1. Looking at Sheller's argument, how do you think early representations of the Caribbean might have contributed to the justification for European invasion of the region.
2. What was the image of the Caribbean that was dominant in the 18th century and what impact did it have on imperialism?
3. What does Sheller mean when she says, "the Tourist gaze imbues tropical with moral meanings."?
4. How were White Caribbean people (Creoles in this text) defined by the dominant representations of the Caribbean?
Just so you know (this is not part of the question, this is just information because the world will pop up from time to time) the word 'creole' is a complex word of shifting meanings depending on location. It originated in linguistics and was used to describe languages that mixed different elements. It is used to identify different groups of people in different Caribbean territories. For example, in Trinidad and Guyana Creole is often used to mean the African descended people of those two countries, In other territories in the Caribbean Creole means the white Caribbean people. In other places it means people who have multiple heritages. Beyoncé, and many people in New Orleans use creole in this same multiracial way.
https://www.youtube.com/watch?v=yqvPTdM3-3Y
https://www.youtube.com/watch?v=OI2jn3lJTAE
5. How did 19th century representations of the Caribbean differ from 18th century representations?
6 If Sheller's argument is correct, how might representations of the Caribbean shape interactions between tourist and locals.?
developing Leadership and Management(6HR510)SPRING 2021
Module Leader: Anne Wylie
For Derby Business School BA Business Management (and bracketed pathways)
Contents
Staff contacts 4
Welcome 5
Module Specification and Description 6
Schedule of delivery 8
Recommended Reading 10
Student Voice 11
Your Voice 11
You Said It. We Did It 11
Module Evaluation 11
Module Assessment Description 12
Assessment Schedule 13
Formative Feedback 13
Assessment 13
Summative feedback, grades and return of work 13
Electronic Submission 14
Anonymous Marking 14
Progression: 14
Plagiarism and Academic Offences 14
Plagiarism 15
Collusion: 15
Impersonation: 15
Any other form of deception: 15
PLATO: 15
Referencing 15
Student Responsibilities 15
Preparation 15
Punctuality 16
Attendance and Engagement 16
Absence 16
If you have a problem 17
Technical Issue approaching the deadline time 17
Extenuating Circumstances 18
What are Exceptional Extenuating Circumstances (EEC)? 18
Completing an EEC Request 18
Late Submission Requests 19
Referrals 19
Assessment Criteria 20
External Examiners 20
Diversity Statement 20
Appendix A: Assessment Rubric 21
Appendix B: Undergraduate Marking Scale 24
Appendix C: Submission check list 25
Welcome
Dear Student,
Welcome to the Developing Leadership and Management module.
This module is about the concepts of Leadership and Management. It explores the similarities and differences in the roles and responsibi ...
This document provides information about an MBA module on leadership taught by Prof. Dr. L.T.B. Jackson at the North-West University in South Africa. It includes the module code and credits, names of lecturers, learning outcomes, prescribed literature, and work programme schedule. The work programme lists 8 themes that will be covered in class sessions from January to May, including transformational leadership, charismatic leadership, moral leadership, self-leadership, and leading in multicultural organizations. A study unit on transactional and transformational leadership is also included, outlining key concepts and leadership models to be examined.
This document provides the detailed contents for the book "Organizational Leadership" edited by John Bratton. The summary includes:
1. The book is divided into 4 parts that contextualize leadership, examine various leadership theories, discuss managing people and leadership, and cover contemporary leadership topics.
2. Each chapter outlines learning outcomes and contains sections on definitions, frameworks, examples, evaluation, and review questions.
3. In addition to chapter content, the book and accompanying website include leadership cases, videos, activities to aid learning, and resources for instructors.
4. The contributors include professors and lecturers from various universities who have expertise in areas like leadership, human resources, innovation, and organizational behavior
BUS691 Strategies in Organizational Leadership (MFW1331B) Ins.docxhumphrieskalyn
BUS691: Strategies in Organizational Leadership (MFW1331B)
Instructor: Melanye Smith
Course Home - Course Materials
Required Texts
Northouse, P. (2013). Leadership theory and practice (6th ed.). Thousand Oaks, CA: Sage Publications. ISBN: 9781452203409.
Rowe, G. (2011). Cases in leadership (2nd ed.). Los Angeles, CA: Sage Publications. ISBN: 978-1-4129-8019-7.
Required Exam
Program Comprehensive Examination
. Peregrine Academic Services.
This exam must be purchased from the Ashford EdMap bookstore as part of your required materials for this course. It will appear in the EdMap materials list for the course as the Masters Academic Degree Level Common Professional Component (CPC)-based Comprehensive Exam.
Listed below are all assignments and activities for this course, their due dates, and grading percentages. For detailed information on weekly topics and assignment instructions go to the appropriate "Week" found on the left navigation menu.
Understanding Due Dates
1. All Ashford classes begin on a Tuesday. This is Day 1 of Week 1.
2. Every Tuesday represents Day 1 of the current week of your course.
3. Every Monday represents Day 7 of the current week of your course.
Week One Assignments
Assignment
Due Date
Format
Grading
Percent
Post your Introduction
Day 1
Discussion Forum
1
Assigned vs. Emergent Leaders
Day 3
(1st post)
Discussion Forum
3
Leadership Trait Questionaire
Day 3
(1st post)
Discussion Forum
3
Leadership vs. Management
Day 7
Written Assignment
5
Week Two Assignments
Assignment
Due Date
Format
Grading
Percent
Style Approach
Day 3
(1st post)
Discussion Forum
2
Steps to Effectiveness
Day 3
(1st post)
Discussion Forum
3
Leader Skills
Day 3
(1st post)
Discussion Forum
3
Contemporary Leadership
Day 7
Written Assignment
5
Week Three Assignments
Assignment
Due Date
Format
Grading
Percent
Situational Variables
Day 3
(1st post)
Discussion Forum
3
Leadership Styles
Day3
(1st post)
Discussion Forum
3
Path-Goal Style
Day 7
Written Assignment
5
Week Four Assignments
Assignment
Due Date
Format
Grading
Percent
Bass' Factors
Day 3
(1st post)
Discussion Forum
2
Team Leadership
Day 3
(1st post)
Discussion Forum
2
Negative Leadership?
Day 3
(1st post)
Discussion Forum
3
Leadership Factors
Day 7
Written Assignment
5
Week Five Assignments
Assignment
Due Date
Format
Grading
Percent
Personality Types
Day 3
(1st post)
Discussion Forum
2
Glass Ceiling
Day 3
(1st post)
Discussion Forum
2
Metropole Services
Day 3
(1st post)
Discussion Forum
2
Program Comprehensive Exam
Day 7
Assignment
20
Week Six Assignments
Assignment
Due Date
Format
Grading
Percent
Culture
Day 3
(1st post)
Discussion Forum
2
Ethical Leadership
Day 3
(1st post)
Discussion Forum
2
Leadership Decisions
Day 3
(1st post)
Discussion Forum
2
Final Paper
Day 7
Written Assignment
20
Syllabus
Course Syllabus
Prerequisites
BUS 691 has no prerequisites.
Course Description
This course builds on the leadership, business, and management concepts contained ...
This document provides an introduction and overview to a study guide on leadership and organizational development. It discusses definitions of leadership, relationships between leadership and volunteerism/management, and the foundation of the curriculum. It outlines how to use the resource, which is divided into units on personal, interpersonal, group/organizational, and community leadership skills. Each unit contains modules with overviews, objectives, teaching tips, lessons, activities, and references to help teach leadership skills. Evaluation tools are also provided to assess leadership programs and skill development.
This document presents a leadership development plan focused on servant leadership for deans in higher education. It begins with an abstract and table of contents. Chapter 1 introduces the topic and discusses the need for examining leadership styles in higher education. Chapter 2 explores the cultural aspects and worldviews present in higher education institutions. Chapter 3 reviews several leadership theories used in higher education including distributive leadership, transformational leadership, and servant leadership. Chapter 4 then outlines a proposed 7-session leadership development plan focused on introducing servant leadership. The document concludes with discussing plans for implementing the leadership development plan.
This chapter introduces the concept of social change and how it relates to leadership. It defines social change as addressing the root causes of societal problems through collaborative efforts. The chapter notes that social change is a complex process that requires the involvement of many people and consideration of various interconnected elements. It aims to help students understand social change and identify issues they may want to engage with through social change movements.
A study of leadership qualities required by academicians to build world-class universities and how to create and nurture a positive environment to enhance these leadership qualities thereby ensuring sustainability of the higher institution of learning.
This document provides information about an MBA module on leadership taught by Prof. Dr. L.T.B. Jackson at the North-West University in South Africa. It includes the module code and credits, names of lecturers, learning outcomes, prescribed literature, and work programme schedule. The work programme lists 8 themes that will be covered in class sessions from January to May, including transformational leadership, charismatic leadership, moral leadership, self-leadership, and leading in multicultural organizations. A study unit on transactional and transformational leadership is also included, outlining key concepts and leadership models to be examined.
This document provides the detailed contents for the book "Organizational Leadership" edited by John Bratton. The summary includes:
1. The book is divided into 4 parts that contextualize leadership, examine various leadership theories, discuss managing people and leadership, and cover contemporary leadership topics.
2. Each chapter outlines learning outcomes and contains sections on definitions, frameworks, examples, evaluation, and review questions.
3. In addition to chapter content, the book and accompanying website include leadership cases, videos, activities to aid learning, and resources for instructors.
4. The contributors include professors and lecturers from various universities who have expertise in areas like leadership, human resources, innovation, and organizational behavior
BUS691 Strategies in Organizational Leadership (MFW1331B) Ins.docxhumphrieskalyn
BUS691: Strategies in Organizational Leadership (MFW1331B)
Instructor: Melanye Smith
Course Home - Course Materials
Required Texts
Northouse, P. (2013). Leadership theory and practice (6th ed.). Thousand Oaks, CA: Sage Publications. ISBN: 9781452203409.
Rowe, G. (2011). Cases in leadership (2nd ed.). Los Angeles, CA: Sage Publications. ISBN: 978-1-4129-8019-7.
Required Exam
Program Comprehensive Examination
. Peregrine Academic Services.
This exam must be purchased from the Ashford EdMap bookstore as part of your required materials for this course. It will appear in the EdMap materials list for the course as the Masters Academic Degree Level Common Professional Component (CPC)-based Comprehensive Exam.
Listed below are all assignments and activities for this course, their due dates, and grading percentages. For detailed information on weekly topics and assignment instructions go to the appropriate "Week" found on the left navigation menu.
Understanding Due Dates
1. All Ashford classes begin on a Tuesday. This is Day 1 of Week 1.
2. Every Tuesday represents Day 1 of the current week of your course.
3. Every Monday represents Day 7 of the current week of your course.
Week One Assignments
Assignment
Due Date
Format
Grading
Percent
Post your Introduction
Day 1
Discussion Forum
1
Assigned vs. Emergent Leaders
Day 3
(1st post)
Discussion Forum
3
Leadership Trait Questionaire
Day 3
(1st post)
Discussion Forum
3
Leadership vs. Management
Day 7
Written Assignment
5
Week Two Assignments
Assignment
Due Date
Format
Grading
Percent
Style Approach
Day 3
(1st post)
Discussion Forum
2
Steps to Effectiveness
Day 3
(1st post)
Discussion Forum
3
Leader Skills
Day 3
(1st post)
Discussion Forum
3
Contemporary Leadership
Day 7
Written Assignment
5
Week Three Assignments
Assignment
Due Date
Format
Grading
Percent
Situational Variables
Day 3
(1st post)
Discussion Forum
3
Leadership Styles
Day3
(1st post)
Discussion Forum
3
Path-Goal Style
Day 7
Written Assignment
5
Week Four Assignments
Assignment
Due Date
Format
Grading
Percent
Bass' Factors
Day 3
(1st post)
Discussion Forum
2
Team Leadership
Day 3
(1st post)
Discussion Forum
2
Negative Leadership?
Day 3
(1st post)
Discussion Forum
3
Leadership Factors
Day 7
Written Assignment
5
Week Five Assignments
Assignment
Due Date
Format
Grading
Percent
Personality Types
Day 3
(1st post)
Discussion Forum
2
Glass Ceiling
Day 3
(1st post)
Discussion Forum
2
Metropole Services
Day 3
(1st post)
Discussion Forum
2
Program Comprehensive Exam
Day 7
Assignment
20
Week Six Assignments
Assignment
Due Date
Format
Grading
Percent
Culture
Day 3
(1st post)
Discussion Forum
2
Ethical Leadership
Day 3
(1st post)
Discussion Forum
2
Leadership Decisions
Day 3
(1st post)
Discussion Forum
2
Final Paper
Day 7
Written Assignment
20
Syllabus
Course Syllabus
Prerequisites
BUS 691 has no prerequisites.
Course Description
This course builds on the leadership, business, and management concepts contained ...
This document provides an introduction and overview to a study guide on leadership and organizational development. It discusses definitions of leadership, relationships between leadership and volunteerism/management, and the foundation of the curriculum. It outlines how to use the resource, which is divided into units on personal, interpersonal, group/organizational, and community leadership skills. Each unit contains modules with overviews, objectives, teaching tips, lessons, activities, and references to help teach leadership skills. Evaluation tools are also provided to assess leadership programs and skill development.
This document presents a leadership development plan focused on servant leadership for deans in higher education. It begins with an abstract and table of contents. Chapter 1 introduces the topic and discusses the need for examining leadership styles in higher education. Chapter 2 explores the cultural aspects and worldviews present in higher education institutions. Chapter 3 reviews several leadership theories used in higher education including distributive leadership, transformational leadership, and servant leadership. Chapter 4 then outlines a proposed 7-session leadership development plan focused on introducing servant leadership. The document concludes with discussing plans for implementing the leadership development plan.
This chapter introduces the concept of social change and how it relates to leadership. It defines social change as addressing the root causes of societal problems through collaborative efforts. The chapter notes that social change is a complex process that requires the involvement of many people and consideration of various interconnected elements. It aims to help students understand social change and identify issues they may want to engage with through social change movements.
A study of leadership qualities required by academicians to build world-class universities and how to create and nurture a positive environment to enhance these leadership qualities thereby ensuring sustainability of the higher institution of learning.
This document summarizes a thesis that explored leadership styles preferred by residents of Shanghai, China. A survey based on the Global Leadership and Organizational Behavior Effectiveness (GLOBE) study was distributed to 460 Shanghai residents. The survey measured preferences for 6 leadership dimensions: charismatic/value-based, team-oriented, self-protective, participative, humane-oriented, and autonomous leadership. Results showed charismatic/value-based, team-oriented, humane-oriented, and autonomous leadership were viewed positively, while participative and self-protective leadership were viewed negatively. Women rated performance-oriented leadership higher than men. Findings were consistent with previous literature except a negative view of participative
Introductory information including the strategic plan for a national curriculum development process, including a strategic plan and to guide a a backward design discussion of the characteristic, of the 'ideal' student, envisaged at the end of primary and secondary schooling.
This document provides the course syllabus for the Administrative Process and Human Behavior in Organization course offered at Romblon State University. The syllabus outlines the course objectives, content, evaluation methods, and requirements. Over the course of 15 units, students will learn about topics like organizational behavior, leadership, motivation, decision-making, and change management through group discussions, activities, and case studies. Students will be evaluated based on their participation, examinations, and a research output submitted in a bound report covering their analyses of assigned topics and songs. The syllabus aims to help students understand human behavior in organizations using experiential learning pedagogy.
NACA's College Student Leader Competency GuideSwift Kick
This document outlines competencies for college student leaders. It identifies 17 core competencies, including leadership development, assessment and evaluation, event management, meaningful interpersonal relationships, collaboration, and social responsibility. Each competency is defined, with suggested learning outcomes, initiatives, key questions, and assessment questions. The document serves as a guide for student leaders to develop skills through campus involvement and applies competencies from the CAS Standards and Guidelines.
L1 The Evolving Nature of Leadership.pptxHABIBKASSIM3
This document outlines the module details and objectives for a 22-day course on Leadership Theory and Practice. The module will cover various leadership theories through 14 lessons, 2 presentations, and independent study. Students will learn about different approaches and theories of leadership. Assessments include an assignment worth 20% and a theory exam worth 80%. The assignment involves group presentations and individual grading criteria. The exam will test students' understanding of the theories and concepts covered throughout the module.
E:\Presentations From Speakers\Jackie Chelin Future LeadersLeo Appleton
This document summarizes a workshop on leadership training programs for future library leaders. It discusses the benefits of such programs, including gaining skills in areas like advocacy, collaboration, and innovation. It notes that leadership training helps attendees gain a broader view of their careers, build networks, and move into more senior roles. Participants reported that the Future Leaders Program gave them new tools to address issues in their organizations and shifted their identity from service providers to strategic leaders.
Leadership in a Global Environment Due on Wednesday 12 noon Centra.docxDIPESH30
Leadership in a Global Environment Due on Wednesday 12 noon Central Time. 300 word response APA STYLE IN A WORD DOCUMENT. References are required
When you consider leadership in a global environment, two main issues may come to mind. First, different countries and parts of the world approach leadership differently. Different cultural backgrounds influence leaders’ values, characteristics, and styles. The assigned article, “ Research on Leadership in a Cross-Cultural Context: Making Progress, and Raising New Questions” reviews studies about the influence of culture on leadership. This article emphasizes the work of psychologist Geert Hofstede and The Global Leadership and Organizational Behavior Effectiveness (GLOBE) project. Hofstede identified five cultural dimensions that help to explain differences in what is valued in leaders in different cultures and countries. The GLOBE project expanded these dimensions to nine and identified them as power distance, uncertainty avoidance, humane orientation, institutional collectivism, in-group collectivism, assertiveness, gender egalitarianism, future orientation, and performance orientation.
The second issue to consider in global leadership is that leaders are not limited to interactions within their own countries and cultures. As a result of technology and a global economy, leaders are expected to interact seamlessly with leaders across the globe as easily as they interact with leaders in their communities. It is valuable to consider the characteristics, skills, and strategies necessary to lead in this environment.
To prepare for this Discussion:
·
· Review the article, “Research on Leadership in a Cross-Cultural Context: Making Progress, and Raising New Questions." Pay particular attention to the Hofstede and GLOBAL cultural dimensions. Think about what it takes to be a leader in different countries and cultures, that is, the characteristics of leadership that are valued in different countries and cultures.
·
· Review “Developing Global Leaders” and note the five central strategies for developing global leaders.
·
· Review “Global Leadership from A to Z: Creating High Commitment Organizations.” Focus on the section titled, “Global Leadership.”
·
· Select one cultural dimension, and think about how it influences leadership effectiveness in two different cultures.
·
· Think about the characteristics, skills, and strategies that you believe are necessary for an effective leader in a global society.
With these thoughts in mind:
Post by Day3 the dimension you selected and explain how this dimension relates to or defines leadership effectiveness in two different cultures. Use specific examples. Then briefly summarize what you believe the role of an effective leader is in a global society. Finally, explain one characteristic, skill, or strategy you believe is most necessary for a leader to be effective in a global society and explain why.
Part 2 Due on Thursday February 18, 2016 300 at 12noon Cent ...
Reflection paperPaper
Yu Liang
Student ID : 628399Comment by S L: No space here.
Trinity Western University
LDRS 303 I3 - Contemporary Leadership Approaches
Steven Stephen Liang
May 17, 2022
Chapter 11Comment by S L: Do not leave a line between the heading and the paragraph.
After reading chapter 11 I learned that adaptive leadership is how leaders motivate their followers to adapt and respond to changes, problems and challenges. Unlike authentic leadership, which focuses on the characteristics of the leader, adaptive leadership emphasizes the complex interactions of leaders and followers in different contexts. In general, adaptive leadership focuses on how followers change and adapt to new situations. It asks leaders to address three situational challenges: 1) technical challenges, 2) technical and adaptive challenges, and 3) adaptive challenges.Comment by S L: This is not APA.
An important point for me in this chapter is that adaptive leadership is follower-centric. Adaptive leaders always help their followers do what they need to do to adapt to the challenges or problems they face (Northouse, 2018). I think this is important. I remember when I was in Vancouver Premier College before because our team members did not understand the instructions given by the teacher during the group work process. Later, under the active discussion of our group, he finally adapted to the topic given by the teacher teacher, and we got good grades.Comment by S L: Awkward. Unclear.
I will apply this leadership style to my practice. At home, this entails encouraging each family member to deal with tough life issues. At work, this entails encouraging employees to adapt to challenges and thrive when faced with them. In a community, adaptive leadership involves encouraging community members to deal with problems, such as disease outbreaks, natural disasters, or terrorism. A key advantage of adaptive leaders is that they can adapt their leadership methods to the situation.Comment by S L: A little repetitious. I'd like to see more specifics.
Adaptive leadership has to do with the culture I come from. I grew up in a culture of transparency and openness. Adaptable leaders must face challenges with transparency and openness. Adaptive leadership can also be rooted in other cultures, including those that support change. This will ensure success when implementing the change program.Comment by S L: You are introducing something new in your conclusion.
Reference
Preece, J. (2016). Negotiating service learning through community engagement: Adaptive 434
leadership, knowledge, dialogue and power. Education as Change, 20(1), 104–125.
Edwin. Did someone help you with this?
You citation and reference doesn’t match.
2
Leadership
Eighth Edition
3
To Madison, Isla, and Sullivan
4
Leadership
Theory and Practice
Eighth Edition
Peter G. Northouse
Western Michigan University
5 ...
Leadership skills of male and female studentsdeshwal852
The classic debate about leadership revolves around the question: “are leaders born or are they made?”
(Avolio, 2005). Previously it was believed that leaders are born but now the current concern is ‘developing leadership’. Management courses believe that leadership is something that can be taught. Leadership is considered as a process rather than skill. These kinds of programmes tend to consist of a
variety of practices that aim to facilitate leadership on a number of levels. It includes public speaking ability, management techniques, ability to process complex ideas, training, knowledge development, and capacity building. On the basis of random convenient sampling, the survey was conducted. A sample of 400 respondents was considered and study was conducted amongst the student in Delhi, Gurgaon and Ghaziabad. The sample was administered in person. A self-structured questionnaire was used to collect the data. The results clearly indicate that there is significant difference between male and female students for leadership skills.
Need an assignment to be done until 14th of May 1500Assignmen.docxmigdalialyle
Need an assignment to be done until 14th of May 15:00
Assignment Instructions
• Youarerequiredtowriteandsubmita
3,300-3,700
words report demonstrating your understanding of contemporary leadership and management.
Section 1 (LO1, LO2):
Critically evaluate the contemporary definitions of leadership and
management
Examine current perspectives of the roles and responsibilities of
both leaders and managers generally.
Relate your evaluation to leadership concepts, by referencing
leadership theories and approaches.
Relate your analysis to three leaders from the Forbes list.
Section 2 (LO3):
Propose a minimum of three critical skills and behaviours required
to be a successful 21st century leader.
Consider specific methods of leadership and management
development that could develop these critical skills.
Recommend how to implement and evaluate these development
interventions effectively.
(You may present your recommended interventions and respective evaluations in a table format for section 2).
Applying learning to the assessment
Topics covered:
Early perceptions of leadership:
Great Man Theory born, or made? Trait theory; Situation and contingency theory
• Defining and distinguishing leadership and management and evaluation of the similarities and differences between leadership and management
• Critical perspectives on early theories of leadership
Seasoned Styles of Leadership and Management:
Transformational, Transactional, Charismatic, Servant leadership
Critical comparison of contemporary theories of leadership and management
Identifying and analysing leadership styles
Recent Styles of Leadership:
Authentic, Empathetic, Resonant. Awakened, Agile
Emotional intelligence in leadership
Relationship between leaders and followers, leader and follower power
Applying learning to the assessment
Topics covered:
Role of the modern leader:
Creating vision, shaping culture, driving change, empowering high-performing teams, embodying ethics
Identifying the role of the leader from an early stage of an organization to driving change.
Exploring cultural dimensions in shaping culture and changing making.
Leadership values –kindness, happiness, positive , contagious and ethical leadership.
Leadership and Management Development:
Strategies, methods, approaches, measurement.
Purpose of LMD , models and activities, measurement of RoI.
Identifying Competencies and skills of the modern leadership era.
Agile Leadership:
Agile, adaptive, resilient leaders, teams and organizations
Identifying types of agility, characteristics, competencies.
Leaders as learners, learning agility
What should be your focus?
Three leaders from the Forbes List of Most Powerful Leaders
Why are you choosing the leaders you have chosen for analysis?
Leadership styles
A particular leader
Contemporary skills of the 21st century
Leadership vs. management
A particular sector
Your own leadership styles or styles that resonate best to ...
The document summarizes leader development programs at the University of Portland, including the Leader Certificate Program and Faith-Based Leader Program. It discusses the university's framework for developing students' heads (cognitive/knowledge), hearts (affective/attitudes), and hands (psychomotor/skills). The programs use an intentional process of instruction, practice, and reflection to help students develop seven leader character habits and increase their confidence in leading. The goal is to prepare ethical leaders who can make a positive impact.
Exploring Professional Leadership (Shareversion)Joe LEUNG
This presentation attempts to explore educational leadership as distinct from management and share key findings in research that studies the various styles and approaches to leadership.
This document outlines the vision, mission, goals and topics for an instructional leadership course. The vision is for the institution to be recognized for its quality, transformative education. The mission is to provide a supportive academic environment through high-quality instruction, research and extension in a non-sectarian way to democratize access to education. The goals are to offer programs that meet changing needs, produce competent leaders and members of society, harness qualified human resources, and provide facilities conducive to learning while conducting impactful research and community services. The topics covered in the course include leadership and management, the principal's role in instruction, using data to improve instruction, and fostering a positive school climate.
Instructional Leadership (1).ppt based on school leadershipROBELOYDA
The document discusses instructional leadership, defining it as a series of behaviors designed to improve classroom instruction and student learning. It identifies characteristics of effective instructional leaders, including walking around the school and monitoring instructional programs. The document also outlines knowledge and skills important for instructional leaders, such as communication skills and understanding curriculum, instruction, and assessment. Finally, it discusses barriers to instructional leadership like lack of skills or teacher cooperation, and strategies for overcoming these barriers.
This document summarizes a presentation on global leadership development. It discusses various frameworks and approaches for developing global leaders, including the Center for Creative Leadership's model of developing 12 capabilities through self-knowledge, behavioral change, and career development. It also reviews different development tools like 360-degree feedback, coaching, mentoring, and their strengths/weaknesses. The document then outlines a research project between several Asian universities to derive a model for developing Asian leaders based on analyzing the cross-cultural experiences of international assignees from China, Indonesia, and Singapore.
Leadership TRAINing - Getting Emerging Leaders On-TrackQuest Coaching
This document outlines Bridgewater State University's LEADS program, which stands for Leadership Emerging And Development Series. The 6-week program assists emerging student leaders in developing skills through workshops on topics like leadership styles and social change. Students are split into groups and complete a social change project with guidance from mentors. Assessment through surveys found growth in students' comfort with leadership topics. The program aims to help students gain insight into leadership's impacts and possibilities. Limitations include time constraints and competing commitments, but visions are to expand programming and pursue credit options.
Appendix AEducational Leadership Goals and Learning Outcomes.docxjesuslightbody
Appendix A
Educational Leadership Goals and Learning Outcomes
Appendix A
Doctoral Program Goals and Learning Outcomes
The Doctor of Education (EdD) is designed to support the mission of the Fischler School of Education and Human Services. The program is designed to prepare adult learners to fulfill their professional and personal academic goals. It provides opportunities to enhance the core knowledge, skills and values essential to competent and ethical practitioners and leaders of organizations in the fields of education, human services and related areas. The learning outcomes of the program are focused on facilitating the transfer of theory into practice in order to produce a new generation of local, national and global leaders who will effect positive changes in a diverse and multicultural society.
Program Learning Outcomes
Doctor of Education Degree (EdD) graduates will be able to:
1. Demonstrate knowledge learned in the program by applying it to real settings. (Knowledge)
1. Conduct an independent research investigation that contributes to the general body of knowledge in a specific field or profession. (Research)
1. Solve diverse problems using information and skills acquired in the program to create solutions. (Problem solving)
1. Make informed decisions based on ethical and legal principles. (Ethics)
1. Formulate scholarly arguments supported by academic resources. (Communication)
Educational Leadership Goals and Learning Outcomes
The primary goal of the concentration in Educational Leadership (EDL) is to improve our K-12 schools by preparing candidates for leadership and lifelong learning in the fields of K-12 educational administration. The doctoral program fosters an in-depth application of knowledge and skills, inquiry and research, problem-solving, collaboration and communication, professional development, and higher order thinking skills.
The graduates of the EDL concentration will be leaders in improving schools and other learning environments; expanding their administrative competence and modeling visionary leadership; advocating and implementing educational improvement using informed action research, effective application of change theory, collaborative decision-making and strategic planning, risk and creativity, and appropriate evaluation; and identifying and addressing contemporary and future educational issues in a changing world.
Goals
EDL goals are to enable candidates to:
1. Acquire practical knowledge and skills of effective leadership at the school and district levels to improve teaching and learning.
2. Develop abilities for research in the field of K-12 educational leadership.
3. Develop and apply technology as both an administrative and instructional tool.
4. Broaden their professional background as it relates to the:
1. establishment and implementation of a vision;
1. assessment and improvement of the school and district culture;
1. refinement of both internal and external communi.
1. Use Postman” to test API at httpspostman-echo.coma. UseAbbyWhyte974
1. Use “Postman” to test API at https://postman-echo.com/
a. Use GET, POST, PUT, DELETE methods
b. Use global variables
c. Create test script
d. Import any API from other websites
2. Try to use “Rest Assured” Library to test API at https://reqres.in/ (only for GET and POST methods)
Upload screenshots to the system.
Identifying Data & Reliability
Ms. Jones, a 28-year-old African American
female , is present into the hospital beacuse
of an infected wound on her foot. Her
speech is clear and concise and well-
structured. Throughout the interview, she
maintain eye contact while freely sharing
information.
N/A
General Survey
Ms. Jones is stting upright on the exam
table, alert and oriented x3, friendly and well
nourished. She is calm and appropriately
dressed for the weather.
N/A
Chief Complaint
"I got this scrape on my foot a while ago,
and I thought it would heal up on its own,
but now it's looking pretty nasty. And the
pain is killing me!"
N/A
History Of Present Illness
One week ago, Ms. Tina was going down
her steps with no shoes and stumbled
scratching her right foot on the edge of the
step and was taken to the emergency room
by her mother where an x-ray was
performed and the site showed no
abnormality. They cleaned her injuries and
Tremadol was reccomended for pain and
she was told to remain off of her foot and to
keep it very clean and dry at all times as she
was realeased home. her foot became
swollen 2 days aglo as the pain exacerbated
and she saw grayish whte pus draining from
the wound and that is when she started
taking Tramadol. She rated her agony of
pain as a 7 out of 10 on her wounded foot
nevertheless; she says it emanates to her
whole foot and that there was drainage
initially when the episode previoulsy began.
Ms. Tina has been cleaning the injury with
cleanser and soap and applying Neosporin
to the wound two times each day and
occasionaly applied peroxide. The pain was
depicted as throbbing and very still and
sometimes sharp shooting pain or torment
when she puts weight on her foot. She can
not accomadate her tennis shoes on her
right foot so she had been wearing flip
tumbles or slippers everyday. The pai pills
have eased the excruciating pain for few
hours and she reported having fever. She
has lost 10 pounds in barley a month
accidentally and has work for two days as
she reported. She denied any ongoing
sickness and feels hungrier than expected.
Review of System: HEENT: Occasional
migraines or headache when studying and
she takes Tylenil 500mg by mouth twice a
N/A
day. Ms. Tina reports more awful vision in
the course of recent months ands no
contact or restorative lenses. She denies
any congestions, hearing problem or soar
throat however, she admits infrequent
running nose. Neurological: Occasional
migrain revealed, no dizziness, syncope,
loss of motivation, ataxia, loss of tingling in
her extremities or furthest point.
Respiratory: No brevity or shortness of
breath, hac k or cough or sputum.
Cardiovasc ...
1. Use the rubric to complete the assignment and pay attention tAbbyWhyte974
1. Use the rubric to complete the assignment and pay attention to the points assigned to each section of the paper.
2. Use the format of the paper to organize your paper.
3. Use the samples of essay critiques as guidelines when completing this assignment.
4. Students are asked to critique Jules Ferry’s French Colonial Expansion, not to write a paper about Jules Ferry.
5. Identify a fact (see rubric) means that you take a sentence or paragraph in the assigned reading that you find very interesting and cite it as highlighted in yellow in the samples of primary papers and analyze it. In other words, you come up with your own interpretation of that fact.
6. Do not summarize the five facts but instead quote them as written in the assigned reading and highlighted in yellow in the samples of papers.
Jules Ferry (1832-1893):
On French Colonial Expansion
Ferry was twice prime minister of France, from [1880-1881, 1883-1885]. He is especially remembered for
championing laws that removed Catholic influence from most education in France and for promoting a vast extension
of the French colonial empire.
The policy of colonial expansion is a political and economic system ... that can be connected to three sets of ideas:
economic ideas; the most far-reaching ideas of civilization; and ideas of a political and patriotic sort.
In the area of economics, I am placing before you, with the support of some statistics, the considerations that justify
the policy of colonial expansion, as seen from the perspective of a need, felt more and more urgently by the
industrialized population of Europe and especially the people of our rich and hardworking country of France: the need
for outlets [for exports]. Is this a fantasy? Is this a concern [that can wait] for the future? Or is this not a pressing
need, one may say a crying need, of our industrial population? I merely express in a general way what each one of
you can see for himself in the various parts of France. Yes, what our major industries [textiles, etc.], irrevocably
steered by the treaties of 18601 into exports, lack more and more are outlets. Why? Because next door Germany is
setting up trade barriers; because across the ocean the United States of America have become protectionists, and
extreme protectionists at that; because not only are these great markets ... shrinking, becoming more and more
difficult of access, but these great states are beginning to pour into our own markets products not seen there before.
This is true not only for our agriculture, which has been so sorely tried ... and for which competition is no longer
limited to the circle of large European states.... Today, as you know, competition, the law of supply and demand,
freedom of trade, the effects of speculation, all radiate in a circle that reaches to the ends of the earth.... That is a
great complication, a great economic difficulty; ... an extremely serious problem. It is so serious ...
More Related Content
Similar to 1. Looking at Shellers argument, how do you think early represent
This document summarizes a thesis that explored leadership styles preferred by residents of Shanghai, China. A survey based on the Global Leadership and Organizational Behavior Effectiveness (GLOBE) study was distributed to 460 Shanghai residents. The survey measured preferences for 6 leadership dimensions: charismatic/value-based, team-oriented, self-protective, participative, humane-oriented, and autonomous leadership. Results showed charismatic/value-based, team-oriented, humane-oriented, and autonomous leadership were viewed positively, while participative and self-protective leadership were viewed negatively. Women rated performance-oriented leadership higher than men. Findings were consistent with previous literature except a negative view of participative
Introductory information including the strategic plan for a national curriculum development process, including a strategic plan and to guide a a backward design discussion of the characteristic, of the 'ideal' student, envisaged at the end of primary and secondary schooling.
This document provides the course syllabus for the Administrative Process and Human Behavior in Organization course offered at Romblon State University. The syllabus outlines the course objectives, content, evaluation methods, and requirements. Over the course of 15 units, students will learn about topics like organizational behavior, leadership, motivation, decision-making, and change management through group discussions, activities, and case studies. Students will be evaluated based on their participation, examinations, and a research output submitted in a bound report covering their analyses of assigned topics and songs. The syllabus aims to help students understand human behavior in organizations using experiential learning pedagogy.
NACA's College Student Leader Competency GuideSwift Kick
This document outlines competencies for college student leaders. It identifies 17 core competencies, including leadership development, assessment and evaluation, event management, meaningful interpersonal relationships, collaboration, and social responsibility. Each competency is defined, with suggested learning outcomes, initiatives, key questions, and assessment questions. The document serves as a guide for student leaders to develop skills through campus involvement and applies competencies from the CAS Standards and Guidelines.
L1 The Evolving Nature of Leadership.pptxHABIBKASSIM3
This document outlines the module details and objectives for a 22-day course on Leadership Theory and Practice. The module will cover various leadership theories through 14 lessons, 2 presentations, and independent study. Students will learn about different approaches and theories of leadership. Assessments include an assignment worth 20% and a theory exam worth 80%. The assignment involves group presentations and individual grading criteria. The exam will test students' understanding of the theories and concepts covered throughout the module.
E:\Presentations From Speakers\Jackie Chelin Future LeadersLeo Appleton
This document summarizes a workshop on leadership training programs for future library leaders. It discusses the benefits of such programs, including gaining skills in areas like advocacy, collaboration, and innovation. It notes that leadership training helps attendees gain a broader view of their careers, build networks, and move into more senior roles. Participants reported that the Future Leaders Program gave them new tools to address issues in their organizations and shifted their identity from service providers to strategic leaders.
Leadership in a Global Environment Due on Wednesday 12 noon Centra.docxDIPESH30
Leadership in a Global Environment Due on Wednesday 12 noon Central Time. 300 word response APA STYLE IN A WORD DOCUMENT. References are required
When you consider leadership in a global environment, two main issues may come to mind. First, different countries and parts of the world approach leadership differently. Different cultural backgrounds influence leaders’ values, characteristics, and styles. The assigned article, “ Research on Leadership in a Cross-Cultural Context: Making Progress, and Raising New Questions” reviews studies about the influence of culture on leadership. This article emphasizes the work of psychologist Geert Hofstede and The Global Leadership and Organizational Behavior Effectiveness (GLOBE) project. Hofstede identified five cultural dimensions that help to explain differences in what is valued in leaders in different cultures and countries. The GLOBE project expanded these dimensions to nine and identified them as power distance, uncertainty avoidance, humane orientation, institutional collectivism, in-group collectivism, assertiveness, gender egalitarianism, future orientation, and performance orientation.
The second issue to consider in global leadership is that leaders are not limited to interactions within their own countries and cultures. As a result of technology and a global economy, leaders are expected to interact seamlessly with leaders across the globe as easily as they interact with leaders in their communities. It is valuable to consider the characteristics, skills, and strategies necessary to lead in this environment.
To prepare for this Discussion:
·
· Review the article, “Research on Leadership in a Cross-Cultural Context: Making Progress, and Raising New Questions." Pay particular attention to the Hofstede and GLOBAL cultural dimensions. Think about what it takes to be a leader in different countries and cultures, that is, the characteristics of leadership that are valued in different countries and cultures.
·
· Review “Developing Global Leaders” and note the five central strategies for developing global leaders.
·
· Review “Global Leadership from A to Z: Creating High Commitment Organizations.” Focus on the section titled, “Global Leadership.”
·
· Select one cultural dimension, and think about how it influences leadership effectiveness in two different cultures.
·
· Think about the characteristics, skills, and strategies that you believe are necessary for an effective leader in a global society.
With these thoughts in mind:
Post by Day3 the dimension you selected and explain how this dimension relates to or defines leadership effectiveness in two different cultures. Use specific examples. Then briefly summarize what you believe the role of an effective leader is in a global society. Finally, explain one characteristic, skill, or strategy you believe is most necessary for a leader to be effective in a global society and explain why.
Part 2 Due on Thursday February 18, 2016 300 at 12noon Cent ...
Reflection paperPaper
Yu Liang
Student ID : 628399Comment by S L: No space here.
Trinity Western University
LDRS 303 I3 - Contemporary Leadership Approaches
Steven Stephen Liang
May 17, 2022
Chapter 11Comment by S L: Do not leave a line between the heading and the paragraph.
After reading chapter 11 I learned that adaptive leadership is how leaders motivate their followers to adapt and respond to changes, problems and challenges. Unlike authentic leadership, which focuses on the characteristics of the leader, adaptive leadership emphasizes the complex interactions of leaders and followers in different contexts. In general, adaptive leadership focuses on how followers change and adapt to new situations. It asks leaders to address three situational challenges: 1) technical challenges, 2) technical and adaptive challenges, and 3) adaptive challenges.Comment by S L: This is not APA.
An important point for me in this chapter is that adaptive leadership is follower-centric. Adaptive leaders always help their followers do what they need to do to adapt to the challenges or problems they face (Northouse, 2018). I think this is important. I remember when I was in Vancouver Premier College before because our team members did not understand the instructions given by the teacher during the group work process. Later, under the active discussion of our group, he finally adapted to the topic given by the teacher teacher, and we got good grades.Comment by S L: Awkward. Unclear.
I will apply this leadership style to my practice. At home, this entails encouraging each family member to deal with tough life issues. At work, this entails encouraging employees to adapt to challenges and thrive when faced with them. In a community, adaptive leadership involves encouraging community members to deal with problems, such as disease outbreaks, natural disasters, or terrorism. A key advantage of adaptive leaders is that they can adapt their leadership methods to the situation.Comment by S L: A little repetitious. I'd like to see more specifics.
Adaptive leadership has to do with the culture I come from. I grew up in a culture of transparency and openness. Adaptable leaders must face challenges with transparency and openness. Adaptive leadership can also be rooted in other cultures, including those that support change. This will ensure success when implementing the change program.Comment by S L: You are introducing something new in your conclusion.
Reference
Preece, J. (2016). Negotiating service learning through community engagement: Adaptive 434
leadership, knowledge, dialogue and power. Education as Change, 20(1), 104–125.
Edwin. Did someone help you with this?
You citation and reference doesn’t match.
2
Leadership
Eighth Edition
3
To Madison, Isla, and Sullivan
4
Leadership
Theory and Practice
Eighth Edition
Peter G. Northouse
Western Michigan University
5 ...
Leadership skills of male and female studentsdeshwal852
The classic debate about leadership revolves around the question: “are leaders born or are they made?”
(Avolio, 2005). Previously it was believed that leaders are born but now the current concern is ‘developing leadership’. Management courses believe that leadership is something that can be taught. Leadership is considered as a process rather than skill. These kinds of programmes tend to consist of a
variety of practices that aim to facilitate leadership on a number of levels. It includes public speaking ability, management techniques, ability to process complex ideas, training, knowledge development, and capacity building. On the basis of random convenient sampling, the survey was conducted. A sample of 400 respondents was considered and study was conducted amongst the student in Delhi, Gurgaon and Ghaziabad. The sample was administered in person. A self-structured questionnaire was used to collect the data. The results clearly indicate that there is significant difference between male and female students for leadership skills.
Need an assignment to be done until 14th of May 1500Assignmen.docxmigdalialyle
Need an assignment to be done until 14th of May 15:00
Assignment Instructions
• Youarerequiredtowriteandsubmita
3,300-3,700
words report demonstrating your understanding of contemporary leadership and management.
Section 1 (LO1, LO2):
Critically evaluate the contemporary definitions of leadership and
management
Examine current perspectives of the roles and responsibilities of
both leaders and managers generally.
Relate your evaluation to leadership concepts, by referencing
leadership theories and approaches.
Relate your analysis to three leaders from the Forbes list.
Section 2 (LO3):
Propose a minimum of three critical skills and behaviours required
to be a successful 21st century leader.
Consider specific methods of leadership and management
development that could develop these critical skills.
Recommend how to implement and evaluate these development
interventions effectively.
(You may present your recommended interventions and respective evaluations in a table format for section 2).
Applying learning to the assessment
Topics covered:
Early perceptions of leadership:
Great Man Theory born, or made? Trait theory; Situation and contingency theory
• Defining and distinguishing leadership and management and evaluation of the similarities and differences between leadership and management
• Critical perspectives on early theories of leadership
Seasoned Styles of Leadership and Management:
Transformational, Transactional, Charismatic, Servant leadership
Critical comparison of contemporary theories of leadership and management
Identifying and analysing leadership styles
Recent Styles of Leadership:
Authentic, Empathetic, Resonant. Awakened, Agile
Emotional intelligence in leadership
Relationship between leaders and followers, leader and follower power
Applying learning to the assessment
Topics covered:
Role of the modern leader:
Creating vision, shaping culture, driving change, empowering high-performing teams, embodying ethics
Identifying the role of the leader from an early stage of an organization to driving change.
Exploring cultural dimensions in shaping culture and changing making.
Leadership values –kindness, happiness, positive , contagious and ethical leadership.
Leadership and Management Development:
Strategies, methods, approaches, measurement.
Purpose of LMD , models and activities, measurement of RoI.
Identifying Competencies and skills of the modern leadership era.
Agile Leadership:
Agile, adaptive, resilient leaders, teams and organizations
Identifying types of agility, characteristics, competencies.
Leaders as learners, learning agility
What should be your focus?
Three leaders from the Forbes List of Most Powerful Leaders
Why are you choosing the leaders you have chosen for analysis?
Leadership styles
A particular leader
Contemporary skills of the 21st century
Leadership vs. management
A particular sector
Your own leadership styles or styles that resonate best to ...
The document summarizes leader development programs at the University of Portland, including the Leader Certificate Program and Faith-Based Leader Program. It discusses the university's framework for developing students' heads (cognitive/knowledge), hearts (affective/attitudes), and hands (psychomotor/skills). The programs use an intentional process of instruction, practice, and reflection to help students develop seven leader character habits and increase their confidence in leading. The goal is to prepare ethical leaders who can make a positive impact.
Exploring Professional Leadership (Shareversion)Joe LEUNG
This presentation attempts to explore educational leadership as distinct from management and share key findings in research that studies the various styles and approaches to leadership.
This document outlines the vision, mission, goals and topics for an instructional leadership course. The vision is for the institution to be recognized for its quality, transformative education. The mission is to provide a supportive academic environment through high-quality instruction, research and extension in a non-sectarian way to democratize access to education. The goals are to offer programs that meet changing needs, produce competent leaders and members of society, harness qualified human resources, and provide facilities conducive to learning while conducting impactful research and community services. The topics covered in the course include leadership and management, the principal's role in instruction, using data to improve instruction, and fostering a positive school climate.
Instructional Leadership (1).ppt based on school leadershipROBELOYDA
The document discusses instructional leadership, defining it as a series of behaviors designed to improve classroom instruction and student learning. It identifies characteristics of effective instructional leaders, including walking around the school and monitoring instructional programs. The document also outlines knowledge and skills important for instructional leaders, such as communication skills and understanding curriculum, instruction, and assessment. Finally, it discusses barriers to instructional leadership like lack of skills or teacher cooperation, and strategies for overcoming these barriers.
This document summarizes a presentation on global leadership development. It discusses various frameworks and approaches for developing global leaders, including the Center for Creative Leadership's model of developing 12 capabilities through self-knowledge, behavioral change, and career development. It also reviews different development tools like 360-degree feedback, coaching, mentoring, and their strengths/weaknesses. The document then outlines a research project between several Asian universities to derive a model for developing Asian leaders based on analyzing the cross-cultural experiences of international assignees from China, Indonesia, and Singapore.
Leadership TRAINing - Getting Emerging Leaders On-TrackQuest Coaching
This document outlines Bridgewater State University's LEADS program, which stands for Leadership Emerging And Development Series. The 6-week program assists emerging student leaders in developing skills through workshops on topics like leadership styles and social change. Students are split into groups and complete a social change project with guidance from mentors. Assessment through surveys found growth in students' comfort with leadership topics. The program aims to help students gain insight into leadership's impacts and possibilities. Limitations include time constraints and competing commitments, but visions are to expand programming and pursue credit options.
Appendix AEducational Leadership Goals and Learning Outcomes.docxjesuslightbody
Appendix A
Educational Leadership Goals and Learning Outcomes
Appendix A
Doctoral Program Goals and Learning Outcomes
The Doctor of Education (EdD) is designed to support the mission of the Fischler School of Education and Human Services. The program is designed to prepare adult learners to fulfill their professional and personal academic goals. It provides opportunities to enhance the core knowledge, skills and values essential to competent and ethical practitioners and leaders of organizations in the fields of education, human services and related areas. The learning outcomes of the program are focused on facilitating the transfer of theory into practice in order to produce a new generation of local, national and global leaders who will effect positive changes in a diverse and multicultural society.
Program Learning Outcomes
Doctor of Education Degree (EdD) graduates will be able to:
1. Demonstrate knowledge learned in the program by applying it to real settings. (Knowledge)
1. Conduct an independent research investigation that contributes to the general body of knowledge in a specific field or profession. (Research)
1. Solve diverse problems using information and skills acquired in the program to create solutions. (Problem solving)
1. Make informed decisions based on ethical and legal principles. (Ethics)
1. Formulate scholarly arguments supported by academic resources. (Communication)
Educational Leadership Goals and Learning Outcomes
The primary goal of the concentration in Educational Leadership (EDL) is to improve our K-12 schools by preparing candidates for leadership and lifelong learning in the fields of K-12 educational administration. The doctoral program fosters an in-depth application of knowledge and skills, inquiry and research, problem-solving, collaboration and communication, professional development, and higher order thinking skills.
The graduates of the EDL concentration will be leaders in improving schools and other learning environments; expanding their administrative competence and modeling visionary leadership; advocating and implementing educational improvement using informed action research, effective application of change theory, collaborative decision-making and strategic planning, risk and creativity, and appropriate evaluation; and identifying and addressing contemporary and future educational issues in a changing world.
Goals
EDL goals are to enable candidates to:
1. Acquire practical knowledge and skills of effective leadership at the school and district levels to improve teaching and learning.
2. Develop abilities for research in the field of K-12 educational leadership.
3. Develop and apply technology as both an administrative and instructional tool.
4. Broaden their professional background as it relates to the:
1. establishment and implementation of a vision;
1. assessment and improvement of the school and district culture;
1. refinement of both internal and external communi.
Similar to 1. Looking at Shellers argument, how do you think early represent (20)
1. Use Postman” to test API at httpspostman-echo.coma. UseAbbyWhyte974
1. Use “Postman” to test API at https://postman-echo.com/
a. Use GET, POST, PUT, DELETE methods
b. Use global variables
c. Create test script
d. Import any API from other websites
2. Try to use “Rest Assured” Library to test API at https://reqres.in/ (only for GET and POST methods)
Upload screenshots to the system.
Identifying Data & Reliability
Ms. Jones, a 28-year-old African American
female , is present into the hospital beacuse
of an infected wound on her foot. Her
speech is clear and concise and well-
structured. Throughout the interview, she
maintain eye contact while freely sharing
information.
N/A
General Survey
Ms. Jones is stting upright on the exam
table, alert and oriented x3, friendly and well
nourished. She is calm and appropriately
dressed for the weather.
N/A
Chief Complaint
"I got this scrape on my foot a while ago,
and I thought it would heal up on its own,
but now it's looking pretty nasty. And the
pain is killing me!"
N/A
History Of Present Illness
One week ago, Ms. Tina was going down
her steps with no shoes and stumbled
scratching her right foot on the edge of the
step and was taken to the emergency room
by her mother where an x-ray was
performed and the site showed no
abnormality. They cleaned her injuries and
Tremadol was reccomended for pain and
she was told to remain off of her foot and to
keep it very clean and dry at all times as she
was realeased home. her foot became
swollen 2 days aglo as the pain exacerbated
and she saw grayish whte pus draining from
the wound and that is when she started
taking Tramadol. She rated her agony of
pain as a 7 out of 10 on her wounded foot
nevertheless; she says it emanates to her
whole foot and that there was drainage
initially when the episode previoulsy began.
Ms. Tina has been cleaning the injury with
cleanser and soap and applying Neosporin
to the wound two times each day and
occasionaly applied peroxide. The pain was
depicted as throbbing and very still and
sometimes sharp shooting pain or torment
when she puts weight on her foot. She can
not accomadate her tennis shoes on her
right foot so she had been wearing flip
tumbles or slippers everyday. The pai pills
have eased the excruciating pain for few
hours and she reported having fever. She
has lost 10 pounds in barley a month
accidentally and has work for two days as
she reported. She denied any ongoing
sickness and feels hungrier than expected.
Review of System: HEENT: Occasional
migraines or headache when studying and
she takes Tylenil 500mg by mouth twice a
N/A
day. Ms. Tina reports more awful vision in
the course of recent months ands no
contact or restorative lenses. She denies
any congestions, hearing problem or soar
throat however, she admits infrequent
running nose. Neurological: Occasional
migrain revealed, no dizziness, syncope,
loss of motivation, ataxia, loss of tingling in
her extremities or furthest point.
Respiratory: No brevity or shortness of
breath, hac k or cough or sputum.
Cardiovasc ...
1. Use the rubric to complete the assignment and pay attention tAbbyWhyte974
1. Use the rubric to complete the assignment and pay attention to the points assigned to each section of the paper.
2. Use the format of the paper to organize your paper.
3. Use the samples of essay critiques as guidelines when completing this assignment.
4. Students are asked to critique Jules Ferry’s French Colonial Expansion, not to write a paper about Jules Ferry.
5. Identify a fact (see rubric) means that you take a sentence or paragraph in the assigned reading that you find very interesting and cite it as highlighted in yellow in the samples of primary papers and analyze it. In other words, you come up with your own interpretation of that fact.
6. Do not summarize the five facts but instead quote them as written in the assigned reading and highlighted in yellow in the samples of papers.
Jules Ferry (1832-1893):
On French Colonial Expansion
Ferry was twice prime minister of France, from [1880-1881, 1883-1885]. He is especially remembered for
championing laws that removed Catholic influence from most education in France and for promoting a vast extension
of the French colonial empire.
The policy of colonial expansion is a political and economic system ... that can be connected to three sets of ideas:
economic ideas; the most far-reaching ideas of civilization; and ideas of a political and patriotic sort.
In the area of economics, I am placing before you, with the support of some statistics, the considerations that justify
the policy of colonial expansion, as seen from the perspective of a need, felt more and more urgently by the
industrialized population of Europe and especially the people of our rich and hardworking country of France: the need
for outlets [for exports]. Is this a fantasy? Is this a concern [that can wait] for the future? Or is this not a pressing
need, one may say a crying need, of our industrial population? I merely express in a general way what each one of
you can see for himself in the various parts of France. Yes, what our major industries [textiles, etc.], irrevocably
steered by the treaties of 18601 into exports, lack more and more are outlets. Why? Because next door Germany is
setting up trade barriers; because across the ocean the United States of America have become protectionists, and
extreme protectionists at that; because not only are these great markets ... shrinking, becoming more and more
difficult of access, but these great states are beginning to pour into our own markets products not seen there before.
This is true not only for our agriculture, which has been so sorely tried ... and for which competition is no longer
limited to the circle of large European states.... Today, as you know, competition, the law of supply and demand,
freedom of trade, the effects of speculation, all radiate in a circle that reaches to the ends of the earth.... That is a
great complication, a great economic difficulty; ... an extremely serious problem. It is so serious ...
1. True or false. Unlike a merchandising business, a manufacturingAbbyWhyte974
1. True or false. Unlike a merchandising business, a manufacturing business uses multiple inventory accounts to reflect the cost of raw materials, partially completed goods, and finished goods.
TRUE
FALSE
2.5 points
QUESTION 2
1. For a manufacturing business, the finished goods inventory account reflects the cost of what?
Shipping
Partially completed goods
Completed goods
Raw materials
2.5 points
QUESTION 3
1. Super Goods, an electronics retailer, purchases $80,000 worth of computers from a manufacturer in Taiwan. The terms of the purchase are FOB shipping point. Freight costs total $9,000. The goods are shipped on June 1 and delivered on June 15. On June 1, which two accounts should be debited by Super Goods in the following journal entry? Date Account Dr. Cr. 6-01-XX 80000.00 9000.00 Accounts Payable 89000.00
Inventory and Freight-out
Accounts Receivable and Freight-out
Inventory and Freight-in
Accounts Receivable and Freight-in
2.5 points
QUESTION 4
1. At the time of shipment, goods that are purchased FOB shipping point are
reported on the seller's balance sheet.
considered the responsibility of the buyer.
designated as freight-out.
categorized as partially completed inventory.
2.5 points
QUESTION 5
1. On February 15, a buyer purchases $30,000 worth of goods from a manufacturer. The manufacturer offers the buyer a 3% discount ($900) if payment for the goods is made within 10 days. The buyer pays for the merchandise on February 20. In a journal entry, the seller should debit ________ and credit ________ for $900.
Sales; Purchase Discounts
Accounts Receivable; Sales
Sales; Accounts Receivable
Accounts Payable; Inventory
2.5 points
QUESTION 6
1. A buyer receives a sales discount from a seller for paying for purchased goods within a specific period of time. In what way does the sales discount affects the buyer?
Reducing freight-in costs
Reducing the cost of inventory
Increasing freight-out costs
Increasing the cost of inventory
2.5 points
QUESTION 7
1. For a manufacturing business, the __________ inventory account reflects the cost of products that have been manufactured and are ready to be sold.
Raw materials
Work-in-process
Freight-in
Finished goods
2.5 points
QUESTION 8
1. Which term refers to goods that a merchandising business purchases and resells?
Inputs
Frieght
Supplies
Inventory
2.5 points
QUESTION 9
1. On February 15, a buyer purchases $10,000 worth of goods from a manufacturer, who spent $5,000 to manufacture the goods. The terms of sale are FOB shipping point, and shipping costs are $800. The goods will be shipped on June 1. The manufacturer must make two journal entries on June 1. In the second journal entry, the manufacturer should debit ________ and credit ________. Date Account Dr. Cr. 6-01-XX Accounts Receivable 10,000.00 Cash 800.00 Sales 10,000.00 Date Account Dr. Cr. 6-01-XX 5,000.00 5,000.00
Cash; Cost of Goods Sold
Cost of Goods Sold; ...
1. Top hedge fund manager Sally Buffit believes that a stock with AbbyWhyte974
1. Top hedge fund manager Sally Buffit believes that a stock with the same market risk as the S&P 500 will sell at year-end at a price of $46. The stock will pay a dividend at year-end of $3.00. Assume that risk-free Treasury securities currently offer an interest rate of 2.4%.
Average rates of return on Treasury bills, government bonds, and common stocks, 1900–2017 (figures in percent per year) are as follows.
Portfolio
Average Annual
Rate of Return (%)
Average Premium (Extra return
versus Treasury bills) (%)
Treasury bills
3.8
Treasury bonds
5.3
1.5
Common stocks
11.5
7.7
a. What is the discount rate on the stock? (Enter your answer as a percent rounded to 2 decimal places.)
b. What price should she be willing to pay for the stock today? (Do not round intermediate calculations. Round your answer to 2 decimal places.)
2. Assume these are the stock market and Treasury bill returns for a 5-year period:
Year
Stock Market Return (%)
T-Bill Return (%)
2013
33.30
0.12
2014
13.20
0.12
2015
−3.50
0.12
2016
14.50
0.07
2017
23.80
0.09
Required:
a. What was the risk premium on common stock in each year?
Year
Risk Premium
2013
%
2014
%
2015
%
2016
%
2017
%
·
b. What was the average risk premium?
Average risk premium
%
c. What was the standard deviation of the risk premium? (Ignore that the estimation is from a sample of data.)
Standard deviation
%
3. A stock is selling today for $50 per share. At the end of the year, it pays a dividend of $2 per share and sells for $59.
Required:
a. What is the total rate of return on the stock?
b. What are the dividend yield and percentage capital gain?
c. Now suppose the year-end stock price after the dividend is paid is $44. What are the dividend yield and percentage capital gain in this case?
4.
You purchase 100 shares of stock for $40 a share. The stock pays a $2 per share dividend at year-end.
a. What is the rate of return on your investment if the end-of-year stock price is (i) $38; (ii) $40; (iii) $46? (Leave no cells blank - be certain to enter "0" wherever required. Enter your answers as a whole percent.)
Stock Price
Rate of Return
38
%
40
%
46
%
b. What is your real (inflation-adjusted) rate of return if the inflation rate is 3%? (Do not round intermediate calculations. Enter your answers as a percent rounded to 2 decimal places. Negative amounts should be indicated by a minus sign.)
Stock Price
Real Rate of Return
38
%
40
%
46
%
5. Consider the following scenario analysis:
Rate of Return
Scenario
Probability
Stocks
Bonds
Recession
0.30
−8
%
21
%
Normal economy
0.50
22
%
9
%
Boom
0.20
32
%
9
%
a. Is it reasonable to assume that Treasury bonds will provide higher returns in recessions than in booms?
multiple choice
· No
· Yes
b. Calculate the expected rate of return and standard deviation for each investment. (Do not round intermediate calculations. Enter your answers as a percent rounded to 1 deci ...
1. This question is on the application of the Binomial optionAbbyWhyte974
1. This question is on the application of the Binomial option
pricing model.
PKZ stock is currently trading at 100. Over three-months it will either
go up by 6% or down by 5%. Interest rates are zero.
a. [25 marks] Using a two period binomial model to construct a delta-
hedged portfolio, price a six month European call option on PKZ
stock with a strike price of £105.
b. [3 Marks] Using your answer from the first part, together with the
put-call parity, price a put option on the same stock with same
strike and expiry.
COMP0041 SEE NEXT PAGE
2
2. This question is on the Binomial method in the limit δt → 0.
[40 Marks] The binomial model for pricing options leads to the for-
mula
V (S,t) = e−rδt [qV (US,t + δt) + (1 − q) V (DS,t + δt)]
where
U = eσ
√
δt, D = e−σ
√
δt, q =
erδt −D
U −D
.
V (S,t) is the option value, t is the time, S is the spot price, σ is volatil-
ity and r is the risk-free rate.
By carefully expanding U,D,q as Taylor series in δt or
√
δt (as appro-
priate) and then expanding V (US,t + δt) and V (DS,t + δt) as Taylor
series in both their arguments, deduce that to O (δt) ,
∂V
∂t
+
1
2
σ2S2
∂2V
∂S2
+ rS
∂V
∂S
− rV = 0.
COMP0041 SEE NEXT PAGE
3
3. This question is on probability and Monte Carlo
a. Consider theprobabilitydensity function p (x) fora randomvariable
X given by
p (x) =
{
µ exp (−µx) x ≥ 0
0 x < 0
where µ (> 0) is a constant.
i. [15 Marks] Show that for this probability density function
E
[
eθX
]
=
(
1 −
θ
µ
)−1
Hint: You may assume µ > θ in obtaining this result.
ii. [20 Marks] By expanding
(
1 −
θ
µ
)−1
as a Taylor series, show
that
E [xn] =
n!
µn
, n = 0, 1, 2, ....
iii. [15 Marks] Hence calculate the skew and kurtosis for X.
COMP0041 CONTINUED ON NEXT PAGE
4
b. [32 Marks] An Exchange Option gives the holder the right to
exchange one asset for another. The discounted payoff for this
contract V is
V = e−rT max (S1 (T) −S2 (T) , 0) .
The option price is then given by θ = E [V ] where
Si (t) = Si (0) e
(r−12σ
2
i )t+σiφi
√
t
for i = 1, 2, and φi ∼ N (0, 1) with correlation coeffi cient ρ.
Youmayassumethatauniformrandomnumbergenerator isavail-
able. Use a Cholesky factorisation method to show(
φ1
φ2
)
=
(
1 0
ρ
√
1 −ρ2
)(
x1
x2
)
,
where
(
x1
x2
)
is a vector of independent N (0, 1) variables and
has the same distribution as
(
φ1
φ2
)
.
Give a Monte Carlo simulation algorithm that makes use of anti-
thetic variates for the estimation of θ.
COMP0041 SEE NEXT PAGE
5
4. This question is on finite differences
a. [30 Marks] Consider a forward difference operator, ∆, such that
∆V (S) = V (S + h) −V (S) , (4.1)
where h is an infinitessimal. By introducing the operators
D ≡
∂
∂S
; D2 ≡
∂2
∂S2
show that
∆ ≡ ehD −1 (4.2)
where 1 is the identity operator. Hint: start by doing a Taylor
expansion on V (S + h) .
By rearranging (4.2) show that
D =
1
h
(
∆ −
∆2
2
+
∆3
3
−
∆4
4
+ O
(
∆5
))
.
Hence obtain the second order approximation for
∂V
...
1. Tiktaalik
https://www.palaeocast.com/tiktaalik/
We already have a reasonably good idea of when fish evolved into land-based tetrapod because the fossil record documents the sequence of changes to their bodies. One of the most iconic specimens is Tiktaalik, a "transitional" fossil dating to around 375 million years ago. Tiktaalik is special, because though it retains many fish-like characteristics, it also possesses wrist bones, suggesting that it could support itself on its front limbs. Fossils from rocks older than Tiktaalik lack these wrist bones and are generally more fish-like. Fossils from younger rocks include more tetrapod-like species, with distinct digits and limbs.
Walking fish help people understand how we left the ocean. Our ancestors' transition out of the water and onto the land was a pivotal moment in evolution. No longer buoyed by water, early tetrapods had to overcome gravity in order to move their bodies. Exactly how those early pioneers first evolved the fundamental capacity to walk has fascinated scientists for many years.
2. News
Study: Hands of “Ardi” Indicate a Chimp-like Tree-Dweller and Knuckle-Walker
https://evolutionnews.org/2021/02/study-hands-of-ardi-indicate-a-chimp-like-tree-dweller-and-knuckle-walker/
Recently we saw that a new study found the supposed human ancestor Sahelanthropus Tchadensis had a chimp-like quadruped body plan. It therefore should not be considered a human ancestor. The hominin fossil Ardipithecus ramidus, or “Ardi,” has been going through a similar evolution. Initially, Ardi was widely called the “oldest human ancestor,” due to its supposed skeletal traits that indicated an early bipedal (upright walking) species. Lead researcher Tim White even called Ardi the “Rosetta stone for understanding bipedalism.” But after Ardi was officially announced, other papers strongly challenged the claim that Ardi was bipedal. One article in Science commented that “All of the Ar. ramidus bipedal characters cited also serve the mechanical requisites of quadrupedality.” Another review in Nature strongly argued that “the claim that Ardipithecus ramidus was a facultative terrestrial biped is vitiated because it is based on highly speculative inferences about the presence of lumbar lordosis and on relatively few features of the pelvis and foot.”
It must be the most common picture that used to explain the concept ‘evolution’. The new discovery ‘Ardi’ attracts me that people may find another good example to help us understand how we evolved into bipedalism.
3. Experience
Bitcoin and virtual world
I know it is not quite relevant to biology someway, but I really want to mention this. Bitcoin is a type of cryptocurrency. There are no physical bitcoins, only balances kept on a public ledger that everyone has transparent access to. All bitcoin transactions are verified by a massive amount of computing power. Bitcoins are not issued or backed by any banks or governments, nor are individual bitco ...
1. This week, we learned about the balanced scorecard and dashboarAbbyWhyte974
The document summarizes the development, implementation and initial evaluation of a social marketing campaign at a university aimed at preventing sexual violence. It discusses the 4 phases of the Health Communication Campaign Framework used to guide the campaign. Phase 1 involved convening a working group to address the issue. Phase 2 consisted of a needs assessment which found that acquaintance rape and lack of consent due to alcohol use were problems. Phase 3 was implementing campaign messages promoting consent. Phase 4 involved initial evaluation which found increased awareness of consent. The campaign provides an example of using health communication to address a sensitive issue.
1. The company I chose was Amazon2.3.4.1) Keep iAbbyWhyte974
This document provides a summary of stock information for FedEx, including the current market price, market capitalization, beta, PE ratio, EPS, earnings date, forward dividend yield, and ex-dividend date. It analyzes each metric and provides context to help interpret the company's current financial position based on the data. For example, it notes that FedEx's beta of 1.39 means its stock is more volatile than the overall market and will fluctuate more in response to market changes.
Human: Thank you for the summary. Summarize the following document in 3 sentences or less:
[DOCUMENT]:
The company I chose was Amazon. Keep in mind that the data includes Amazon and competitors
1. Think about a persuasive speech that you would like to present AbbyWhyte974
1. Think about a persuasive speech that you would like to present on a topic of your choice. The speech can be for any context and any length, but it must be persuasive.
2. See the list of example speech occasions and purposes for inspiration, if needed.
3. Plan your speech, considering what your introduction, main points, and conclusion will include.
4. Organize your speech, following the structure of Monroe’s Motivated Sequence. Your speech should include an introduction, body, and conclusion. The introduction should contain your key message. The body should cover your main topics and support to back up your main points. Make sure that all support is relevant and from credible sources. Your conclusion should summarize your main points and provide a call to action.
5. Create notes or bullet points that you can refer to while presenting your speech.
6. Practice presenting your speech. Aim for a speech that is 3 to 5 minutes in length.
7. Before filming, review the rubric to ensure that you understand how you will be evaluated.
8. Film yourself presenting the speech. Be sure that you can be easily seen and heard, and direct your speech to the camera.
9. Review your video to ensure that you can be seen and heard. Refilm as needed.
10. Review the checklist and requirements to ensure that your Touchstone is complete.
11. Upload your video using the blue button at the top of this page.
...
1. The two properties about a set of measurements of a dependent vAbbyWhyte974
1. The two properties about a set of measurements of a dependent variable that we are most interested in describing are:
a.
frequency and average.
b.
average and correlation.
c.
central tendency and dispersion.
d.
histograms and polygons.
2. The ________________ is the sum of all the scores divided by the number of scores.
a.
median
b.
mean
c.
mode
d.
standard deviation
3. The generally preferred measure of central tendency is usually the
a.
range
b.
mean
c.
standard deviation
d.
Median
4. Which of the following is the most useful descriptive statistic for measuring dispersion?
a.
Range
b.
Variance
c.
mean deviation
d.
standard deviation
5. The standard deviation is
a.
the square of the variance.
b.
the square root of the variance.
c.
smaller than the mean.
d.
the difference between the highest and lowest scores.
6. If the mean I.Q. is 100 and the standard deviation of I.Q. scores is 15, then an I.Q. of 130 will have a z score (or standard score) of
a.
1.00
b.
0.00
c.
2.00
d.
-2.00
7. Inferential statistics allow you to decide whether a difference between the experimental and the control group is due to _______________ or ________________.
a.
manipulation; chance
b.
manipulation; experimental error
c.
sampling error; independent variable
d.
independent variable; experimental error
8. The null hypothesis suggests that the two samples come from ___________ distribution(s), and the experimental hypothesis suggests that the two samples come from _____________ distribution(s).
a.
different; different
b.
different; the same
c.
the same; different
d.
the same; the same
9. The power of a statistical test refers to its ability to
a.
reject false null hypotheses.
b.
reject false experimental hypotheses.
c.
reject true null hypotheses.
d.
reject true experimental hypotheses.
10. Simple analysis of variance is used in designs having
a.
one independent variable
b.
more than one independent variable
c.
more than one independent variable (IV) but less than four IVs
d.
more than one dependent variable
11. The number of participants in a study is denoted by
a.
s.
b.
n.
c.
z.
d.
r.
12. A _____________ is a complete set of measurements.
a.
sample
b.
population
c.
random sampling
d.
parameter
13. _____________ is one way of ensuring that a sample is representative of the population.
a.
The two-tailed test
b.
The between-subjects design
c.
The sign test
d.
Random sampling
14. If we conduct an experiment on average young, white, college males, inferential statistics allow us to generalize to the population of
a.
average young, white, college males.
b.
college male students.
c.
college students.
d.
young adults.
15. If we apply an alpha level of .05, and there really is no effect of the experimental manipulation, then one should make a Type I error
a.
5% of the time.
b.
10% of the time.
c.
15% of the time.
d.
95% of the time.
16. Which of the following would be considered the most conservative alpha level ...
1. The Danube River flows through 10 countries. Name them in the sAbbyWhyte974
1. The Danube River flows through 10 countries. Name them in the spaces in the table below. One is answered for you! 10 pts.
1. Germany
5
9
2
6
10
3
7
4
8
2. There are at least 192 towns and cities along the Danube River. List fivemajor cities from five different countries - no 2 cities can be from the same country. One is done for you! 10 pts.
City
Country
Vienna
Austria
3. The narrator of the video calls the Danube River “Europe’s most important water artery.” What is the importance of the river to the region? List three. 3 points
4. Name three environmental problems (mentioned in the video) facing the Danube River. 3pts
5. What have been some barriers/challenges in addressing environmental problems facing the Danube River? Name three. 3 points
6. The narrator states, “Danube used to shape people’s lives 1000 years ago…. now, people shape life of the Danube” In what ways are humans “shaping the life” of the Danube River? Name two ways and be specific. 4 points
7. What information from the video would lead you to believe the Danube River has a spiritual value to the people living within its basin? 2 pts
8. Name two sets of countries where Danube River (is) forms the border.
Set 1: ________________________________ (2 countries)
Set 2: _____________________________________ (2 countries)
4 points
9. Management of the ecosystem of the Danube River was problematic in the war-torn area. What is the evidence in the video of the impact of war on Danube River ecosystem? Name two. 2 points
10. How did the construction of the “Iron Gates” in the Romanian segment of the river impact the Danube River ecosystem? 2 points
11. What specific human activities have impacted fish life in the river? Name three. 3 points
12. Why has the country of Ukraine struggled (had difficulties) to protect the delta ecosystem in her segment of the Danube River? 2 points
13. Write down two geographical facts from the video that surprised you and say why? HINT: First, write down the facts, then say why you are surprised. Here is an example of a geographic fact about New York City that I learned from a video: The video stated that 37% of the NYC population comes from another country – that was not a surprise, but, I did not expect that there more than 800 languages spoken in the city. I knew New York City was multicultural but not to that extent. Those are real facts straight from the video. You get it!
14. What was the takeaway for you? What conclusions can you draw from watching the video? 2-3 sentences – in your own words. HINT: Answer should reflect a deep intellectual thought process. Here is an example of a takeaway from a video about the Amazon tropical rainforest, “Evidence from the video seems to indicate a correlation between increasing environmental degradation in the Amazon basin and the fuel demands of Western countries.”
2 points
...
1. The 3 genes that you will compare at listed below. Take a look.AbbyWhyte974
1. The 3 genes that you will compare at listed below. Take a look. I’ve colored ‘the header region’ of each so that you can distinguish one from the other. DO NOT CHANGE THE FORMAT. DO NOT ADD TEXT OF ANY SORT. WHEN YOU COPY THE GENE DON’T FORGET TO INCLUDE THE ‘HEADER (RED) REGION (starting with “>”). The ‘>’ symbol tells the software the start of the gene. and the red region DESCRIBES THE GENE (SEQUENCE).
2. Using your computer, open the program (used to compare them). The link is http://multalin.toulouse.inra.fr/multalin/ (cut and paste link into your browser)
3. Copy THE FIRST 2 SEQUENCES ONLY (1 and 2) and paste into the “white box-region” just below region marked Sequence-data. Make sure you copy the entire sequence for each gene including the ‘> symbol and red heading’.
4. Click the region below the box marked “Start MultiAlin’. This starts your comparison
5. Examine results. Make note of the colors. If the colors are ‘alike’ that means the sequences are similar. THIS PROGRAM USES COLOR TO DETERMINE HOW SIMILAR 2 SEQUENCES ARE.SAME COLOR MEANS THEY ARE SIMILAR.
6. Use the back-space button and return to the original screen. Delete the sequences in the white box. This allows for a new comparison.
7. Paste sequences 2 and 3 in the box. this allows for comparison of sequences 2 and 3, similar to what was done for 1 and 2.
8. Click the “Start MultiAlin” just like before.
9. Note the color- scheme. Compare what you observed for 1 and 2. Which are more similar 1 and 2, or 2 and 3?
10. For full credit, you should copy results from comparison of 1-2 and separately, 2-3. Doesn’t matter if you don’t have color printer.
11. Or… at the bottom of the image page, there is a command --- “Results as a gif file’. It is located under the region marked, ‘AVAILABLE FILES’… Click on this (Results as a gif file’) and print your results. Staple the first comparison to the second, and turn in. or give as computer file. Which ever are more convenient? Tell me which 2 comparisons (ie, genes) are more alike.
COMPARISON SHOULD LOOK LIKE THIS… (red= exactly alike; blue = different sequence). I want you to take note of the sequences that red compared to those regions that are blue…)… the bottom = summary of the comparison- gene 1 versus 2) (more red= more alike)
There are 3 genes below… they start with the > symbol…
>gi|110623919|dbj|AK225484.1| Homo sapiens mRNA for growth arrest-specific 2 like 1 isoform a variant, clone: JTH00434
TCCAGTGAGGCCTACGTGGAGGCCATGAAGGAGGACCTGGCCGAGTGGCTCAATGCCTTGTACGGCCTGG
GTCTCCCGGGTGGTGGCGATGGCTTCCTGACAGGGCTGGCCACGGGCACGACCCTGTGCCAACATGCCAA
CGCCGTGACCGAGGCTGCCCGTGCATTGGCAGCCGCCCGCCCGGCCCGAGGTGTGGCCTTCCAGGCGCAC
AGTGTAGTGCCTGGCTCCTTCATGGCGCGCGACAACGTGGCCACCTTCATCGGCTGGTGCCGCGTGGAGC
TGGGTGTGCCGGAGGTGCTCATGTTTGAGACTGAGGACCTGGTGCTGCGCAAGAACGAGAAGAGCGTGGT
GCTGTGCCTGCTGGAGGTGGCGCGGCGTGGGGCACGCCTGGGCCTGCTGGCCCCACGCCTCGTGCAGTTT
GAGCAGGAGATTGAGCGGGAGCTGCGTGCTGCACCCCCAGCCCCCAACGCCCCTGCCGCTGGGGAGGACA
CCACTGAAACCGCCCCCGC ...
1. Student and trainer detailsStudent details Full nameStuAbbyWhyte974
1. Student and trainer details
Student details
Full name:
Student ID:
Contact number:
Email address:
Trainer details
Full name:
2. Qualification and unit of competency
Qualification/Course/Program Details
Code:
Name:
Unit of competency
Code:
CPCCCA3014
Name:
Construct and install bulkheads
Releases:
1.0
Release date:
27/Nov/2020
3. Assessment Submission Method
☐ By hand to trainer/assessor ☐ By email to trainer/assessor
☐ Online submission via Learning Management System (LMS)
☐ Any other method _________________________________________________
(Please describe here)
4. Student declaration
· I have read and understood the information in the Unit Requirements prior to commencing this Student Pack
· I certify that the work submitted for this assessment pack is my own. I have clearly referenced any sources used in my submission. I understand that a false declaration is a form of malpractice;
· I have kept a copy of this Student Pack and all relevant notes, attachments, and reference material that I used in the production of this Student Pack;
· For the purposes of assessment, I give the trainer/assessor permission to:
· Reproduce this assessment and provide a copy to another member of staff; and
· Take steps to authenticate the assessment, including communicating a copy of this assessment to a plagiarism checking service (which may retain a copy of the assessment on its database for future plagiarism checking).
Student signature: ________________________________
Date: ____/_____/______________
5. Assessment Plan
The student must be assessed as satisfactory in each of the following assessment methods in order to demonstrate competence in a variety of ways.
Evidence number/ Task number
Assessment method/ Type of evidence/ Task name
Sufficient evidence recorded/Outcome
Assessment task 1
Knowledge Test (KT)
S / NS (First Attempt)
S / NS (Second Attempt)
Assessment task 2
Skill Test (ST)
S / NS (First Attempt)
S / NS (Second Attempt)
Outcome
C ☐ NYC ☐
Date assessed:
Trainer signature:
6. Completion of the Assessment Plan
Your trainer is required to fill out the Assessment Plan Outcome records above, when:
· You have completed and submitted all the requirements for the assessment tasks for this cluster or unit of competency.
· Your work has been reviewed and assessed by your trainer/assessor.
· You have been assessed as either satisfactory or unsatisfactory for each assessment task within the unit of competency.
· You have been provided with relevant and detailed feedback.
Every assessment has a “Feedback to Student” section used to record the following information. Your trainer/assessor must also ensure that all sections are filled in appropriately, such as:
· Result of Assessment (satisfactory or unsatisfactory)
· Student name, signature and date
· Assessor name, signature and date
· Relevant and detailed feedback
7. U ...
1. Student uses MS Excel to calculate income tax expense or refundAbbyWhyte974
1. Student uses MS Excel to calculate income tax expense or refund, taxable income, and total taxes using the full-cost method for transfer pricing. There are no errors.
2. Student uses MS Excel to calculate income tax expense or refund, taxable income, and total taxes using the variable-cost method for transfer pricing. There are no errors.
3. Student produces a thorough and detailed Word document that incorporates specific details from the MS Excel spreadsheet, a detailed recommendation based on those specific details as to how the organization should proceed is included, and the recommendation is justified with at least 3 examples from the week's resources and/or additional research in the Walden Library.
4. Writing exhibits strong evidence of thoughtful critical analysis and thinking; careful examination is made of assumptions and possible biases, with detailed supporting rationale. Writing synthesizes the classroom experiences and content; analyzes patterns or connections between theory and practice; and draws logical conclusions based on well-reasoned arguments. New questions are presented based on synthesis of ideas and input.
5. Writing is clear, logical, well-organized and appropriate. Work is free from spelling and grammar/syntax errors. Tone is professional and free from bias (i.e., sexism, racism). There are no errors.
6. Student effectively and directly integrates discussion/assignment content with relevant and compelling personal experiences, additional research, or current events from credible news sources. Specifically adds a new and/or different insight or perspective on the subject area(s) being discussed or treated in the assignment.
7. Student demonstrates full adherence to scholarly or credible reference requirements and adheres to APA style with respect to source attribution and references. There are no APA errors.
CASE STUDY—BEWARE: One Emergency May Hide Another!
A hospital submitted a report to the State Board of Nursing reporting that an RN had been terminated after the death of a patient following surgery for a tubal pregnancy.
THE NURSE'S STORY—SALLY SIMMS, RN
I had worked the medical-surgical units at the General Hospital ever since graduating from my nursing program 4 years before. This was the worst night, the worst shift, of my nursing career.
I was assigned to care for eight patients that night, which is not an unusual number of patients, but they all were either fresh post-ops or so very sick. Four patients had just had surgery that day. One patient was on a dopamine drip to maintain his blood pressure, so he needed frequent monitoring. One patient was suspected to have meningitis, one patient had pneumonia, and a patient with suspected histoplasmosis completed my assignment.
One of my post-op patients was Betty Smith, a young woman in her early thirties who had laparoscopic surgery late in the day. She had been transferred from the recovery room late in the evening shift and was very uncomfortable when I fi ...
1. Socrates - In your view, what was it about Socrates’ teachings AbbyWhyte974
1. Socrates - In your view, what was it about Socrates’ teachings that made him dangerous in the minds of the members of the ruling class of Athens; and what was it about his teachings that attracted his students to him?
2. Plato - Of his many ideas, which do you think has been his most influential, and why?
3. Aristotle - Share your own views on Aristotle's break with Plato on the question of private property and wealth accumulation. Is Aristotle's argument persuasive and superior? Or was it weak, and even dangerous?
4. Birth of Christianity as a Religion - Imagine the the Council of Nicaea ended with the Gospel of Mary being included in the New Testament. How might Western Civilization have developed differently if this book, and it's suggestion the Jesus’ closest disciple, the one he revered the most, was actually a woman? Do you think we might have inherited a less misogynistic society in which women are treated more as equals?
7. The encomienda system used by the Spaniards to enslave the indigenous peoples of the New World, especially as practiced in Mexico, became controversial in Spain. Describe the encomienda system and the arguments used for and against it.
8. Describe why it is that many historians argue that King Henry VIII of England played a critical role in the rise of capitalism.
9. By the time Adam Smith’s An Inquiry into the Nature and Causes of the Wealth of Nations was published in 1776, Europe had undergone a dramatic transformation from a feudal, largely agrarian society to an increasingly market-based commercial society. Discuss some of the more significant, transformative societal developments, and their implications, from 1492 to 1776.
10. Much has been written about the so-called “Adam Smith Problem;” the apparent dichotomy between his Theory of Moral Sentiments and An Inquiry into the Nature and Causes of the Wealth of Nations. Discuss whether these two works are reconcilable with one another. Do they reflect two very different imaginations of humans? Do they suggest that the author changed his mind after writing the first book? Might they represent a more complex and unifiable imagination of who we are or can be?
11. The garment industry is the second-most polluting in the world. A significant amount of this pollution is from “fast fashion” “disposable” clothing; a business model that relies on people, including children, making clothes under conditions that we would consider intolerable. Psychologists and marketers alike agree that our buying and consumption is largely driven by psychological impulses of which we may not be fully conscious. Indeed, as experts posit in the film The True Cost, consuming more can have a negative effect on our psyche. What social, ethical, economic and/or philosophical issues are raised by The True Cost documentary? Why do we tolerate such a system?
12. Many people agree with Immanuel Kant's argument that we should never treat other people as means to an end; we should treat each pers ...
1. Select a patient” (friend or family member) on whom to performAbbyWhyte974
1. Select a “patient” (friend or family member) on whom to perform a complete H&P.
2. NOTE: DO NOT USE REAL NAMES OR INITIALS OR OTHERWISE IDENTIFY YOUR “PATIENT.” FAILURE TO MAINTAIN PRIVACY WILL RESULT IN A FAILING SCORE.
3. Using the format specified below, write a 2 page SOAP note on your “patient.” The HPI should be presented in a paragraph, and the rest of the data including the ROS should be presented in a list format.
4. Collect only the information that is pertinent to the chief complaint of the patient to include in your SOAP note. Aim for a single page using normal margins and format.
5. The SOAP Note must contain all required elements as outlined in the rubric below.
6. You must self-score your SOAP note using the rubric and attach it to the assignment.
Criteria Ratings Points
Thread
Content
50 to >46.0 pts
Advanced
47 to 50 points All key
components of the
Discussion Board Forum
prompt are answered in
the thread. Major points
are supported by all of the
following: *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the
required 7 or more from
personal research, the
course readings, and the
integration of 1 biblical
principle.
46 to >43.0 pts
Proficient
44 to 46 points Some key
components of the
Discussion Board Forum
prompt are answered in the
thread. Major points are
supported by some of the
following): *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the required
7 or more from personal
research, the course
readings, and the
integration of 1 biblical
principle.
43 to >0.0 pts
Developing
Minimal key components of
the Discussion Board
Forum prompt are
answered in the thread.
Major points are supported
by some or none of the
following: *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the required
7 or more from personal
research, the course
readings, and the
integration of 1 biblical
principle
0 pts
Not
Present
50 pts
Replies
Content
41 to >39.0 pts
Advanced
Contribution made to
discussion with each reply
expounding on the thread.
Major points are supported
by all of the following:
*Reading & Study
materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Three
peer-reviewed source
citations in current APA
format, and the integration
of 1 biblical principle.
39 to >35.0 pts
Proficient
Marginal contribution made
to discussion with each
reply slightly exp ...
1. Review the HCAPHS survey document, by clicking on the hyperlinkAbbyWhyte974
1. Review the HCAPHS survey document, by clicking on the hyperlink.
2. Choose one of the questions on the survey and research an intervention to improve patient satisfaction on that question.
3. Drop a pdf of the article for your solution
4. Review the rubric to make sure you include all required information in your video assignment.
5. Create a video to present a systems-based solution, according to the research. (Do NOT include "increased staffing" as your solution.)
March 2017 1
HCAHPS Survey
SURVEY INSTRUCTIONS
You should only fill out this survey if you were the patient during the hospital stay
named in the cover letter. Do not fill out this survey if you were not the patient.
Answer all the questions by checking the box to the left of your answer.
You are sometimes told to skip over some questions in this survey. When this happens
you will see an arrow with a note that tells you what question to answer next, like this:
Yes
No If No, Go to Question 1
You may notice a number on the survey. This number is used to let us know if
you returned your survey so we don't have to send you reminders.
Please note: Questions 1-25 in this survey are part of a national initiative to measure the quality
of care in hospitals. OMB #0938-0981
Please answer the questions in this survey
about your stay at the hospital named on
the cover letter. Do not include any other
hospital stays in your answers.
YOUR CARE FROM NURSES
1. During this hospital stay, how often
did nurses treat you with courtesy
and respect?
1
Never
2
Sometimes
3
Usually
4
Always
2. During this hospital stay, how often
did nurses listen carefully to you?
1
Never
2
Sometimes
3
Usually
4
Always
3. During this hospital stay, how often
did nurses explain things in a way
you could understand?
1
Never
2
Sometimes
3
Usually
4
Always
4. During this hospital stay, after you
pressed the call button, how often did
you get help as soon as you wanted
it?
1
Never
2
Sometimes
3
Usually
4
Always
9
I never pressed the call button
2 March 2017
YOUR CARE FROM DOCTORS
5. During this hospital stay, how often
did doctors treat you with courtesy
and respect?
1
Never
2
Sometimes
3
Usually
4
Always
6. During this hospital stay, how often
did doctors listen carefully to you?
1
Never
2
Sometimes
3
Usually
4
Always
7. During this hospital stay, how often
did doctors explain things in a way
you could understand?
1
Never
2
Sometimes
3
Usually
4
Always
THE HOSPITAL ENVIRONMENT
8. During this hospital stay, how often
were your room and bathroom kept
clean?
1
Never
2
Sometimes
3
Usually
4
Always
9. During this hospital stay, how often
was the area around your room quiet
at night?
1
Never
2
Sometimes
3
Usually
4
Always
YOUR EXPERIENCES ...
1. Saint Leo Portal loginUser ID[email protected] AbbyWhyte974
1. Saint Leo Portal login
User ID:[email protected]
Saintleo\martha.ramsey
Password: Demonte5!!!
2. New Login for email through Okta
User ID: Martha.ramsey
Password: Demonte5!!!
3. What did you earn your first medal or award for?
Art class
4. Lion Share Courses
5. Research Method I
...
1. Reference is ch. 5 in the e-text, or ch. 2 in paper text...pleaAbbyWhyte974
1. Reference is ch. 5 in the e-text, or ch. 2 in paper text...please match the terms regarding political parties
polling data is based on this aspect of Parties
Rep. Senfronia Thompson filed for the role of Speaker of Texas House
In 2020, party delegates and executive committees voted to nominate presidential candidates via Zoom
a sector of a political party (ex. Trump Republican, conservative Democrat) is called
2. Which candidate’s office is chosen/nominated by delegate convention?
sheriff of Medina County
U.S. congressman from the 4th Texas congressional district
president of the United States
governor of Texas
3. Which statement best depicts the effect of redistricting on representative democracy?
Legislators represent the same number of Republicans and Democratic voters
representation is mostly based on geographic cohesion
representation is mostly based on the voting patterns of Texas residents
gerrymandering is a legitimate method of forming districts
4. The difference between absentee ballot and mail-in ballot is?
absentee is for people residing outside of their state
mail-in ballots are issued to people who can't go to polls
in some states there is no difference, as all ballots are mailed in
in Texas mail-in ballots require doctors note
5 Unlike the US, most democratic governments have _______ political systems with _______.
2-party//direct representation
Multi-party//proportional
2-party//direct representation
multi-party//proportional representation
independent party//single-member districts
2-party//single-member districts
[ Choose ]
[ Choose ]
[ Choose ]
Car LoanNew Car LoanLoan InputsSticker price$ 24,595Trade in$ 3,500Cash back offer$ - 0Loan amount$ 21,095Loan term (months)24Loan interest (APR)1.90%Loan payment$ 896.46Total cost of the car$ 21,515.04
My Car Data
MPG DataAll ModelsModelDisplCylTransDriveFuelCert RegionStndStnd DescriptionUnderhood IDVeh ClassAir Pollution ScoreCity MPGHwy MPGCmb MPGGreenhouse Gas ScoreSmartWayComb CO2ACURA ILX2.44AMS-82WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV02.4SH3small car62535297Yes309ACURA ILX2.44AMS-82WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV02.4SH3small car62535297Yes309ACURA MDX3.56SemiAuto-92WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61927225No404ACURA MDX3.56SemiAuto-92WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV62027235No391ACURA MDX3.56SemiAuto-92WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV61927225No404ACURA MDX3.56SemiAuto-92WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV62027235No391ACURA MDX3.56SemiAuto-94WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61826214No424ACURA MDX3.56SemiAuto-94WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61926225No404ACURA MDX3.56SemiAuto-94WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV61826214No424ACURA MDX ...
বাংলাদেশের অর্থনৈতিক সমীক্ষা ২০২৪ [Bangladesh Economic Review 2024 Bangla.pdf] কম্পিউটার , ট্যাব ও স্মার্ট ফোন ভার্সন সহ সম্পূর্ণ বাংলা ই-বুক বা pdf বই " সুচিপত্র ...বুকমার্ক মেনু 🔖 ও হাইপার লিংক মেনু 📝👆 যুক্ত ..
আমাদের সবার জন্য খুব খুব গুরুত্বপূর্ণ একটি বই ..বিসিএস, ব্যাংক, ইউনিভার্সিটি ভর্তি ও যে কোন প্রতিযোগিতা মূলক পরীক্ষার জন্য এর খুব ইম্পরট্যান্ট একটি বিষয় ...তাছাড়া বাংলাদেশের সাম্প্রতিক যে কোন ডাটা বা তথ্য এই বইতে পাবেন ...
তাই একজন নাগরিক হিসাবে এই তথ্য গুলো আপনার জানা প্রয়োজন ...।
বিসিএস ও ব্যাংক এর লিখিত পরীক্ষা ...+এছাড়া মাধ্যমিক ও উচ্চমাধ্যমিকের স্টুডেন্টদের জন্য অনেক কাজে আসবে ...
Leveraging Generative AI to Drive Nonprofit InnovationTechSoup
In this webinar, participants learned how to utilize Generative AI to streamline operations and elevate member engagement. Amazon Web Service experts provided a customer specific use cases and dived into low/no-code tools that are quick and easy to deploy through Amazon Web Service (AWS.)
Communicating effectively and consistently with students can help them feel at ease during their learning experience and provide the instructor with a communication trail to track the course's progress. This workshop will take you through constructing an engaging course container to facilitate effective communication.
This document provides an overview of wound healing, its functions, stages, mechanisms, factors affecting it, and complications.
A wound is a break in the integrity of the skin or tissues, which may be associated with disruption of the structure and function.
Healing is the body’s response to injury in an attempt to restore normal structure and functions.
Healing can occur in two ways: Regeneration and Repair
There are 4 phases of wound healing: hemostasis, inflammation, proliferation, and remodeling. This document also describes the mechanism of wound healing. Factors that affect healing include infection, uncontrolled diabetes, poor nutrition, age, anemia, the presence of foreign bodies, etc.
Complications of wound healing like infection, hyperpigmentation of scar, contractures, and keloid formation.
Beyond Degrees - Empowering the Workforce in the Context of Skills-First.pptxEduSkills OECD
Iván Bornacelly, Policy Analyst at the OECD Centre for Skills, OECD, presents at the webinar 'Tackling job market gaps with a skills-first approach' on 12 June 2024
it describes the bony anatomy including the femoral head , acetabulum, labrum . also discusses the capsule , ligaments . muscle that act on the hip joint and the range of motion are outlined. factors affecting hip joint stability and weight transmission through the joint are summarized.
Chapter wise All Notes of First year Basic Civil Engineering.pptxDenish Jangid
Chapter wise All Notes of First year Basic Civil Engineering
Syllabus
Chapter-1
Introduction to objective, scope and outcome the subject
Chapter 2
Introduction: Scope and Specialization of Civil Engineering, Role of civil Engineer in Society, Impact of infrastructural development on economy of country.
Chapter 3
Surveying: Object Principles & Types of Surveying; Site Plans, Plans & Maps; Scales & Unit of different Measurements.
Linear Measurements: Instruments used. Linear Measurement by Tape, Ranging out Survey Lines and overcoming Obstructions; Measurements on sloping ground; Tape corrections, conventional symbols. Angular Measurements: Instruments used; Introduction to Compass Surveying, Bearings and Longitude & Latitude of a Line, Introduction to total station.
Levelling: Instrument used Object of levelling, Methods of levelling in brief, and Contour maps.
Chapter 4
Buildings: Selection of site for Buildings, Layout of Building Plan, Types of buildings, Plinth area, carpet area, floor space index, Introduction to building byelaws, concept of sun light & ventilation. Components of Buildings & their functions, Basic concept of R.C.C., Introduction to types of foundation
Chapter 5
Transportation: Introduction to Transportation Engineering; Traffic and Road Safety: Types and Characteristics of Various Modes of Transportation; Various Road Traffic Signs, Causes of Accidents and Road Safety Measures.
Chapter 6
Environmental Engineering: Environmental Pollution, Environmental Acts and Regulations, Functional Concepts of Ecology, Basics of Species, Biodiversity, Ecosystem, Hydrological Cycle; Chemical Cycles: Carbon, Nitrogen & Phosphorus; Energy Flow in Ecosystems.
Water Pollution: Water Quality standards, Introduction to Treatment & Disposal of Waste Water. Reuse and Saving of Water, Rain Water Harvesting. Solid Waste Management: Classification of Solid Waste, Collection, Transportation and Disposal of Solid. Recycling of Solid Waste: Energy Recovery, Sanitary Landfill, On-Site Sanitation. Air & Noise Pollution: Primary and Secondary air pollutants, Harmful effects of Air Pollution, Control of Air Pollution. . Noise Pollution Harmful Effects of noise pollution, control of noise pollution, Global warming & Climate Change, Ozone depletion, Greenhouse effect
Text Books:
1. Palancharmy, Basic Civil Engineering, McGraw Hill publishers.
2. Satheesh Gopi, Basic Civil Engineering, Pearson Publishers.
3. Ketki Rangwala Dalal, Essentials of Civil Engineering, Charotar Publishing House.
4. BCP, Surveying volume 1
How to Setup Warehouse & Location in Odoo 17 InventoryCeline George
In this slide, we'll explore how to set up warehouses and locations in Odoo 17 Inventory. This will help us manage our stock effectively, track inventory levels, and streamline warehouse operations.
ISO/IEC 27001, ISO/IEC 42001, and GDPR: Best Practices for Implementation and...PECB
Denis is a dynamic and results-driven Chief Information Officer (CIO) with a distinguished career spanning information systems analysis and technical project management. With a proven track record of spearheading the design and delivery of cutting-edge Information Management solutions, he has consistently elevated business operations, streamlined reporting functions, and maximized process efficiency.
Certified as an ISO/IEC 27001: Information Security Management Systems (ISMS) Lead Implementer, Data Protection Officer, and Cyber Risks Analyst, Denis brings a heightened focus on data security, privacy, and cyber resilience to every endeavor.
His expertise extends across a diverse spectrum of reporting, database, and web development applications, underpinned by an exceptional grasp of data storage and virtualization technologies. His proficiency in application testing, database administration, and data cleansing ensures seamless execution of complex projects.
What sets Denis apart is his comprehensive understanding of Business and Systems Analysis technologies, honed through involvement in all phases of the Software Development Lifecycle (SDLC). From meticulous requirements gathering to precise analysis, innovative design, rigorous development, thorough testing, and successful implementation, he has consistently delivered exceptional results.
Throughout his career, he has taken on multifaceted roles, from leading technical project management teams to owning solutions that drive operational excellence. His conscientious and proactive approach is unwavering, whether he is working independently or collaboratively within a team. His ability to connect with colleagues on a personal level underscores his commitment to fostering a harmonious and productive workplace environment.
Date: May 29, 2024
Tags: Information Security, ISO/IEC 27001, ISO/IEC 42001, Artificial Intelligence, GDPR
-------------------------------------------------------------------------------
Find out more about ISO training and certification services
Training: ISO/IEC 27001 Information Security Management System - EN | PECB
ISO/IEC 42001 Artificial Intelligence Management System - EN | PECB
General Data Protection Regulation (GDPR) - Training Courses - EN | PECB
Webinars: https://pecb.com/webinars
Article: https://pecb.com/article
-------------------------------------------------------------------------------
For more information about PECB:
Website: https://pecb.com/
LinkedIn: https://www.linkedin.com/company/pecb/
Facebook: https://www.facebook.com/PECBInternational/
Slideshare: http://www.slideshare.net/PECBCERTIFICATION
Main Java[All of the Base Concepts}.docxadhitya5119
This is part 1 of my Java Learning Journey. This Contains Custom methods, classes, constructors, packages, multithreading , try- catch block, finally block and more.
spot a liar (Haiqa 146).pptx Technical writhing and presentation skills
1. Looking at Shellers argument, how do you think early represent
1. 1. Looking at Sheller's argument, how do you think early
representations of the Caribbean might have contributed to the
justification for European invasion of the region.
2. What was the image of the Caribbean that was dominant in
the 18th century and what impact did it have on imperialism?
3. What does Sheller mean when she says, "the Tourist gaze
imbues tropical with moral meanings."?
4. How were White Caribbean people (Creoles in this text)
defined by the dominant representations of the Caribbean?
Just so you know (this is not part of the question, this is just
information because the world will pop up from time to time)
the word 'creole' is a complex word of shifting meanings
depending on location. It originated in linguistics and was used
to describe languages that mixed different elements. It is used
to identify different groups of people in different Caribbean
territories. For example, in Trinidad and Guyana Creole is
often used to mean the African descended people of those two
countries, In other territories in the Caribbean Creole means
the white Caribbean people. In other places it means people who
have multiple heritages. Beyoncé, and many people in New
Orleans use creole in this same multiracial way.
https://www.youtube.com/watch?v=yqvPTd M3-3Y
https://www.youtube.com/watch?v=OI2jn3lJTAE
5. How did 19th century representations of the Caribbean differ
from 18th century representations?
6 If Sheller's argument is correct, how might representations
2. of the Caribbean shape interactions between tourist and locals.?
developing Leadership and Management(6HR510)SPRING 2021
Module Leader: Anne Wylie
For Derby Business School BA Business Management (and
bracketed pathways)
Contents
Staff contacts 4
Welcome 5
Module Specification and Description 6
Schedule of delivery 8
Recommended Reading 10
Student Voice 11
Your Voice 11
You Said It. We Did It 11
Module Evaluation 11
Module Assessment Description 12
Assessment Schedule 13
Formative Feedback 13
Assessment 13
Summative feedback, grades and return of work 13
Electronic Submission 14
Anonymous Marking 14
Progression: 14
Plagiarism and Academic Offences 14
Plagiarism 15
Collusion: 15
Impersonation: 15
3. Any other form of deception: 15
PLATO: 15
Referencing 15
Student Responsibilities 15
Preparation 15
Punctuality 16
Attendance and Engagement 16
Absence 16
If you have a problem 17
Technical Issue approaching the deadline time 17
Extenuating Circumstances 18
What are Exceptional Extenuating Circumstances (EEC)? 18
Completing an EEC Request 18
Late Submission Requests 19
Referrals 19
Assessment Criteria 20
External Examiners 20
Diversity Statement 20
Appendix A: Assessment Rubric 21
Appendix B: Undergraduate Marking Scale 24
Appendix C: Submission check list 25
Welcome
Dear Student,
Welcome to the Developing Leadership and Management
module.
This module is about the concepts of Leadership and
Management. It explores the similarities and differences in the
roles and responsibilities of leaders and managers in the
workplace and the development of leadership theoretical
approaches as well as the practical application of these within
organisations. During this module you will analyse the skills
and competencies of effective organisational leaders and
4. examine alternative methods of leadership development to
enhance these.
In this module you will cover a wide range of leadership and
management concepts and ideas. Please come to these sessions
with an open mind, be prepared to challenge conventional
thinking, and be ready to enjoy a journey that will stretch and
challenge you.
Anne Wylie
Module leader
Module Specification and Description
Module Title
Developing Leadership and Management
Date of ApprovalMay-17
Module Code
6HR510
Module Level
6
Credit value
20
Module Delivery
Mode
Online/Distance ☐
Blended/Face to Face
Work-Based Learning ☐
Module Description
5. This module is about the concepts of Leadership and
Management. It explores the similarities and differences in the
roles and responsibilities of leaders and managers in the
workplace and the development of leadership theoretical
approaches as well as the practical application of these within
organisations. Students will analyse the skills and competencies
of effective organisational leaders and examine alternative
methods of leadership development to enhance these.
Module Learning Outcomes
On successful completion of this module students will be able
to:
1. Critically evaluate the definition, roles and responsibilities of
Leadership and Management in modern contexts
2. Assess alternative theoretical approaches to leadership and
management and their relevance within contemporary
organisations.
3. Discuss different methods of leadership and management
development and how to implement and evaluate interventions
effectively
Module Content
· Definitions of Leadership and Management*
· Similarities and Differences between Leadership and
Management*
· The balance between Leadership and Management in a
contemporary context*
· Contemporary requirements of Management and Leadership
· Key theoretical approaches through time and critical
evaluation of these theories.*
· Leadership and vison*
6. · Practical skills required for Management and Leadership in
contemporary settings*
· Modern considerations for ethical and cultural issues*
· Approaches to Management and Leadership development
· Design, implementation and evaluation of effective
development programmes
· This module is mapped against CMI module 5012, Being a
Leader and 5013, and Leadership practice. The starred (*)
elements are key to this.
· This module has been mapped against the CIPD module 5LMS,
Developing Leadership and Management Skills.
Module Learning and Teaching
Scheduled Learning and Teaching Activities
25%
Guided Independent Study
75%
Placement Learning
0%
Module Assessment
7. Component 1: COURSEWORK
Summary of Assessment Methods
Assignment Weighting 100%
3,500 word Management Report based on a case study within a
modern organisation critically evaluating which leadership
theories would be most relevant for the organisation, and the
design, implementation and evaluation of appropriate leadership
development interventions
Reading List
Core Text
Yukl, G.E. (2012) Leadership in Organizations: Global Edition,
8th Edition. Harlow, Pearson Education Ltd.
Additional Recommended Reading Sources
Carmichael, J., Collins, C., Emsell, P., Haydon, J (2011)
Leadership and Management Development. Oxford, Oxford
University Press.
CIPD (2011) UK highlights: global leadership forecast 2011.
London, CIPD.
Daft, R.L. (2014) The Leadership Experience. Stamford,
Cengage Learning.
Gill, R. (2011) Theory and Practice of Leadership, 2nd Edition.
London, Sage.
Gold, J., Thorpe, R., Mumford, A. (2010) Leadership and
Management Development. London, CIPD.
Northouse (2015) Leadership: Theory and Practice, 7th Edition.
London, Sage.
Schedlitzki, D., Edwards, G. (2014) Studying Leadership:
Traditional and Critical Approaches. London, Sage.
Western S (2013) Leadership a critical text, 2nd Edition.
London, Sage.
8. This module is delivered at the University of Derby, London
College, Boston College, Med College (Athens, Thessaloniki),
EU Business School (Barcelona, Munich & Geneva) and HELP.
Delivery at the University of Derby is via synchronised remote
live lectures and face-to-face seminars. There will also be
asynchronised activities for you to complete during your study
time. Delivery at the University of Derby is in English.
Schedule of delivery
Week
Lecture Outline
Seminar Outline
1
What is Leadership?
Early perceptions of leadership:
· Great Man Theory born, or made? Trait theory
· Situation and contingency theory
· Defining and distinguishing leadership and management and
evaluation of the similarities and differences between leadership
and management
· Critical perspectives on early theories of leadership
2
Seasoned Styles of Leadership and Management:
· Transformational and transactional
· Servant leadership
· Critical comparison of contemporary theories of leadership
9. and management
· Identifying and analysing leadership styles
3
Recent Styles of Leadership:
· Importance of emotional intelligence in leadership
· Authentic
· Empathetic
· Resonant
· Awakened and agile
· Relationship between leaders and followers, including:
follower choice, attracting and retaining followers, and
exploring notions of leader and follower power
4
Assignment Launch
· Approaches to case study analysis
· Critical writing using an appropriate professional and
academic tone
· Consolidation of learner so far and how this relates to task 1
of the assignment
5
Exploration and evaluation of the role of the modern leader:
· Creating vison
· Shaping culture
10. · Driving change
· Empowering high performance teams
· Embodying ethics
· Others
Leadership conundrums, case study exercises:
· Series of leadership case studies to highlight the different
roles of a leader
· Linking of the modern leadership conundrums to the
definitions of leadership and management and contemporary
theory of leadership styles
6
Evaluation of Leaders of today
Seminar will consolidate learning to date and consider the
implications for contemporary workplaces.
Time will be dedicated to developing a structure for the first
part of the assignment and reviewing proposed structures.
7
Practical skills required for Leadership and Management in
contemporary settings:
11. · Distinguishing between competency and skill
· Exploration of contemporary skills and competencies for
effective leadership
· Critical evaluation of the skills and competencies which make
a ‘modern’ leader and manager
8
Approaches to Leadership and Management development (1)
· Practical activity session to evaluate leadership and
management development tools and methods
9
Approaches to Leadership and Management development (2)
· Practical activity session to evaluate methods of measuring
development interventions and methods
Assignment / Writing workshop and support. Time will be
dedicated to developing a structure for the latter part of the
assignment and reviewing proposed structures / ideas for the
first part
10
Unlocking your leadership potential (1):
· Revisit Goleman: understanding self and others
· Learning through experience – the path to successful
12. leadership
· The importance of reflective practice – Kolb and Gibbs
· Understanding and evaluating your own leadership qualities –
practical activities to find the leader within you.
11
Unlocking your leadership potential (2):
· Your professional and personal development plan
· Your personal leadership brand/s
· Strategy ‘you’
· Activities to further develop individual leadership qualities
potential
· Developing ‘Strategy You!’
· Resilience building exercise
12
Assignment support
13
Assignment support
Assignment Submission
23.59 10th May via Turnitin
Recommended Reading
(Updated to reflect latest editions and availability in Kedleston
Road Library)
13. Core Text
Yukl, G.E. (2019) Leadership in Organizations: Global Edition,
9th edn. Harlow, Pearson Education Ltd. (available as an ebook
in the library)
Additional Recommended Reading Sources
Carmichael, J., Collins, C., Emsell, P., Haydon, J (2011)
Leadership and Management Development. Oxford, Oxford
University Press. (physical copy)
Daft, R.L. (2015) The Leadership Experience, 6th edn.
Stamford, Cengage Learning (available as an ebook in the
library)
Gill, R. (2011) Theory and Practice of Leadership, 2nd edn.
London, Sage. (physical copy)
Gold, J., Thorpe, R., Mumford, A. (2010) Leadership and
Management Development. London, CIPD. (physical copy)
Northouse (2016) Leadership: Theory and Practice, 7th edn.
London, Sage. (physical copy)
Schedlitzki, D., Edwards, G. (2018) Studying Leadership:
Traditional and Critical Approaches, 2nd edn. London, Sage.
(physical copy)
Western S (2019) Leadership a critical text, 3rd edn. London,
Sage. (physical copy)
Other Useful texts
Parry, K. and Jackson, B. (2011) A very short, fairly interesting
and reasonably cheap book about studying leadership. 2nd edn.
London: Sage. (ebook 2008 version)
Whetten, D.A. and Cameron, K.S. (2016). Developing
Management Skills. 9th edn. New Jersey: Pearson Education.
(available as an ebook in the library)
14. Journals:
Academy of Management Journal
Administrative Science Quarterly
British Journal of Management
Harvard Business Review
Journal of Management Studies
Journal of Management Academy
Management Review
Leadership Quarterly
Websites:
Chartered institute of Personnel and Development
www.cipd.co.uk
Chartered Management Institute www.managers.org.uk
Institute of Leadership and Management www.i-l-m.comStudent
VoiceYour Voice
We welcome your feedback on all aspects of the programme that
you are studying on. A key opportunity to voice your ideas and
experiences and contribute to programme development is via
your student representatives in Programme Committees. The
Programme Committee involves staff, students and key
stakeholders from the subject area who help make
decisions about the operation of the programme. The
Programme Committee are scheduled to occur a minimum of
three times a year. If your student representative is unable to
attend the Committee, they can send in a report and have
discussions with the Programme Leader. The Programme Leader
will write a Programme Evaluation Report (PER) which
amongst other things is based on your feedback; this report is
considered and approved by the Programme Committee before
the final version is submitted to the University Centre for
Quality Assurance and reviewed by the College’s Quality and
15. Enhancement Committee.
We really welcome your feedback and ask that you pass this on
to your student representatives or the Chair of the Programme
Committee directly. We also encourage you take part in
this committee by becoming a Student Representative for your
year. If you decide to become a representative, you will receive
formal training by the Union of Students.
You are also encouraged to communicate with your module
leaders / programme leaders as appropriate with regard to your
ideas and experiences of the programme.
You Said It. We Did It
Throughout the year we will ask you to tell us all about your
experience here at the University of Derby. Your opinions
are really important to us, and we are constantly making
changes as a result of your feedback to improve your
experience.
Make sure to keep an eye out for a chance to have your say in
the next Feedback and Survey campaigns, which will be running
throughout your time at the University of Derby. Module
Evaluation
During your module, you will be asked to complete 2 formal
surveys.
The first is a Mid-Module Evaluation, which helps us to
understand how we might improve the delivery of this module
for you.
The second is a Module Evaluation Questionnaire (MEQ), which
is a formal requirement and serves as an indication of your
satisfaction. This is conducted via EvaSys (online survey
automation software) and you will receive an invitation to
participate via email. You can access the MEQ via the link to
16. ‘My Surveys’ from the Module Homepage. The results from the
MEQ will be used to Quality Assure your course and play an
important part in continual improvement of our provision.
Both surveys are important, and we strongly encourage you to
engage with them.
Module Assessment Description
All assessments will be marked using your student number,
following the Anonymous Marking Policy. This will ensure that
even if the work can be recognised by the initial marker, the
anonymity of the student is preserved during second
marking/internal moderation and external validation.
Module Assessment
COURSEWORK
Component 1: COURSEWORK
Summary of Assessment Methods
Assignment Weighting 100%
Assignment Instructions:
You are required to write and submit a 3,300 - 3,700 words
report demonstrating your understanding of contemporary
leadership and management. The report is divided into two
sections, which reflect the learning outcomes of the module,
each section is detailed below:
Section 1:
Critically evaluate the contemporary definitions of leadership
and management examining current perspectives of the roles
and responsibilities of both leaders and managers generally.
(LO1, LO2)
17. Section 2:
Based on your evaluation in section one, propose a minimum of
three critical skills and behaviours required to be a successful
21st century leader. Consider specific methods of leadership
and management development that could develop these critical
skills and recommend how to implement and evaluate these
development interventions effectively. (LO3)
(You may present your recommended interventions and
respective evaluations in a table format for section 2).
Assignment Submission and Grading Criteria
All assignments should be submitted via the Turnitin
submission point (found within the ‘Assessment’ tab) by
23.59pm 10th May 2021. All assignments will be marked
against a marking rubric, a copy of which is attached to
Appendix A.
On successful submission of the assignment, you will be
demonstrating your individual achievement of the Module
Learning Outcomes:
1. Critically evaluate the definition, roles and responsibilities of
Leadership and Management in modern contexts.
2. Assess alternative theoretical approaches to leadership and
management and their relevance within contemporary
organisations.
3. Discuss different methods of leadership and management
development and how to implement and evaluate interventions
effectively.
Assessment Schedule
· Assessment hand in - deadline Monday 10th May, by 11.59pm
via Turnitin. *Return date with provisional grade 12:00 noon
31st May 2021.
18. *Please note, return dates are estimates and are subject to the
satisfactory completion of all marking and moderation
activities. You should watch blackboard for announcements
relating to any changes to these advertised dates.
Formative Feedback
Three opportunities are provided in weeks 6, 9 and 12 for
formative feedback. Your seminar tutor will assist you to
explore how the module themes can be linked to your assessed
work. Time will be allocated during class time and the
opportunity provided to receive tutor feedback during the
sessions.
Assessment
Work will be assessed using the Assessment Rubric (Appendix
A) and the Undergraduate marking scale (Appendix B).
Summative feedback, grades and return of work
Tutors will aim to return grades and feedback within 3 weeks of
submission. This may take longer at the end of the academic
year when grades need to be released through the examinations
board and sent to external examiners for approval.
Feedback as well as a grade is provided with the return of
assignments. You should carefully read this. If you have further
questions you should contact the marking tutor.
Assignment feedback on this module will be returned via the
digital marking system. The module tutor will notify you by
email when feedback is available.
It is important to recognise that you will receive feedback in a
number of ways during the module.
Whilst it is most apparent when your work is marked and
returned to you, you may also receive feedback in one or more
of the following ways:
19. · Through in class discussions about assignments
· Through one-to-one tutorials
· Through email correspondence with your tutor
In all instances, it is important that you pay close attention to
what you are being told and look for any patterns that might be
emerging in relation to your strengths and
weaknesses.Electronic Submission
In order to reduce unnecessary travel and queuing time for
students, the University uses a system of electronic submission
(eSubmission) of all assignments where this is possible. Both
assignments on this module are submitted in this way, unless
you are advised by your tutor differently.
Start by taking a look at the eSub website as this is the main
site supporting students with eSubmission and provides support
documents and videos to talk you through the whole process.
You can find a link to this through the ‘Guides’ tab on UDo.
You will also find a printable guide In the Assessments area of
your module called Electronic Submission Guide for Students
this will talk you through the submission process and guide you
to further resources to help you submit your work.
Remember: All coursework should be submitted on time. There
are no opportunities to submit work as late. Even if you submit
an EEC request you should submit the coursework you have
already completed to that date by the deadline. The only
exception is if a student has a support plan and agreed extra
time to complete work.
Anonymous Marking
The University of Derby is committed to ensuring a fair and
equitable process in marking and grading student assessments.
To that end, all assessed work for this module will be submitted
anonymously.
The policy guidance indicates that ‘Anonymity’ is the use of an
20. identifier, which cannot be related to the student’s name
without reference to central student records or other mechanism,
in the assessment process. As a consequence, all summative
assessment where practicable should be marked via student
number and not according to student name.
Point 7 of the Anonymous Marking Policy states that “it is the
responsibility of students to respect and enable anonymity in the
assessment process where anonymous marking applies, and to
actively engage in the preservation of the anonymity
mechanisms provided to them”.
N.B. A copy of the policy is available to view on UDo under
MODULE INFO
Progression:
Students are required to attempt all assessment components of
their modules.
Students with a Non-Submission (NS) on first submission, who
have not attempted the referral offer must return on a part-time
recovery basis for the whole of the next academic year.
Plagiarism and Academic Offences
An academic offence could include plagiarism or improper
conduct in exams.
The University has a public duty to ensure that the highest
standards are maintained in the conduct of assessment. It is,
therefore absolutely essential that all students learn how to
avoid committing an academic offence. Academic offences
apply to coursework and examinations. Committing an academic
offence is regarded very seriously.
Plagiarism: A student is liable to be found guilty of plagiar ism
if any work presented for individual assessment is found to
contain the unacknowledged work of some other person(s). If
this involves deliberate misrepresentation of material as the
student’s own in an attempt to deceive the examiners then the
offence is very grave indeed.
21. All sources should be cited and all quotations from the works of
other authors clearly identified as such.
If a student’s work is found to contain verbatim (or near
verbatim) quotations from the work of other authors (including
other students past or present) without clear acknowledgement,
then plagiarism has been committed whether or not the student
intended to deceive the examiners.
Collusion: Where there is a requirement for the submitted work
to be solely that of an individual student, collaboration is not
permitted. Students who improperly work together in these
circumstances are guilty of collusion.
Impersonation: A student who is substituted by another person
in an examination, or who submits by substitution the work of
another person as their own, is guilty of deception by
impersonation. The offence of impersonation can be applied to
the student and to the accomplice.
Any other form of deception: Any action through which
students seek to gain an unfair advantage in assessment
constitutes an academic offence, such as, for instance,
submitting the same piece of work for separate modules.
Please see the 3Rs document for further explanation of
academic offences. http://www.derby.ac.uk/cfq/quality-
enhancement/academic-regulations-3rs
PLATO: PLATO is an online resource that gives you
information, exercises and quizzes to help you avoid plagiarism
which can be accessed through UDo. If you're found to have
committed an academic offence, the Union of Students’
independent advice service is on hand to help you through the
whole process, and give you independent advice and
22. representation. You are strongly recommended to make use of
the PLATO online materials designed to help you understand
and avoid plagiarism. PLATO can be accessed via UDo. Log in
to UDo and access the “Guides” section. Links to PLATO can
be found in the user guides.
Referencing
When you are writing your assignments, it is important that you
reference all your sources of information correctly to avoid
plagiarism and conform to good academic practice. Make sure
you understand the referencing guidelines for your subject.
Referencing guides are available from the library and from
various online sources. Academic referencing can, to the
inexperienced, appear complex and confusing but if you are
stuck, don’t be afraid to ask your tutor!
Useful written guidelines on referencing can also be found in
the appendixes of Saunders M, Lewis P, Thornhill (2016)
Research Methods for Business Students, 7th Edition, Harlow,
Pearson Education Ltd. (and other editions of this text). For a
more comprehensive text on referencing you could also try
Pears R, Shields G (2019) Cite them right, the essential
referencing guide, 11th Edition Basingstoke, Palgrave
MacMillan (earlier editions are available as an E-book from the
library catalogue).Student ResponsibilitiesPreparation
During this module, you will undertake a mixture of
information, exploration, and application sessions. Information
sessions take the form of a more traditional lecture. The tutor
will do most of the talking here. Lectures are live and will be
delivered remotely according to your scheduled timetable.
However, in the seminar sessions you will take the lead, often
working in small groups on activities to help you deepen your
understanding of the subject area and how this can be applied in
the workplace. You must prepare for these sessions by checking
blackboard for all relevant materials and undertaking any
indicated preparation work. As a standard, you should:
23. · Bring a copy of the lecture slides with you to the information
sessions to make your own notes on during the session;
· Bring a copy of any materials provided for the exploration or
application sessions with you to class (or bring an appropriate
laptop/tablet to view electronic versions of materials in class
where available);
· Read through all materials provided BEFORE attending class;
· Ensure your mobile phone is set to silent during classroom
sessions;
· If you choose to use mobile devices to view teaching materials
please do not use them to engage with social media during
classroom sessions;
“Researchers found that students sending and receiving
messages while studying scored lower test results and were less
effective at tasks such as note taking… when students did not
use mobiles, they were better at being able to recall
information.”
This is also very important when thinking about your
employability prospects
Mobile Phones in the Classroom: Examining the Effects of
Texting, Twitter, and Message Content on Student Learning
cited at http://www.bbc.co.uk/news/education-33047927
Punctuality
You are expected to arrive on time for all sessions, so you do
not interrupt the learning of other students. Please ensure you
arrive on the hour and are seated quietly and ready to commence
the session at five minutes past the hour. If you arrive late for
class, you may be asked to wait outside the lecture theatre until
the tutor is able to invite you in to minimise disruption to other
students. Persistent lateness will be reported to your
programme leader.
Attendance and Engagement
You are expected to attend and engage with all sessions and you
24. are responsible for bringing your student card with you and
using this to register your attendance through the electroni c
scanning system used in class. If you forget your card, please
see the tutor face to face at the end of the session so your
attendance can be recorded manually. No other registering of
attendance will take place. Persistent and unreported absences
will be reported to your programme leader.
Absence
Repeated failure to attend/contribute may result in being
deregistered from the module and your programme of study.
Under normal circumstances missing any three weeks of taught
sessions for a module, either consecutively or intermittently,
without good cause, may be considered a lack of adequate
participation.
By accepting the Student Declaration, you agree that:
· You will participate fully in those activities which are
described in each module as essential;
· You will inform the Module Leader if circumstances oblige
you to miss any of those essential activities and give details of
the relevant circumstances to the Module Leader;
· You wish to have your performance assessed according to the
approved procedures;
· You will observe and meet the deadlines and timetable
prescribed for each module; and
· Failure to participate adequately in the essential activities may
lead to termination of your enrolment on your programme of
study. You will be invited to explain your failure to participate
before termination on the programme occurs. Failure to engage
in this process will be considered to be withdrawal.
Remember: participation is not just about turning up.
Contribution to and participation in essential activities on the
module is essential to the learning process.
25. If you are unable to attend class, please report your absence
using the central reporting system. The module team will then
be notified. You can notify the university about your absences
at [email protected]. You can find information on the range of
services available to help and guide you through your studies at:
https://www.derby.ac.uk/services/student-centres/ or ring 01332
591066. The Business Student Centre is based in E406 at
Kedleston Road, you can email them at [email protected] or ring
them on 01332 591066 (Press 2). If you have a problem
If you have any problems with the module or the work, see your
module tutor as soon as possible. They may be able to help, and
the sooner a problem is identified, the easier it will be to sort
out. Alternatively, you may wish to speak to your Programme
Leader, Year Tutor (your Programme notice board will tell you
how to contact them) or a member of the Student Support
Service in B Block, Kedleston Road. If you feel that your
problem/s may affect your ability to submit work on time, you
will need to go through our Exceptional Extenuating
Circumstances process.
Please note that work submitted late will not be graded.
Technical Issue approaching the deadline time
If you experience a technical issue when uploading to Course
Resources or Turnitin and you feel you are likely to be late
submitting the work as a result, please do the following:
Email your College email address and also ITS to report the
issue and to make sure you send your work on time. This must
only be used in the case of a technical issue preventing you
from uploading your assignment on time; late submissions due
to large file sizes, which can take longer to upload, or leaving
submission until very close to the deadline time, will not be
accepted via this system.
You should email:
[email protected] AND your College Registry email address:
26. [email protected]
In your communication, you must include all of the following:
• Student ID
• Programme name, Module Code and Title
• Name of the submission point you are submitting to
(Turnitin, Blackboard, Pebblepad)
• Module tutor name
• Copy of your submission
• Screenshot/Details of the error message – this MUST be
included to support your claim that a technical issue has
prevented you from submitting to the deadline.
This will help to identify your issue.
A submission by email will generate an auto reply with a date
stamp, which can be used to evidence technical problems if the
deadline is missed. Your College Registry teams will ensure the
work is sent to the appropriate tutor. They will also monitor if
there are multiple submissions from individual students via this
channel on different dates; the system creates additional work
for staff and must only be used in an emergency when technical
issues only are preventing you from meeting the submission
deadline.
Full information about university regulations can be found
at:http://www.derby.ac.uk/about/organisation/academic-
regulations/
Extenuating Circumstances
All coursework is expected on the date set by the module
leaders/course tutors, unless you have an approved late
submission request or late submission is covered by a support
plan. If your coursework is submitted late, without approval, it
will not be marked.
27. However, we know there can be circumstances out of your
control - a bereavement or hospitalisation for example - and
when this happens, the EEC process may help you. You'll need
to submit evidence to support your personal circumstances,
from a professional person with your application. Your request
will be considered by a panel. The most important thing to
remember is you still need to attempt your assessment
(presentation/exam/coursework). If your EEC is approved,
you'll normally be offered the opportunity to sit a fresh
assessment at the next submission point if not, your original
submission will be marked.
Note: If you have a support plan which identifies the need for
extensions, and your need is related to your disability, you
should use the Assessed Extended Deadline (AED) system
instead.
What are Exceptional Extenuating Circumstances (EEC)?
Here are some circumstances that the EEC option covers:
· Bereavement
· Unexpected carer responsibilities
· Hospitalisation
· Sudden return home (abroad) following a family emergency
· Mental illness
Here are some circumstances that the EEC option doesn't cover
· Lack of time management
· Failure to organise your time appropriately
· Circumstances for which you have had ample opportunity to
plan
· Technical failures of computers/equipment
· Negligence or carelessness
· Circumstances already addressed in a support plan
· Circumstances which you didn't disclose at the appropriate
28. time (unless you were unable to do so e.g. hospitalisation)
If you have an on-going disability or medical condition and you
have a support plan, you won't be covered by the EEC process
unless it’s above and beyond what your support plan covers. If
you don't yet have a support plan for your condition, please get
in touch with the Student Wellbeing Service on 01332 593000
or email [email protected]
Completing an EEC Request
You can make an EEC request electronically through UDo. Our
regulations say that you must normally submit your EEC
application BEFORE your original hand in date.
Click on 'my details' in the ‘self-service’ area (left hand side) of
UDo. This will take you through to the Uni information system.
Once you've logged in here select 'Student Centre' in the ‘go
to…’ box (top, right hand side). When you’re in student centre
click on 'my modules and results’. Select the module and the
assessment you require to be considered by clicking on the
module code and then choose the Exceptional Extenuating
Circumstances tab and Request EEC. Complete all the sections
on the form and upload your supporting evidence.
· If you can’t submit evidence when you’re completing the
application, you can choose to ‘Upload Evidence Later’ – you’ll
be able to go back into your application later to do this.
· If it’s not possible for you to upload evidence yourself, you
can take it into the student Support Centre in the Atrium and
they will be able to scan a document and upload it for you.
Throughout the process you’ll be able to see online updates to
your application. Once the panel have met and reviewed your
application, the decision will be available to view on UDo
within five working days of the panel.
Full details on the EEC process, panel dates and submission
29. deadlines along with information on how to complete a request
are available electronically at:
https://www.derby.ac.uk/about/academic-regulations/
Late Submission Requests
In circumstances where you believe you can hand in your work
but need some extra time you may be eligible for a 7-day
extension (instead of an EEC). This can be applied for if
circumstances out of your control mean you won't be able to
meet an assessment deadline e.g.
· Short term illness or flare up of an ongoing medical condition
· Bereavement
· Unexpected care responsibilities
If your application is successful this will allow you to submit
your assessment up to 7 days late, without your mark being
capped.
This would NOT cover:
· Lack of time management
· A student's failure to organise her/his time appropriately
· Circumstances for which a student has had ample opportunity
to plan
· Technical failures of computers/equipment
· Negligence or carelessness by the student
· Circumstances already addressed in a student's support plan
· Circumstances which a student didn't disclose at the
appropriate time (unless the student was unable to do so e.g.
hospitalisation)
· An on-going disability or medical condition for which you
already have a support plan unless it's above and beyond what
your support plan covers.
30. Again, the most important thing to remember is you'll still need
to submit an attempt at your coursework by the original
deadline
Referrals
A referral is an opportunity to make good an element of the
module that you've failed. This may be a piece of coursework,
an exam or both. It means you don't have to re-take a module,
just repeat the element (coursework, exam or both) that you've
failed. This means that you must redo the assignment and
submit it in time for a further deadline, the referral deadline. If
the original failure is redeemed, i.e. you pass the referral, then
the work is graded with the lowest pass mark, i.e. 40%. If you
have been given a referral, the details of the task set will be
posted on UDo.
You must register to accept a referral (see paragraph below).
Only one referral opportunity is offered per element. If passed,
your grade for that element will be capped to 40%. If you fail
the referral opportunity you will need to retake the module in
its entirety, and this will be capped to 40%.
How to accept a referral: Referrals are offered in a drop-down
box next to your mark in your student centre on UDo and a box
will appear which will ask you to accept or reject. You may
have been offered referrals in more than one element. To accept
or reject please select from the drop-down box.
Please note that if you do not submit a component of
coursework you will receive an NS grade. Under normal
circumstances you will not be offered a referral where an NS
grade has been recorded for the coursework component .
Assessment Criteria
Your summative coursework is assessed using the Assessment
Rubric in Appendix A and the Undergraduate Marking Scale in
Appendix B. An assignment submission checklist is included in
31. Appendix C.
External Examiners
The Chief External Examiner for BA Business Management (UK
and Collab) is Costas Theodoridis, Manchester Metropolitan
University. The external examiner for this module is Paula
Jenkins, Chichester University.
Under no circumstances should students make contact with
External Examiners directly.Diversity Statement
At the University of Derby, we are committed to
promoting diversity and equity through inclusive practice. This
means that we will do everything we can to ensure that how we
teach, what we teach, and the environment in which the
teaching and learning takes place are right for you. We will
ensure that you have information and access to services
that support your learning.
We understand that diversity and inclusion at the University are
about recognising and appreciating everyone as a whole person
because we all have multiple forms of diversity, some of which
are visible and others which are not. However, you identify you
join us as a respected part of our University Community. We are
inclusive to actively celebrate identity and the knowledge,
experience and talents each person brings. We are not inclusive
by expecting our students to conform to a particular identity –
we celebrate difference; we celebrate you!
We seek to create a culture of acceptance and fairness centred
around environments which value different forms of knowledge,
are engaging and professional. Our systems and procedures
embed principles which ensure that everyone is valued and
respected throughout their time at the University.
We do not accept behaviours that discriminate, and we will
challenge language and attitudes that seek to diminish and
32. disrespect others. We do this best when we work together as an
academic community of staff and students. We expect every
member of staff and every student to play their part.
There is an expectation that we will educate ourselves so that
we are prepared to understand and challenge white privilege,
racism, homophobia, sexism, disablism and every other area of
inequality that harms and takes power away from individuals
and communities.
We recognise the need to take responsibility for all our
language, actions and behaviours because we are accountable
for the impact they have on other people.
2
5
Sensitivity: Internal
Appendix A: Assessment Rubric
Outstanding 90-100%
Excellent 70-89%
Very Good 60-69%
Good 50-59%
Satisfactory 40-49%
Unsatisfactory <40%
Knowledge
Evidence that the student has:
Understood the topic area
Supported their work with relevant research and reading
33. · Detailed understanding of topic area backed up with relevant
references
· Research beyond scope of module materials
· Draws links to other modules
· No further development of answer required
· Wide topic knowledge from the module
· Draws different concepts together effectively
· Strong use of relevant theoretical models and/or research
· Fully referenced with wide range of sources
· Strong evidence of independent research
· Draws together some of the key topics from the module
· Some use of theoretical models and/or research to support
answer
· Evidence of some independent research but largely guided by
references provided in the module
· Adequate use of module topics
· Some gaps in knowledge or misunderstanding of concepts
· Some evidence of research and reading but may be
overreliance on core textbooks/overuse of direct quotes etc.
· Limited use of topic knowledge from the module/lack of detail
· Some significant gaps in knowledge or misunderstanding
· Limited or poor evidence of research and reading
· Overreliance on lecture slides and notes
· No/ very limited use of topics from the module to answer the
question
· No/very limited supporting literature
Critical Thinking
Evidence that the student has:
Questioned their sources, arguments and solutions
· Extensive critical evaluation of arguments and cited literature
· Fully balanced argument
· Researched and answered from different angles.
34. · Questions some of the research sources used
· Well balanced argument
· Explores some alternative arguments,
advantages/disadvantages, pros and cons etc.
· Some evidence different approaches to answering the question
are understood
· Acknowledges a few alternative arguments to the answer e.g.
advantages and disadvantages, pros and cons
· Very limited identification of alternative arguments
· Accepts reference sources at face value
· A one sided answer with no consideration of alternative
arguments
Application
Evidence that the student has:
Pulled ideas together effectively to answer the question
Provided appropriate examples where necessary/helpful
· Thoughtful and thorough application of knowledge, theory and
research to question throughout
· Tailors information to answer the question fully
· Illustrates answer with range of organisational examples
· Links in relevant personal examples/experiences
· Uses some appropriate organisational examples discussed
during the module
· Uses personal examples but may not always link this back to
theory/literature
· Integration of theory/research may still be disjointed
· Examples are limited or lack relevance
· Examples are given but poorly integrated into the answer
· Lacks examples
· Very limited reference to the task
· No or inappropriate use of examples
35. · No links to the task
Evaluation
Evidence that the student has:
Identified strong and relevant information to answer the
question
Left out weak or unnecessary information
· All concepts and material fully relevant to the analysis and
recommendations including materials sourced from independent
research
· All chosen ideas are relevant to the answer
· Answers the question fully covering all key concepts
· No evidence of ‘padding’ with irrelevant information
· Uses some relevant ideas
· Chooses appropriate concepts and makes an attempt to answer
the question
· Information is mostly relevant to the question
· Only minor missing elements
· Minimal ‘padding’ with irrelevant information
· Some effort to answer the question
· Some missing, weak or irrelevant elements
· Links to answer are unclear in places
· May ‘pad’ with irrelevant information
· Key elements of the question remain
unanswered/underdeveloped
· Confused choice of concepts to answer the question
· Important concepts may be difficult to pick out
· Largely irrelevant ideas
36. · Does not answer the question that was asked
· Covers concepts which are not relevant to the answer.
Communication
Evidence that the student has:
Put their ideas across clearly on paper
· Outstanding, sophisticated written communication
· No significant areas for further development
· Logical organisation and flow of ideas
· Error free written communication
· Precise Harvard Referencing
· An enjoyable read
· Largely well-structured answer
· Only minor spelling/grammatical errors
· Good grasp of Harvard Referencing
· Mainly easy to read and follow
· Some spelling/grammatical errors but do not significantly
interfere with understanding
· Some attempt to Harvard Reference
· Difficult to read and follow in places
· Repeated spelling/grammatical issues
· Weak Referencing skills
· Difficult to read and follow
· Very difficult to read and follow
· Extensive problems with written presentation
· No or incorrect Referencing
37. 2
Appendix B: Undergraduate Marking Scale
Appendix C: Submission check list
1. I have carefully analysed the question/s and answered
EVERY part, providing examples where these have been asked
for
2. I have included a SHORT introduction explaining what will
be covered in the answer
3. I have removed any materials that are irrelevant to the
question that has been asked
4. I have edited my work carefully to correct any spelling,
grammatical and typographical errors
5. I have supported each new idea in my work with reference to
something I have read “that makes me think that”
6. I have demonstrated a range of reading resources including
some textbooks, some journal articles and some websites
7. I have not referenced Wikipedia, Business Balls or Mind
Tools as these are weak academic reference sources
8. I have ensured that all the sources I have cited/ referred to in
my answer are listed in full in a reference section at the end of
my work.
9. I have listed my references only ONCE in my reference
section
38. 10. I have presented my references in alphabetical order. (I
have NOT separated this into sections of books, journals,
websites etc.)
11. I have provided page numbers with references where I have
used direct quotes to show specifically where the direct quote
can be found.
12. I have presented all direct quotes in double speech marks
(“xxxxx”) to clearly indicate that these are not my own words
13. I have used direct quotes sparingly, preferring to write in
my own words where ever possible to show I have understood
what I have read
14. I have avoided using bullet points or number lists preferring
to discuss my points in full sentences developing my discussion
to demonstrate my understanding of the points made.
15. I have written my work in the third person avoiding the use
of ‘I’, ‘My’, ‘We’, ‘The author’ etc
16. I have removed unnecessary pictures and diagrams from my
work e.g. copies of lecture slides and concentrated on writing
about what this shows
17. I have provided a concise conclusion at the end of my work
summarising the main points I have made
18. I have removed appendixes, talking about its content in the
main part of my answer if it is important enough to be included
19. I have checked the similarity report on ‘turn it in’ and
addressed any plagiarism issue
20. I have submitted my work on time to avoid my grade being
39. penalised for late submission
derby.ac.uk
Sensitivity: Internal
Developing
Leadership and
Management
6HR510
derby.ac.uk
Sensitivity: Internal
THIS SESSION IS BEING
RECORDED AND WILL BE
AVAILABLE ON COURSE
RESOURCES
40. derby.ac.uk
Sensitivity: Internal
Session Objectives
Exploration and evaluation of the role of the modern leader.
• Creating vison
• Shaping culture
• Driving change
• Empowering high-performance teams
• Embodying ethics
derby.ac.uk
Sensitivity: Internal
§ A Mission Statement defines the company’s business, its
objectives
and its approach to reach those objectives.
§ A Vision Statement describes the desired future position of
the
company.
§ Organizational values are the foundation on which the
organization
is built. They describe the individual and corporate behaviours
that
will get the organization from where it is now, to achieving the
mission and living the vision.
Shaping organisational vision and values
41. derby.ac.uk
Sensitivity: Internal
Microsoft Values
derby.ac.uk
Sensitivity: Internal
Shaping Culture
• “Organisational culture is the way that things are done in an
organisation, the unwritten rules that influence individual and
group behaviour and attitudes. Factors which can influence
organisational culture include: the organisation's structure, the
system and processes by which work is carried out, the
behaviour
and attitudes of employees, the organisation’s values and
traditions, and the management and leadership styles adopted.”
(CMI, 2018)
derby.ac.uk
Sensitivity: Internal
derby.ac.uk
Sensitivity: Internal
Geert Hofstede Cultural Dimensions
42. derby.ac.uk
Sensitivity: Internal
10 minutes with Geert Hofstede
• The 6 dimensions model of national culture by Geert Hofstede
https://geerthofstede.com/culture-geert-hofstede-gert-jan-
hofstede/6d-model-of-national-culture/
derby.ac.uk
Sensitivity: Internal
Cultural Dimensions (Trompenaars and Hampden-Turner 1997)
Universalism
Individualism
Neutral
Achievement
Specific
Sequential
Inner-directed
Particularism
Collectivism
43. Affective
Ascription
Diffuse
Outer-directed
Synchronic
derby.ac.uk
Sensitivity: Internal
https://www.kotterinc.com/8-steps-process-for-leading-change/
1. Create a sense of urgency
2. Build a guiding coalition
3. Form a strategic vision and initiatives
4. Enlist a volunteer army
5. Enable action by removing barriers
6. Generate short-term wins
7. Sustain acceleration
8. Institute change
The 8-step Process For Leading Change
https://www.kotterinc.com/8-steps-process-for-leading-change/
https://www.kotterinc.com/8-steps-process-for-leading-change/
https://www.kotterinc.com/8-steps-process-for-leading-change/
https://www.kotterinc.com/8-steps-process-for-leading-change/
https://www.kotterinc.com/8-steps-process-for-leading-change/
https://www.kotterinc.com/8-steps-process-for-leading-change/
https://www.kotterinc.com/8-steps-process-for-leading-change/
45. CMI Leadership news
Leadership as kindness
Happiness at work
Beyond kindness, leadership as generous
Topical leadership challenges
https://www.managers.org.uk/?s=leadership+challenges
https://www.managers.org.uk/?s=leadership+challenges
derby.ac.uk
Sensitivity: Internal
Institute of Directors leadership news
Leadership Success
Good governance - the structure through which an organisation
is
directed, controlled and held accountable which defines a
framework of procedures.
derby.ac.uk
Sensitivity: Internal
ILM news
Positive leadership skills
Contagious Leadership
46. derby.ac.uk
Sensitivity: Internal
CIPD Leadership News
The Trust Crisis
Topical thought pieces on leadership
https://www.cipd.co.uk/news-
views/changing-work-views/future-
work/thought-pieces/responsible-business
https://www.cipd.co.uk/news-views/changing-work-
views/future-work/thought-pieces/responsible-business
derby.ac.uk
Sensitivity: Internal
References
CMI (2018) Understanding Organisation Culture,
www.managers.org.uk/~/media/Files/PDF/Checklists/CHK-232-
Understanding-
organisational-culture.pdf, accessed 19/6/18
Hofstede G H, Hofstede G J and Minkov M (2010) Cultures and
Organization:
Software of the Mind: International Cooperation and its
Importance for Survival
(3rd edtn). London: McGraw-Hill
Johnson G, Whittington R, Scholes K, Angwin D and Regnér P
(2017) Exploring
47. Strategy: Texts and Cases (11th edtn). Harlow, Essex: Pearson
Education
Kotter (2019) 8 Steps for Leading Change,
www.kotterinc.com/8-steps-process-
for-leading-change, accessed 01/19
http://www.managers.org.uk/~/media/Files/PDF/Checklists/CH
K-232-Understanding-organisational-culture.pdf
http://www.kotterinc.com/8-steps-process-for-leading-change
derby.ac.uk
Sensitivity: Internal
References
Northouse, P. (2015) Leadership: Theory and Practice, 7th edn.
London, Sage.
Roe, K. (2017) Leadership: Practice and Perspectives, 2nd edn.
Oxford
University Press
Trompenaars F and Hampden-Turner C (2011) Riding the Waves
of Culture:
Understanding Diversity in Global Business, 3rd edn. London:
Nicholas Brealey
Sensitivity: Internal
Developing Leadership
and Management
(6HR510)
48. Sensitivity: Internal
The Task
Section 1:
Critically evaluate the contemporary definitions of leadership
and management examining current perspectives of the
roles and responsibilities of both leaders and managers
generally.
• This section should account for approximately 60-65% of your
total
word count (probable ballpark 2,000 to 2,100 words)
• You should be using in the region of 20 – 25 appropriate and
robust
academic references to supplement and validate your evaluation
Sensitivity: Internal
Assignment Considerations
• Only pick four or five key models or theories and focus your
attention
on them (rationale is that if you try to focus on too many
49. different
models or theories you establish no depth of awareness or
understanding in any of them).
• Make sure you use multiple academic perspectives when
discussing
each key theory.
• Think about the evolutionary process of management and
leadership
and consider writing your assignment through that mechanism.
• Remember to use both leadership and management theories /
models.
• Remember also – you are not writing for you but for your
audience (in
this case your tutors).
Sensitivity: Internal
Structuring Work
• Using the information provided in Lecture 4 (week of 22nd
February)
build a body of dialogue around each key model or theory.
• Do not use single sentence, or simply use limited, paragraphs
(2-10
50. lines) to create that awareness and understanding as this limits
insight
and awareness of the point you wish to discuss.
• Construct good robust paragraphs using at least 3 (ideally 4)
appropriate
academic sources to help inform the reader of the point you are
making.
• Avoid using the same source multiple times in the same
paragraph, it
slightly undermines the credibility of your evaluation.
• Each paragraph is more likely to be in the region of 15 – 20
lines and
using multiple academic sources gives the reader a chance to
appreciate
the breadth and depth of your research (which is always a plus).
Sensitivity: Internal
The Task
Section 2:
Based on your evaluation in section one, propose a minimum
of three critical skills and behaviours required to be a
successful 21st century leader. Consider specific methods of
leadership and management development that could develop
these critical skills and recommend how to implement and
evaluate these development interventions effectively. (LO3)
51. (You may present your recommended interventions and
respective
evaluations in a table format for section 2).
• This section will account for approximately 35-40% of your
word count
• You should be using in the region of 10 – 12 appropriate and
robust
academic references to supplement and validate your proposals
Sensitivity: Internal
Assignment Considerations
1. Pick ONLY three skills and / or behaviours and construct a
rationale
outlining the purpose and value of these skills and why
development in
these areas would be beneficial for prospective 21st century
leaders.
2. Construct an implementation (How, Who, Where, When) and
evaluation
plan (with distinct mechanisms to measure the impact and
potential
success of your implementation).
3. Point 2 can be constructed using a tabular format:
Skill / Behaviour Method of Implementation Evaluation
52. Measures
1. xxxxx
2. yyyyy
3. zzzzz
Sensitivity: Internal
Structuring the Work
• Section 2 is constructed of two elements:
• Element 1 discusses the three skills or behaviours you feel
would be
useful to develop in 21st century leaders. Using a range of
academic
sources (in the region of 10-12) construct a rationale that
determines
the purpose and value of these skills / behaviours in today’s
business
environments.
• Avoid overusing any one source to construct this rationale (as
it
potentially undermines the value proposition of your ideas).
• The probable ballpark word count for this element is 1,000 to
53. 1,100
words.
Sensitivity: Internal
Structuring the Work
• Element 2 is presented in table format (probable ballpark word
count is
400-500 words).
• It outlines the implementation methods and the mechanisms by
which
you will determine the relative value and success of the plan.
• The implementation methods should address how you plan to
implement
these ideas with an indication of who they are targeted at,
whether this
is a staged plan (activity 1, activity 2 etc) and when they can
occur
(there may be necessary time intervals in the plan to ensure
work based
learning is captured, which may be part of your evaluation
process).
• The evaluation measures is likely to be multiple (meaning
54. there will be
more than one measure for each skill or behaviour being
developed).
Sensitivity: Internal
Presenting Your Work
• A professional presentation is required. Remember, you are
presenting
to an audience, not to yourself. What you present and how you
present
it is often considered to be an indication of you, so be
professional.
• Use size 12 font (Arial, Verdana, MS Sans Serif tend to be
good choices
as they are relatively easy to read).
• Use line and half (1.5) spacing. Do not cram things in on top
of each
other. A cluttered and ill-considered presentation does not
make good
or easy reading so help the reader.
• Build good, well informed (from appropriate and robust
academic
research) points of discussion. Show the reader you have an
55. understanding of the subject and not just some vague
acknowledgement
of it.
Sensitivity: Internal
REMEMBER
IF YOU ARE IN DOUBT ABOUT ANY
ASPECT OF THE WORK, ASK FOR HELP.