natural use of vast savannahs of space, life spent on a tiny chain will involve a tremendous amount of
suffering. They develop “stereotypic behaviors” such as constant swaying back and forth, indicating
severe psychological distress (Wildlife Advocacy Project, n.d.). President of PAWS, Ed Stewart, expresses
it well:
Elephants should not be in captivity – period … The social structure isn’t correct, the space is not
right, the climate is not right, the food is not right … They are unbelievably intelligent. With all of
that brainpower – to be as limited as they are in captivity – it’s a wonder they cope at all. (Jabr,
2014)
My final premise states ...
This document provides guidance on writing an inductive essay. It explains that an inductive essay looks at specific examples and builds a conclusion, allowing the reader to gradually understand the author's stance. The introduction should orient the reader to the topic and question without stating a conclusion. The body should interpret evidence clearly and connect it logically to the conclusion. The conclusion should follow from the evidence and answer "so what?". Research should use credible, verifiable sources and select the most important evidence.
The Scientific Method Of Social Science Essay
Environmental Science Essay
Scientific Theory Essay
The Scientific Method Essay
Scientific Method
The Philosophy of Science Essay
Positivism Essay
Anthony Giddens: A Sociological Study
Sociology As A Scientific Discipline Essay
Definition Of Scientific Management Theory Essay
Science As Product And Science
Definition of Science Fiction Essay
Geography as a Science Essay examples
Scientific Racism Definition
The Principles of Scientific Thinking Essay
Scientific Notation Essay
Ethics in Science Essay
What Are Scientific Merit?
The ability to recreate computational results with minimal effort and actionable metrics provides a solid foundation for scientific research and software development. When people can replicate an analysis at the touch of a button using open-source software, open data, and methods to assess and compare proposals, it significantly eases verification of results, engagement with a diverse range of contributors, and progress. However, we have yet to fully achieve this; there are still many sociotechnical frictions.
Inspired by David Donoho's vision, this talk aims to revisit the three crucial pillars of frictionless reproducibility (data sharing, code sharing, and competitive challenges) with the perspective of deep software variability.
Our observation is that multiple layers — hardware, operating systems, third-party libraries, software versions, input data, compile-time options, and parameters — are subject to variability that exacerbates frictions but is also essential for achieving robust, generalizable results and fostering innovation. I will first review the literature, providing evidence of how the complex variability interactions across these layers affect qualitative and quantitative software properties, thereby complicating the reproduction and replication of scientific studies in various fields.
I will then present some software engineering and AI techniques that can support the strategic exploration of variability spaces. These include the use of abstractions and models (e.g., feature models), sampling strategies (e.g., uniform, random), cost-effective measurements (e.g., incremental build of software configurations), and dimensionality reduction methods (e.g., transfer learning, feature selection, software debloating).
I will finally argue that deep variability is both the problem and solution of frictionless reproducibility, calling the software science community to develop new methods and tools to manage variability and foster reproducibility in software systems.
Exposé invité Journées Nationales du GDR GPL 2024
Immersive Learning That Works: Research Grounding and Paths ForwardLeonel Morgado
We will metaverse into the essence of immersive learning, into its three dimensions and conceptual models. This approach encompasses elements from teaching methodologies to social involvement, through organizational concerns and technologies. Challenging the perception of learning as knowledge transfer, we introduce a 'Uses, Practices & Strategies' model operationalized by the 'Immersive Learning Brain' and ‘Immersion Cube’ frameworks. This approach offers a comprehensive guide through the intricacies of immersive educational experiences and spotlighting research frontiers, along the immersion dimensions of system, narrative, and agency. Our discourse extends to stakeholders beyond the academic sphere, addressing the interests of technologists, instructional designers, and policymakers. We span various contexts, from formal education to organizational transformation to the new horizon of an AI-pervasive society. This keynote aims to unite the iLRN community in a collaborative journey towards a future where immersive learning research and practice coalesce, paving the way for innovative educational research and practice landscapes.
The use of Nauplii and metanauplii artemia in aquaculture (brine shrimp).pptxMAGOTI ERNEST
Although Artemia has been known to man for centuries, its use as a food for the culture of larval organisms apparently began only in the 1930s, when several investigators found that it made an excellent food for newly hatched fish larvae (Litvinenko et al., 2023). As aquaculture developed in the 1960s and ‘70s, the use of Artemia also became more widespread, due both to its convenience and to its nutritional value for larval organisms (Arenas-Pardo et al., 2024). The fact that Artemia dormant cysts can be stored for long periods in cans, and then used as an off-the-shelf food requiring only 24 h of incubation makes them the most convenient, least labor-intensive, live food available for aquaculture (Sorgeloos & Roubach, 2021). The nutritional value of Artemia, especially for marine organisms, is not constant, but varies both geographically and temporally. During the last decade, however, both the causes of Artemia nutritional variability and methods to improve poorquality Artemia have been identified (Loufi et al., 2024).
Brine shrimp (Artemia spp.) are used in marine aquaculture worldwide. Annually, more than 2,000 metric tons of dry cysts are used for cultivation of fish, crustacean, and shellfish larva. Brine shrimp are important to aquaculture because newly hatched brine shrimp nauplii (larvae) provide a food source for many fish fry (Mozanzadeh et al., 2021). Culture and harvesting of brine shrimp eggs represents another aspect of the aquaculture industry. Nauplii and metanauplii of Artemia, commonly known as brine shrimp, play a crucial role in aquaculture due to their nutritional value and suitability as live feed for many aquatic species, particularly in larval stages (Sorgeloos & Roubach, 2021).
More Related Content
Similar to Annotation Systems & Implementation Issues - Suzanna Lewis
Things to consider with websitesAuthority -- what are the autho.docxOllieShoresna
Things to consider with websites:
Authority
-- what are the author's experience, credentials, or affiliations? What are their affiliations? look for sources with named authors who have the experience and knowledge
Credibility
-- where is the author getting their information? Do they list their sources?
Audience/Purpose
-- is the author speaking to a particular audience? Do they have a particular perspective, or agenda? Are they trying to sell you something?
Currency
-- does the website have a date? Is it maintained and updated?
PROMPT 1
Most characteristics in humans are not Mendelian but a few of them are. Using reliable websites, find information about Mendelian characteristics in humans (or other animals). You might also look for information about traits that we used to think were Mendelian but now know are polygenic. Include the URL for any sites you use.
PROMPT 2
Epigenetics is an exciting emerging field in genetics that has the promise of helping us finally put to rest the so-called "nature v. nurture" debate. The Carey article mentions several examples of epigenetics in humans. Using reliable websites, find information about other examples of epigenetics in humans or other animals. Include the URL for any sites you use.
PROMPT 3
Darwin did not know about Mendel's work with pea plants while he was developing the theory of evolution by natural selection, which means that, although he elegantly described natural selection and provided a great deal of evidence for it, he did not know how traits were passed from parents to offspring. In the 20th century, as more was learned about DNA and genetics, Darwin's work and Mendel's work were finally put together and the
mechanism
for how traits were passed from parents to offspring became understood. This is what we call the Modern Synthesis, which was a significant expansion in evolutionary theory, building on Darwin's ideas. The modern synthesis largely focused on how variation is produced and distributed in populations. What are the 4 main mechanisms for the production and distribution of variation in populations? Using course materials and the Internet, find some specific examples of each kind.
PROMPT 4
Evolutionary theory predicts that deleterious genetic diseases, like Tay-Sachs, will be selected out of populations and, therefore, occur at a very low rate. However, Tay-Sachs is a disease that occurs at a surprisingly high rate among Ashkenazi Jews. Diamond's article, "Curse and Blessing of the Ghetto", demonstrates how evolutionary theory can help explain why some genetic diseases are more common in some populations than others. Diamond presents 4 possible hypotheses to explain why Tay-Sachs is more common among Ashkenazi Jews than other populations. What are the 4 hypotheses he proposes? Which is the hypothesis he argues is the most plausible explanation?
In discussing this question, you can also integrate information about the genetics of TS and protein synthesis to help demons.
Environmental Science Essay
Scientific Method Step Essay
Science Essay
Scientific Theory Essay
Essay on Forensic Science
Forensic Science Essay example
scientific literacy Essay
Scientific Method
Is Psychology a Science? Essay
The Scientific Method Essay
My Passion For Science
Structure Of A Research Essay. The Research Paper Structure - How to Write a ...Becky Strickland
How to Write a Research Paper - Step by Step Guide - Peachy Essay. How to Structure an Essay: A Guide for College Students. Model Basic Essay Structure Guideline Secure High Grades In Essay. How to Structure an Essay: A Guide for College Students - Peachy Essay. 15+ Essay Format Templates - PDF. Things To Consider For Writing A Great Essay - EssayWritingGuides. Research Paper Format - Fotolip. The Research Paper Structure - How to Write a Research Paper. How to Write an Academic Essay – News – IQ: Research and Education .... Guidelines on How to Properly Write and Structure a Research Paper; Get .... Sample Research Argumentative Essay | Templates at allbusinesstemplates.com. Analytical Essay Introduction Structure – Telegraph. Essay writing Structure - ESSAY WRITING. History Essay: Structure of essay. How to Write a Research Paper. Essay Structure - Area of Study: Discovery. Essay structure overview. 5 Clear and Easy Ways to Write an Academic Essay - wikiHow - IELTS .... (PDF) Analysis of the structure of original research papers: An aid to .... Writing an essay introduction - Research & Learning Online - How to .... Essay structure – English 102: Reading, Research, and Writing. Academic essay writing structure - The Oscillation Band. High School Essay Writing Sample on Topics and Structure. 005 Argumentative Essay Sample Research Paper ~ Museumlegs. The research paper structure - How Can An Admission Essay Service Help .... Examples Of Research Essays - ghostwritingrates.web.fc2.com. Research – Essay Structure – Photography 2 – Landscape, Place and .... Annotated Bibliographies - Extended Essay Guide - LibGuides at .... essay write my marketing research paper. Discussion Essay Structure Worksheets : RECENT ESL EXERCISES. Sample Literary Research Essay - How to create a Literary Research .... Argumentative Essay Topics for College Assignments - Blog BuyEssayClub.com. 7 Must Have Paragraphs In Your Theory Of Knowledge Essay Structure Of A Research Essay
Scientific Method is a process used to build and organize knowledge in the form of testable explanations and predictions about the natural world. It involves making observations, asking questions, formulating hypotheses, making predictions, conducting experiments, and analyzing the results. While science is constantly evolving as new discoveries are made, the scientific method helps ensure research is objective, evidence-based, and peer-reviewed.
The scientific method is important because it allows for a systematic process of exploring the natural world to build understanding. By making detailed observations and asking questions, researchers can form hypotheses to explain phenomena. Experiments are then designed to test these hypotheses, either supporting or dis
The document provides instructions for students to complete various classroom activities related to evolution, including a Venn diagram comparing mitosis and meiosis, defining science, completing surveys on the nature of science and evolution, modeling natural selection through an activity, and taking notes on key concepts like natural selection, fitness, and evidence for evolution such as homologous structures.
A good response to others is not something like I agree. Please .docxransayo
This document provides instructions for an assignment analyzing team dynamics and conflict management in two films depicting crisis situations at sea - The Perfect Storm and The Finest Hours. Students are asked to write a 3000-word essay addressing: the nature of the crisis in each film, the teams involved and their roles, examples of conflict and team behaviors, which teams demonstrated positive behaviors and had successful outcomes, which teams failed at positive conflict management and their outcomes, lessons learned about teamwork and conflict management, and how the student can improve as a team member and help engineering design teams. Students are encouraged to watch and discuss the films with others to gain different perspectives.
Presentation to the J. Craig Venter Institute, Dec. 2014Mark Wilkinson
This is largely a compilation of various other talks that I have posted here - a summary of the past 3+ years of work on SADI/SHARE. It includes the (now well-worn!!) slides about SHARE, as well as some of the more contemporary stuff about how we extended GALEN clinical classes with richer semantic descriptions, and then used them to do automated clinical phenotype analysis. Also includes the slide-deck related to automated Measurement Unit conversion (related to our work on semantically representing Framingham clinical risk assessment rules)
So... for anyone who regularly follows my uploads, there isn't much "new" in here, but at least it's all in one place now! :-)
This document provides an introduction to the concept of a resource-based economy (RBE) by discussing human behavior and how it is shaped by environmental factors. It explains that genes alone do not determine human phenotypes and behaviors, but rather there is an interaction between genes and the environment. Studies are cited showing that traits like aggression and depression are more influenced by traumatic environmental experiences than genetic factors alone. The introduction argues that creating a society and system that does not actively reward behaviors like violence and crime through things like poverty would be important for reducing such behaviors. The rest of the document outlines how an RBE model based on scientific principles could provide an alternative social and economic system unlike any tried before.
High School Biology Instructional Unit_Jordan HamptonJordan Hampton
This document provides an overview and analysis of a high school biology textbook chapter on evolution. It examines the chapter's content, vocabulary, instructional strategies, and alignment with state standards. The chapter focuses on Darwin's theory of natural selection and evidence for evolution. Key instructional strategies highlighted include a vocabulary self-collection strategy, PreP pre-reading procedure, and Reading for Meaning organizer to support comprehension during reading.
1 Running head THE ETHICS OF ELEPHANTS IN CIRCUSES .docxhoney725342
1
Running head: THE ETHICS OF ELEPHANTS IN CIRCUSES
The Ethics of Elephants in Circuses
Dr. Christopher Foster
PHI103: Informal Logic
Ashford University
Annotated example for Week One Assignment
2
THE ETHICS OF ELEPHANTS IN CIRCUSES
This is the argument in
Standard Form.
Standard Form means
putting each premise
and conclusion on a
separate line, as
observed here. Labeling
the premises P1, P2, etc.
is also helpful to be able
to refer to them later.
The next four
paragraphs
provide
support for
each premise
of the
argument.
The topic of
each
paragraph is
clear from the
opening
sentence.
It is good to
provide
clarification of
the meaning of
premises as well
(as indicated in
the instructions).
P1: Elephants are highly intelligent animals.
P2: Putting elephants in circuses requires them to live their
lives in extreme confinement.
P3: Anything that requires highly intelligent animals to
live their lives in extreme confinement is wrong unless it serves
a purpose that outweighs the suffering involved.
P4: Putting elephants in circuses does not serve a purpose that
outweighs the suffering involved.
C: Therefore, putting elephants in circuses is wrong.
The first premise has been widely known for decades by those who
have studied elephants. Scientific studies have shown that elephants are
able to independently discover novel methods to figure out how to retrieve
food, and they have recently been shown to be able to enlist the help of
other elephants in situations that require cooperation (Jabr, 2014).
The second premise is justified by looking at how elephants are
treated in circuses. When not performing or being transported, circus
elephants are kept on a short chain that prevents them from being able
to move around or even lie down normally. This is what is meant by
‘extreme confinement’: captivity so severe that the animal is not able
to get proper exercise and stimulation. In addition to the captivity, there
3
THE ETHICS OF ELEPHANTS IN CIRCUSES
have been many reports, and footage, of abuse of circus elephants with bullhooks, electrocution, and
other forms of cruelty (Nelson, 2011).
The third premise makes a strong moral claim. Given the intelligence of elephants, and their
natural use of vast savannahs of space, life spent on a tiny chain will involve a tremendous amount of
suffering. They develop “stereotypic behaviors” such as constant swaying back and forth, indicating
severe psychological distress (Wildlife Advocacy Project, n.d.). President of PAWS, Ed Stewart, expresses
it well:
Elephants should not be in captivity – period … The social structure isn’t correct, the space is not
right, the climate is not right, the food is not right … They are unbelievably intelligent. With all of
that brainpower – to be as limited as they are in captivity – it’s a wonder they cope at all. (Jabr,
2014)
My final premise states ...
This document provides guidance on writing an inductive essay. It explains that an inductive essay looks at specific examples and builds a conclusion, allowing the reader to gradually understand the author's stance. The introduction should orient the reader to the topic and question without stating a conclusion. The body should interpret evidence clearly and connect it logically to the conclusion. The conclusion should follow from the evidence and answer "so what?". Research should use credible, verifiable sources and select the most important evidence.
The Scientific Method Of Social Science Essay
Environmental Science Essay
Scientific Theory Essay
The Scientific Method Essay
Scientific Method
The Philosophy of Science Essay
Positivism Essay
Anthony Giddens: A Sociological Study
Sociology As A Scientific Discipline Essay
Definition Of Scientific Management Theory Essay
Science As Product And Science
Definition of Science Fiction Essay
Geography as a Science Essay examples
Scientific Racism Definition
The Principles of Scientific Thinking Essay
Scientific Notation Essay
Ethics in Science Essay
What Are Scientific Merit?
Similar to Annotation Systems & Implementation Issues - Suzanna Lewis (12)
The ability to recreate computational results with minimal effort and actionable metrics provides a solid foundation for scientific research and software development. When people can replicate an analysis at the touch of a button using open-source software, open data, and methods to assess and compare proposals, it significantly eases verification of results, engagement with a diverse range of contributors, and progress. However, we have yet to fully achieve this; there are still many sociotechnical frictions.
Inspired by David Donoho's vision, this talk aims to revisit the three crucial pillars of frictionless reproducibility (data sharing, code sharing, and competitive challenges) with the perspective of deep software variability.
Our observation is that multiple layers — hardware, operating systems, third-party libraries, software versions, input data, compile-time options, and parameters — are subject to variability that exacerbates frictions but is also essential for achieving robust, generalizable results and fostering innovation. I will first review the literature, providing evidence of how the complex variability interactions across these layers affect qualitative and quantitative software properties, thereby complicating the reproduction and replication of scientific studies in various fields.
I will then present some software engineering and AI techniques that can support the strategic exploration of variability spaces. These include the use of abstractions and models (e.g., feature models), sampling strategies (e.g., uniform, random), cost-effective measurements (e.g., incremental build of software configurations), and dimensionality reduction methods (e.g., transfer learning, feature selection, software debloating).
I will finally argue that deep variability is both the problem and solution of frictionless reproducibility, calling the software science community to develop new methods and tools to manage variability and foster reproducibility in software systems.
Exposé invité Journées Nationales du GDR GPL 2024
Immersive Learning That Works: Research Grounding and Paths ForwardLeonel Morgado
We will metaverse into the essence of immersive learning, into its three dimensions and conceptual models. This approach encompasses elements from teaching methodologies to social involvement, through organizational concerns and technologies. Challenging the perception of learning as knowledge transfer, we introduce a 'Uses, Practices & Strategies' model operationalized by the 'Immersive Learning Brain' and ‘Immersion Cube’ frameworks. This approach offers a comprehensive guide through the intricacies of immersive educational experiences and spotlighting research frontiers, along the immersion dimensions of system, narrative, and agency. Our discourse extends to stakeholders beyond the academic sphere, addressing the interests of technologists, instructional designers, and policymakers. We span various contexts, from formal education to organizational transformation to the new horizon of an AI-pervasive society. This keynote aims to unite the iLRN community in a collaborative journey towards a future where immersive learning research and practice coalesce, paving the way for innovative educational research and practice landscapes.
The use of Nauplii and metanauplii artemia in aquaculture (brine shrimp).pptxMAGOTI ERNEST
Although Artemia has been known to man for centuries, its use as a food for the culture of larval organisms apparently began only in the 1930s, when several investigators found that it made an excellent food for newly hatched fish larvae (Litvinenko et al., 2023). As aquaculture developed in the 1960s and ‘70s, the use of Artemia also became more widespread, due both to its convenience and to its nutritional value for larval organisms (Arenas-Pardo et al., 2024). The fact that Artemia dormant cysts can be stored for long periods in cans, and then used as an off-the-shelf food requiring only 24 h of incubation makes them the most convenient, least labor-intensive, live food available for aquaculture (Sorgeloos & Roubach, 2021). The nutritional value of Artemia, especially for marine organisms, is not constant, but varies both geographically and temporally. During the last decade, however, both the causes of Artemia nutritional variability and methods to improve poorquality Artemia have been identified (Loufi et al., 2024).
Brine shrimp (Artemia spp.) are used in marine aquaculture worldwide. Annually, more than 2,000 metric tons of dry cysts are used for cultivation of fish, crustacean, and shellfish larva. Brine shrimp are important to aquaculture because newly hatched brine shrimp nauplii (larvae) provide a food source for many fish fry (Mozanzadeh et al., 2021). Culture and harvesting of brine shrimp eggs represents another aspect of the aquaculture industry. Nauplii and metanauplii of Artemia, commonly known as brine shrimp, play a crucial role in aquaculture due to their nutritional value and suitability as live feed for many aquatic species, particularly in larval stages (Sorgeloos & Roubach, 2021).
ESPP presentation to EU Waste Water Network, 4th June 2024 “EU policies driving nutrient removal and recycling
and the revised UWWTD (Urban Waste Water Treatment Directive)”
When I was asked to give a companion lecture in support of ‘The Philosophy of Science’ (https://shorturl.at/4pUXz) I decided not to walk through the detail of the many methodologies in order of use. Instead, I chose to employ a long standing, and ongoing, scientific development as an exemplar. And so, I chose the ever evolving story of Thermodynamics as a scientific investigation at its best.
Conducted over a period of >200 years, Thermodynamics R&D, and application, benefitted from the highest levels of professionalism, collaboration, and technical thoroughness. New layers of application, methodology, and practice were made possible by the progressive advance of technology. In turn, this has seen measurement and modelling accuracy continually improved at a micro and macro level.
Perhaps most importantly, Thermodynamics rapidly became a primary tool in the advance of applied science/engineering/technology, spanning micro-tech, to aerospace and cosmology. I can think of no better a story to illustrate the breadth of scientific methodologies and applications at their best.
The technology uses reclaimed CO₂ as the dyeing medium in a closed loop process. When pressurized, CO₂ becomes supercritical (SC-CO₂). In this state CO₂ has a very high solvent power, allowing the dye to dissolve easily.
ESR spectroscopy in liquid food and beverages.pptxPRIYANKA PATEL
With increasing population, people need to rely on packaged food stuffs. Packaging of food materials requires the preservation of food. There are various methods for the treatment of food to preserve them and irradiation treatment of food is one of them. It is the most common and the most harmless method for the food preservation as it does not alter the necessary micronutrients of food materials. Although irradiated food doesn’t cause any harm to the human health but still the quality assessment of food is required to provide consumers with necessary information about the food. ESR spectroscopy is the most sophisticated way to investigate the quality of the food and the free radicals induced during the processing of the food. ESR spin trapping technique is useful for the detection of highly unstable radicals in the food. The antioxidant capability of liquid food and beverages in mainly performed by spin trapping technique.
hematic appreciation test is a psychological assessment tool used to measure an individual's appreciation and understanding of specific themes or topics. This test helps to evaluate an individual's ability to connect different ideas and concepts within a given theme, as well as their overall comprehension and interpretation skills. The results of the test can provide valuable insights into an individual's cognitive abilities, creativity, and critical thinking skills
Travis Hills' Endeavors in Minnesota: Fostering Environmental and Economic Pr...Travis Hills MN
Travis Hills of Minnesota developed a method to convert waste into high-value dry fertilizer, significantly enriching soil quality. By providing farmers with a valuable resource derived from waste, Travis Hills helps enhance farm profitability while promoting environmental stewardship. Travis Hills' sustainable practices lead to cost savings and increased revenue for farmers by improving resource efficiency and reducing waste.
Travis Hills' Endeavors in Minnesota: Fostering Environmental and Economic Pr...
Annotation Systems & Implementation Issues - Suzanna Lewis
1. Motivation
Your research is valuable
All advances in knowledge are incremental, with
each new idea ultimately building on earlier
knowledge such as you are gathering.
2. Losing data at a rapid rate
up to 80% unavailable after 20 years
2
http://www.nature.com/news/scientists-losing-data-at-a-rapid-rate-1.14416
3. Data valuation
Information is infinitely shareable without any loss of
value
Reuse increases the value derived from the original
investment
By combining data, their value increases
The more these assets are used, the more additional
knowledge can be gathered (data science)
As a corollary, unshared or insufficiently documented
information is less valuable
The more accurate and complete the information is,
the more useful, and therefore valuable, it is
Moody and Walsh 1999
7. eye
what kinds of
things exist?
what are the
relationships
between
these things?
ommatidium
sense organeye disc
is_a
part_of
develops
from
A biological ontology is:
A machine interpretable representation of
some aspect of biological reality
8. October 25, 2016
Ontology defined
The science of what is: of the kinds and
structures of the objects, and their properties
and relations in every area of reality.
The classification of entities and the relations
between them.
Defined by a scientific field's vocabulary and by
the canonical formulations of its theories.
Seeks to solve problems which arise in these
domains.
10. Ontologies help with decision
making
handy ontology tells us what’s there…
Where
should I
eat…?
11. Ontologies don’t just organize data; they
also facilitate inference,
and that creates new knowledge, often
unconsciously in the user.
(Presumable)
country of origin
Type of cuisine
12. What a 5 year old child (or a computer) will likely infer
about the world from this helpful ontology…
Flag of fresh juice
‘Frozen Yogurt’ cuisine in
search of a national identity?
Where delicatessen food
hails from from…
Fresh Juice is a national cuisine…
13. Information retrieval is not straightforward
18-day pregnant females
female (lactating)
individual female
worker caste (female)
2 yr old female
female (pregnant)
lgb*cc females
sex: female
400 yr. old female
female (outbred)
mare
female, other
adult female
female parent
female (worker)
female child
asexual female
female plant
monosex female
femal
femlale
diploid female
female(gynoecious)
remale
metafemale
f
femele
semi-engorged female
sterile female
famale
female, pooled
sexual oviparous female
normal female
femail
femalen
sterile female worker
sf
female
females
strictly female
vitellogenic replete
female
female - worker
females only
tetraploid female
worker
female (alate sexual)
gynoecious
thelytoky
hexaploid female
female (calf)
healthy female
female (gynoecious)
female (f-o)
hen
probably female (based
on morphology)
castrate female
female with eggs
ovigerous female
3 female
cf.female
female worker
oviparous sexual
females
female (phenotype)
cystocarpic female
female, 6-8 weeks old
worker bee
female mice
dikaryon
female, virgin
female enriched
female, spayed
dioecious female
female, worker
pseudohermaprhoditic
female
Courtesy of N. Silvester and S. Orchard, European Nucleotide Archive, EMBL-
EBI
14. October 25, 2016
Motivation is to represent biology
accurately
Inferences and decisions we make are
based upon what we know of the
biological reality.
An ontology is a computable
representation of this underlying biological
reality.
Enables a computer to reason over the
data in (some of) the ways that we do.
15. Annotation bottleneck
Even the best research will be for naught if
data can never be found again.
An active lab can easily generate 10-100GB of
data per month, and it is very difficult to
manage on this scale.
Must be annotated at the rate at which it is
generated
And the data must be integrated with other data
Furthermore, the effort put into generating this data
will be utterly wasted if the curated data cannot be
reliably computed upon.
17. Ontologies must be shared
Communities form scientific theories
that seek to explain all of the existing evidence
and can be used for prediction
The computable representation must also be
shared
Thus ontology development is inherently
collaborative
October 25, 2016
18. October 25, 2016
Ontologies must be used
Usage feeds back on ontology development and
improves the ontology
It improves even more when these data are used
to answer research questions
There will be fewer problems in the ontology and
more commitment to fixing remaining problems
when important research data is involved that
scientists depend upon
19. Why do we need rules for good
ontology?
Ontologies must be intelligible
To humans (for annotation) and
To machines (for searching, reasoning and error-checking)
Makes it easier to find the most accurate term(s) to use
Avoids annotation errors
Makes it easier for new curators to learn and understand
Makes it easier to combine with other ontologies and terminologies
Makes automatic reasoning possible for searching & inference
Bottom line:
Following basic rules makes more useful ontologies
20. October 25, 2016
First Rule: Univocity
Terms (including those describing
relations) should have the same meanings
on every occasion of use.
In other words, they should refer to the
same kinds of entities in reality
22. Comparison is difficult, especially across species or across
databases that each use one of these different variants
Disambiguation
Use a single term, and
plenty of synonyms
Gluconeogenesis
Synonyms:
Glucose synthesis
Glucose biosynthesis
Glucose formation
Glucose anabolism
24. = tooth bud initiation
= cellular bud initiation
= flower bud initiation
Include plain “bud initiation” as a synonym for each of
these terms
Classification rule:
Disambiguation
25. October 25, 2016
Second Rule: Positivity
Complements of classes are not
themselves classes.
Terms such as ‘non-mammal’ or ‘non-
membrane’ do not designate genuine
classes.
26. October 25, 2016
The Challenge of Positivity
Some organelles are membrane-bound.
A centrosome is not a membrane bound organelle,
but it still may be considered an organelle.
27. October 25, 2016
Positivity
Note the logical difference between
“non-membrane-bound organelle” and
“not a membrane-bound organelle”
The latter includes everything that is not a
membrane bound organelle!
28. October 25, 2016
Third Rule: Objectivity
Which classes exist is not a function of our
biological knowledge.
Terms such as ‘unknown’ or
‘unclassified’ or ‘unlocalized’ do not
designate biological natural kinds.
29. Objectivity
How can we annotate when we know that
we don’t have any information?
Annotate to root nodes and use the ND (no data)
evidence code
Similar strategies can be used for any
situation more specific information is not
yet known
October 25, 2016
31. Ontologies are graphs, where the nodes (terms in the
ontology ) are connected by edges (relationships
between the terms)
is-a
part-of
Fourth Rule: Use defined
relationships
mitochondrial
membrane
chloroplast
Cell
membrane
Chloroplast
membrane
32. Reasoning is critical
Prokaryotic and
Eukaryotic cell are
declared disjoints
Fungal cell is a
Eukaryotic cell
Spore is a Fungal cell
and a Prokaryotic cell
Satisfiable?
http://www.plosone.org/article/info:doi/10.1371/journal.pone.0022006
32
Prokaryotic
Cell
Eukaryotic
Cell
Fungal
Cell
Spore
disjoint
33. Reasoning is critical
Solution: clarify spore
http://www.plosone.org/article/info:doi/10.1371/journal.pone.0022006
33
Prokaryotic
Cell
Eukaryotic
Cell
Fungal
Cell
disjoint
Actinomycete
Type Spore
Mycetozoa
Type Spore
34. October 25, 2016
Fifth Rule: Intelligibility of Definitions
The terms used in a definition should be
simpler (more intelligible) than the term to
be defined
otherwise the definition provides no
assistance
to human understanding
for machine processing
35. October 25, 2016
Sixth Rule: Keep it Real
When building or maintaining an ontology,
always think carefully at how classes
(types, kinds, species) relate to instances
in reality
36. October 25, 2016
The Rules
1. Univocity: Terms should have the same meanings
on every occasion of use
2. Positivity: Terms such as ‘non-mammal’ or ‘non-
membrane’ do not designate genuine classes.
3. Objectivity: Terms such as ‘unknown’ or
‘unclassified’ or ‘unlocalized’ do not designate
biological natural kinds.
4. Single Inheritance: No class in a classification
hierarchy should have more than one is_a parent
on the immediate higher level
5. Intelligibility of Definitions: The terms used in a
definition should be simpler (more intelligible) than
the term to be defined
6. Basis in Reality: When building or maintaining an
ontology, always think carefully at how classes
relate to instances in reality
7. Distinguish Universals and Instances
37. Natural Language Computable Ontology
+ Large existing body of information
+ Highly expressive
- Ambiguous (making it difficult and
unreliable to compute on) - Less expressive
+ Logical
+ Precise
How to best describe biology?
41. Once a genome is sequenced…
What are the parts? (sequence features)
Protein coding genes (coding sequence)
Non coding RNAs (rRNA, snoRNA, tRNA, microRNA
antisense RNA)
Promoters and regulatory regions
Transposons
Recombination hotspots, origins of replication
Centromeres & telomeres
…
47. APOLLO
annotation editing environment
BECOMING ACQUAINTED WITH APOLLO
Color by CDS frame,
toggle strands, set color
scheme and highlights.
Upload evidence files
(GFF3, BAM, BigWig),
add combination and
sequence search
tracks.
Query the genome using
BLAT.
Navigation and zoom.
Search for a gene
model or a scaffold.
Get coordinates and “rubber
band” selection for zooming.
Login
User-created
annotations.
Annotator
panel.
Evidence
Tracks
Stage and
cell-type
specific
transcription
data.
http://genomearchitect.org/web_apollo_user_guide
55. GCGAAGTGCCAACTTCTACACACACAAAG
GCGAAGTGCCAACTTCTACACACACAAAG
For example – ontologically described
genotypes/variants
intrinsic genotype
genomic variation
complementgenomic background
= +
CGTAGC
CGTACC
apchu745/+; fgfa8ti282/ti282(AB)
genomic variation
complement
variant single locus
complement
variant allele
sequence alteration
has_part has_part
apchu745/+
apchu745
hu745
has_part has_part
has_part has_part
X
AACGTACCGACGCTCGCTACGGGCGTATC
(AB) apchu745/+; fgf8ati282/ti282
apchu745/+; fgf8ati282/ti282
GCGAAGTGCCAACTTCTACACACACAAAG
GCGAAGTGCCAACTTCTACACACACAAAG
AACGTAGCGACGCTCGCTACGGGCGTATC
AACGTACCGACGCTCGCTACGGGCGTATC X
ACAC
X
X
X
X
AACGTAGCGACGCTCGCTACGGGCGTATC
X ACAC
X
X
X
X
X
59. Ancestral inference
• Integration at points of common ancestry
• Infer “hidden” character of living organisms
• Explicitly leverage evolutionary relationships
E.c.
A.t. MTHFR1
A.t. MTHFR2
D.d.
S.p.
S.c. MET13
D.m.
A.g.
S.p.
S.c. MET12
C.e.
D.r.
G.g.
H.s. MTHFR
R.n.
M.m.
divergence
Biochemistry: purification and assay
Genetics: mutant phenotypes
60. What is transitive annotation?
Related genes have a common function because their common
ancestor had that function.
Not just an inference about one gene. It is also an inference for
The most recent common ancestor (MRCA)
Continuous inheritance since the MRCA
Potential inheritance by other descendants of the MRCA
Gene in
Yeast
Gene in
Mouse
Function X
Gene in
Opisthokont
MRCA
Function X
Function X
Gene in
Zebrafish
Function X
Function X
Gene in
Human
Function X
Function X
61. 61
• Green indicates experimental
• Black dot indicates direct
experimental data.
dot indicates a more
general functional class
inferred from ontology
Red indicates NOT
function for the gene
All nodes have persistent identifiers
which are retained across different
builds of the protein family trees.
cholinesterase
carboxylic ester hydrolase
Evolutionary event type:
duplication
speciation
62. • PAINTed nodes –
• 3 steps carried out by
curator
• Gain & Loss of function
• Inferred By Descendants
• Experimental annotations
provide evidence
• Inferred by Ancestry
• Propagation to
unannotated leaves
carboxylic ester
hydrolase
Node with loss of function
Gaudet, P., et al. (2011). Phylogenetic-
based propagation of functional
annotations within the Gene
Ontology consortium. Briefings in
Bioinformatics, 12(5), 449–62.
doi:10.1093/bib/bbr042
Node with gain of
function- cholinesterase
66. Motivation: multi-scale knowledge
models of mechanistic biology
Bai, J. P. F., & Abernethy, D. R. (n.d.). Systems Pharmacology to Predict Drug Toxicity : Integration Across Levels of Biological Organization ∗,
451–473. doi:10.1146/annurev-pharmtox-011112-140248
67. A data model for causal ontology
annotations: “LEGO”
Activity
GO:nnnnnnn
What: <molecule>
68. A data model for causal ontology
annotations: “LEGO”
Activity
GO:nnnnnnn
What: <molecule>
Where: GO/CL/Uberon
69. A data model for causal ontology
annotations: “LEGO”
Activity
GO:nnnnnnn
What: <molecule>
Where: GO/CL/Uberon
Activity
GO:nnnnnnn
What: <molecule>
Where: GO/CL/Uberon
Relationship
RO:nnnnnnn
70. A data model for causal ontology
annotations: “LEGO”
Activity
GO:nnnnnnn
What: <molecule>
Where: GO/CL/Uberon
Activity
GO:nnnnnnn
What: <molecule>
Where: GO/CL/Uberon
Relationship
RO:nnnnnnn
Evidence: ECO, SEPIO
Source: PMID, ORCID, ...
71. Process
GO:nnnnnnn
A data model for causal ontology
annotations: “LEGO”
Activity
GO:nnnnnnn
What: <molecule>
Where: GO/CL/Uberon
Activity
GO:nnnnnnn
What: <molecule>
Where: GO/CL/Uberon
Relationship
RO:nnnnnnn
72. A data model for causal ontology
annotations: “LEGO”
GTPase activity
GO:0003924
What: TEM1 S000004529
Where: spindle pole
GO:0000922
GTPase inhibitor activity
GO:0005095
What: BFA1
S000003814
Where: spindle pole
GO:0000922
73. Exit from mitosis
GO:0010458
A data model for causal ontology
annotations: “LEGO”
GTPase activity
GO:0003924
What: TEM1 S000004529
Where: spindle pole
GO:0000922
GTPase inhibitor activity
GO:0005095
What: BFA1
S000003814
Where: spindle pole
GO:0000922