1. Integrity, the basic principle of healthcare leadership.Conta
•Download as DOCX, PDF•
0 likes•3 views
1. Integrity, the basic principle of healthcare leadership. Contains unread posts Mateo Alba posted May 12, 2021 10:04 PM Subscribe Integrity of any organization regardless whether it is in healthcare or business or government is paramount. Because of integrity comes trust. Having trust in a healthcare organization is nonnegotiable. It is the foundation of a world-class organization. Executives who ignore ethics run the risk of personal and corporate liability in today’s increasingly tough legal environment (Lynn S. Paine, 1994, Managing for Organizational Integrity, pp. 2-21) First, the healthcare organization. The healthcare organization is the head or the governing body. It is charged of day-to-day functions, establish policies, guidance, business process, safety, security and all the administrative duties. Integrity is and must be the cornerstone of any healthcare organization. Without it, no clinicians or workers that would knowingly work for an organization that they cannot trust or feel safe. And most importantly, if the patients do not have trust in the organization, they will avoid that facility at all cost. Second, the clinicians. The clinicians are what makes the organization or facility function. Whether they are the providers, nurses or staff it is important that they have the integrity to always do what is right not only for the healthcare team or the organization, but most specially for the patient. It starts with the clinical leaders building trust to their subordinate staff by having the integrity and values of what a leader should be. Once that is established, then it permeates throughout the entire team. Thereby improving the healthcare delivery. Lastly, and the most important is the patient. At the center of the entire system needs to be the patient. Once the patient recognizes the integrity or values of the healthcare organization and the clinicians delivering healthcare, patient trust is established. The patient satisfaction also increases. According to Cowing, Davino-Ramaya, Ramaya, Szmerekovsky, 2009, pp.72, “if patients are satisfied with clinician-patient interactions, they are likely to be more compliant with their treatment plan, to understand their role in the recovery process, and to follow through with the recommended treatment”. Having integrity or values in the healthcare delivery is the basic principle of healthcare leadership. Cowing, M., Davino-Ramaya, C. M., Ramaya, K., & Szmerekovsky, J. (2009). Health care delivery performance: service, outcomes, and resource stewardship. The Permanente Journal, 13(4), 72–78. Retrieved from https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2911834/ Lynn S. Paine, 1994, Managing for Organizational Integrity. Harvard business review, 2-21. Retrieved from Managing for Organizational Integrity (hbr.org) 2. Medical Delivery Influences Contains unread posts Robert Breeden posted May 12, 2021 9:44 AM Subscribe Hello, The influence within the medical community is so important and ...
Report
Share
Report
Share
Recommended
The Board's Evolving Role in Quality Oversight August 2015
The document discusses the evolving role of boards in overseeing healthcare quality and patient safety. It notes that healthcare in the US is undergoing transformation, with a focus on value, consumerism, and new technologies. In response, non-profit hospitals are transforming, with a greater focus on quality measurement and reporting. The document outlines the legal, regulatory, financial, and moral imperatives for boards to engage more directly in quality oversight, as well as fiduciary responsibilities and potential approaches boards can take to fulfill their quality governance role.
· Analyze how healthcare reimbursement influences your nursing pra
· Analyze how healthcare reimbursement influences your nursing practice.
Health care is significantly changing with time, and one of these changes is how health care facilities and providers are compensated for offering service. One of these ways is through reimbursement. Health care reimbursement is the payment given to a health care facility or a health care provider for offering medical service to a patient (Torrey, 2020). This cost is often covered by a patient’s health insurer or a government payer. In health care reimbursements are beneficial because they discourage DNP-prepared nurses from establishing their own independent practices. This is because at their own practices they would receive less reimbursement under their own number than under that of a physician. If the reimbursement rates were equal more DNP-prepared nurses would establish their own practices and this would increase competition.
Due to healthcare reimbursement, models that emphasize cost-effective decisions by DNP-prepared nurses are developed. These decisions are offer patients with quality medical care rather than sacrificing the patient service quality. Innovations such as price transparency tools as well as patient engagement apps help the nursing practice during the implementation of healthcare reimbursement. The patient outcome as well as the low-cost care provided by health care providers has an influence on the reimbursement received. Health care reimbursement tends to motivate health care providers because they earn more when the care they provide is of high quality as well as low cost.
DNP- prepared Nurses' role helps Nurse Practitioners to prepare for the advancement they will encounter in their nursing career in health care. This enables them to be more competent and have more knowledge when offering quality health care. The main goal of the health care reimbursement system is to pay health care providers based on their performance. This means that being more advanced and competent is beneficial for a DNP in order to provide high-quality care to patients. This simply means that if they offer high-quality care, the reimbursement will reflect this and they will be paid more. And if they are not competent, then the reimbursement will be vice versa.
2- Examine how the value-based insurance design (VBID) influences clinical outcomes and cost issues.
The aim of value-based insurance design is to increase the quality of health care while decreasing the cost by using financial incentives to promote cost-efficient health care services and consumer choices. In order to remove roadblocks as well as maintain and improve a person’s health, health benefit plans can be developed. These plans tend to save money by reducing future expensive medical procedures. They do this by covering treatments such as prescribed drugs at a low cost or no cost, preventive care as well as wellness visits (Lexchin, 2020).
The healthcare industry is making a shif ...
Student Response #1The domain that I believe to be the most si.docx
The document discusses the Donabedian model for evaluating healthcare quality, which consists of structure, process, and outcomes. The author argues that the process domain is the most significant because it directly relates to how patients are treated and cared for. Processes like diagnosis, treatment and education have a large impact on patient recovery, satisfaction and outcomes. While all three domains are important, the processes of care delivery are most crucial for ensuring quality. The document also notes that composite measures are now commonly used in addition to the three traditional domains to evaluate overall quality of care.
1 6EXECUTIVE SUMMARYJessica RamosCapella
This document provides an executive summary of a nursing leadership paper addressing quality and safety issues. It discusses medication errors as a systematic problem that can harm patients and impact healthcare providers and organizations. The author recommends strategies to minimize errors such as establishing a safety culture and acknowledging that humans are fallible. As a nursing leader, the author will work to identify gaps, improve outcomes through evidence-based practices, and address systematic issues and their impacts.
1 6EXECUTIVE SUMMARYJessica RamosCapella
1
6
EXECUTIVE SUMMARY
Jessica Ramos
Capella University
NURS-FPX6212: Health Care Quality Safety Management
Dr. Mary Ellen Cockerham
August 18, 2021
Executive Summary
Medication error being a systematic problem is not a new case. It is something that nurses and other healthcare providers have experienced. The error could be a result of recurring issues of just human error. It could also lead to more severe injuries where the patient could find themselves with a new condition such as itching rashes or skin problems that could either be temporary or permanent. These medication errors could even lead to death in some cases, significantly hurting the patient's family, especially when they know that the death of their loved one could have been prevented. It could make the healthcare provider responsible for the error start doubting themselves and start feeling guilty and ashamed for the action. It could even lead to depression throughout their life. If the deceased's family decides to file a lawsuit against the nurse or the one who was responsible, it could result in them losing their license. Medication errors can also impact the hospital where the healthcare provider is working, and patients even lose trust in the kind of treatment offered in that hospital. The occurrence of medication errors could cause the organization not to achieve its goals and objectives of providing quality care to patients for better results. Since human is to error, a medication error of not greater than 5% is allowed, but currently, it is at 39.5% (Barker et al. 2020)
As a nursing leader, I would recommend using various strategies to help minimize the occurrence of such medication errors in the future. The management should make it their responsibility to establish a safety culture and constantly report the current system and how it is performing. Healthcare providers should understand that humans are to error, and no one is to be blamed or receive a harsh form of punishment. The healthcare provider responsible for the medication error should acknowledge their mistake and report to the nursing leaders or the supervisor in charge to ensure patient safety before things get worse.
Nursing is a vital profession in the healthcare sector, mainly concerned with providing quality care to individuals and families. However, it has been discovered that there is a gap between the expected outcomes and the actual results. As a nursing leader, I will present the matter before other executive leaders to ensure care has been improved. Even though care is the primary concern of nurses, other healthcare providers should also work to ensure quality and safety outcomes. It is the responsibility of every individual in the organization. They should ensure to utilize evidence-based information and apply this knowledge to assess the ability of the entire organization to provide evidence-based care delivery. I will also look at systematic problems and specific medication e ...
MHA6999 SEMINAR IN HEALTHCARE CASES-- WEEK 2 LECTURE, DISCUSSION,
MHA6999 SEMINAR IN HEALTHCARE CASES-- WEEK 2 LECTURE, DISCUSSION, AND PROJECT INSTRUCTIONS
Page | 1
Quality
Nearly fifteen years ago, the Institute of Medicine published the “To Err Is Human” report, which exposed the substantial impact of medical errors in the US healthcare system and called for a dramatic system change, including an improved understanding of those errors (McCarthy, Tuiskula, Driscoll, & Davis, 2017). Medical errors are considered to be failure to achieve the original goal or plan of action, and these errors may range from a patient falls to a mistake in the operating room. Not only do medical errors cause harm to the patient and jeopardize the patient’s trust, but they also cause a financial strain for the health system (“To Err is Human,” 1999). One of the contributing factors to medical errors is the lack of effective communication between doctors who are treating the same patient. This results in healthcare providers overprescribing medications for patients as well as increases the possibility of a patient having unnecessary tests or procedures performed. The report’s four-tiered approach includes:
· Focusing on creating a stronger foundation of education on patient safety
· Mandating a nationwide reporting system to encourage timely reporting of errors
· Increasing the standards of performance for healthcare providers
· Taking advantage of the security that safety systems offer (“To Err is Human,” 1999)
Creating a strong educational foundation for patient safety is most important. Healthcare personnel are much more likely to actively participate in reporting systems, encourage one another to perform at a higher level, and take advantage of safety systems when they are well educated on patient safety and the implications of medical errors. The reporting system seems to provide the least amount of impact on patient safety as they can result in losing patient trust in certain healthcare systems. The healthcare system as a whole has made progress in establishing a safe environment for patients when they are in need of care.
Challenges for Patient Safety and Steps for Improvement
Despite continuing evidence of problems in patient safety and gaps between the care that patients receive and the evidence about what they should receive, efforts to improve quality in healthcare show mostly inconsistent and patchy results.
Tap each image to know more.
Data Collection and Monitoring Systems
This always takes much more time and energy than anyone anticipates. It is worth investing heavily in data from the outset. Assess local systems, train people, and have quality assurance.
Tribalism and Lack of Staff Engagement
Overcoming a perceived lack of ownership and professional or disciplinary boundaries can be very difficult. Clarify who owns the problem and solution, agree roles and responsibilities at the outset, work to common goals, and use shared language.
Convince People That There's a Problem
Use hard data to secure emotional e ...
Increased Awareness Concerning Patient.docx
This document discusses the need for increased patient safety in the U.S. healthcare system. It notes that medical errors have increased significantly in recent decades. While suggestions have been made to improve policies, procedures, and oversight, leadership within individual organizations will be key to implementing new patient safety protocols. Research is also needed to better understand errors and develop solutions. A focus on leadership, data, education, and continuous improvement can help healthcare organizations strengthen patient safety standards over time.
Running head HEALTHCARE1HEALTHCARE3
Running head: HEALTHCARE 1
HEALTHCARE 3
Healthcare
Yahima Montero
Chamberlain University
NR 534 Weeek 5
Healthcare
The Analysis
The paper explores and analyses how the culture and climate of at my workplace, Cleveland Hospital influence the provision of quality care services. The creation of a sustainable healthcare work environment in which workers and patients feel engaged, loyal, and satisfied remain as priorities of any organization. My organization culture makes the broader construct that covers every aspect of employees at work. The climate within the organization involves our shared perceptions among employees on the organization’s procedures, practices, policies, and the nature of the rewarding system. The summary of the assessment findings on my organization’s physical environment, organizational power and structure, social environment, environmental safety, professional and personal support, organizational communication, and organizational taboos form the critical aspects of the paper.
Cleveland Hospital Organizational Culture and Climate Analysis
Summary of Assessment Findings
Physical Environment: How I experience the work environment at any given time, how it feels to work in the organization and to perform in the organization’s culture influences my mood. Within the facility, families visiting their patients have a well-furnished waiting bay with television in which they first rest before being allowed to see their patients. Those with cars can access marked parking lots that are enough. Since the organization is Christian-based, it has a chapel in which patients’ families can gather and pray for their loved ones undergoing medical treatment.
Environmental Safety: As workers, we share values and beliefs that influence our behavior within the organization. It is through these share aspects in which the organization has identified to provide safety measures since the organization believes that healthy workers are essential assets in performance. As a result, environmental safety measures such as safety stickers on elevators, stairwells, passageways, and hallways are maintained. These stickers remind workers and other people that safety at the workplace is critical and that they should observe safety measures.
Social Environment: The organization has maintained its annual event at the end of the year in which all workers and other senior employees converge to celebrate the achievements of that year. These internal social events have helped in strengthening interdepartmental socialization and making the organization one big family. As a result, the shared assumptions, values, and beliefs of the organization get enhanced to propel the achievement of goals and realization of the vision.
Organizational Power Structure: Board of directors manages the facility. The executive management of the organization oversees daily operations. The chief executive officer remains the top boss responsible for all activi ...
Recommended
The Board's Evolving Role in Quality Oversight August 2015
The document discusses the evolving role of boards in overseeing healthcare quality and patient safety. It notes that healthcare in the US is undergoing transformation, with a focus on value, consumerism, and new technologies. In response, non-profit hospitals are transforming, with a greater focus on quality measurement and reporting. The document outlines the legal, regulatory, financial, and moral imperatives for boards to engage more directly in quality oversight, as well as fiduciary responsibilities and potential approaches boards can take to fulfill their quality governance role.
· Analyze how healthcare reimbursement influences your nursing pra
· Analyze how healthcare reimbursement influences your nursing practice.
Health care is significantly changing with time, and one of these changes is how health care facilities and providers are compensated for offering service. One of these ways is through reimbursement. Health care reimbursement is the payment given to a health care facility or a health care provider for offering medical service to a patient (Torrey, 2020). This cost is often covered by a patient’s health insurer or a government payer. In health care reimbursements are beneficial because they discourage DNP-prepared nurses from establishing their own independent practices. This is because at their own practices they would receive less reimbursement under their own number than under that of a physician. If the reimbursement rates were equal more DNP-prepared nurses would establish their own practices and this would increase competition.
Due to healthcare reimbursement, models that emphasize cost-effective decisions by DNP-prepared nurses are developed. These decisions are offer patients with quality medical care rather than sacrificing the patient service quality. Innovations such as price transparency tools as well as patient engagement apps help the nursing practice during the implementation of healthcare reimbursement. The patient outcome as well as the low-cost care provided by health care providers has an influence on the reimbursement received. Health care reimbursement tends to motivate health care providers because they earn more when the care they provide is of high quality as well as low cost.
DNP- prepared Nurses' role helps Nurse Practitioners to prepare for the advancement they will encounter in their nursing career in health care. This enables them to be more competent and have more knowledge when offering quality health care. The main goal of the health care reimbursement system is to pay health care providers based on their performance. This means that being more advanced and competent is beneficial for a DNP in order to provide high-quality care to patients. This simply means that if they offer high-quality care, the reimbursement will reflect this and they will be paid more. And if they are not competent, then the reimbursement will be vice versa.
2- Examine how the value-based insurance design (VBID) influences clinical outcomes and cost issues.
The aim of value-based insurance design is to increase the quality of health care while decreasing the cost by using financial incentives to promote cost-efficient health care services and consumer choices. In order to remove roadblocks as well as maintain and improve a person’s health, health benefit plans can be developed. These plans tend to save money by reducing future expensive medical procedures. They do this by covering treatments such as prescribed drugs at a low cost or no cost, preventive care as well as wellness visits (Lexchin, 2020).
The healthcare industry is making a shif ...
Student Response #1The domain that I believe to be the most si.docx
The document discusses the Donabedian model for evaluating healthcare quality, which consists of structure, process, and outcomes. The author argues that the process domain is the most significant because it directly relates to how patients are treated and cared for. Processes like diagnosis, treatment and education have a large impact on patient recovery, satisfaction and outcomes. While all three domains are important, the processes of care delivery are most crucial for ensuring quality. The document also notes that composite measures are now commonly used in addition to the three traditional domains to evaluate overall quality of care.
1 6EXECUTIVE SUMMARYJessica RamosCapella
This document provides an executive summary of a nursing leadership paper addressing quality and safety issues. It discusses medication errors as a systematic problem that can harm patients and impact healthcare providers and organizations. The author recommends strategies to minimize errors such as establishing a safety culture and acknowledging that humans are fallible. As a nursing leader, the author will work to identify gaps, improve outcomes through evidence-based practices, and address systematic issues and their impacts.
1 6EXECUTIVE SUMMARYJessica RamosCapella
1
6
EXECUTIVE SUMMARY
Jessica Ramos
Capella University
NURS-FPX6212: Health Care Quality Safety Management
Dr. Mary Ellen Cockerham
August 18, 2021
Executive Summary
Medication error being a systematic problem is not a new case. It is something that nurses and other healthcare providers have experienced. The error could be a result of recurring issues of just human error. It could also lead to more severe injuries where the patient could find themselves with a new condition such as itching rashes or skin problems that could either be temporary or permanent. These medication errors could even lead to death in some cases, significantly hurting the patient's family, especially when they know that the death of their loved one could have been prevented. It could make the healthcare provider responsible for the error start doubting themselves and start feeling guilty and ashamed for the action. It could even lead to depression throughout their life. If the deceased's family decides to file a lawsuit against the nurse or the one who was responsible, it could result in them losing their license. Medication errors can also impact the hospital where the healthcare provider is working, and patients even lose trust in the kind of treatment offered in that hospital. The occurrence of medication errors could cause the organization not to achieve its goals and objectives of providing quality care to patients for better results. Since human is to error, a medication error of not greater than 5% is allowed, but currently, it is at 39.5% (Barker et al. 2020)
As a nursing leader, I would recommend using various strategies to help minimize the occurrence of such medication errors in the future. The management should make it their responsibility to establish a safety culture and constantly report the current system and how it is performing. Healthcare providers should understand that humans are to error, and no one is to be blamed or receive a harsh form of punishment. The healthcare provider responsible for the medication error should acknowledge their mistake and report to the nursing leaders or the supervisor in charge to ensure patient safety before things get worse.
Nursing is a vital profession in the healthcare sector, mainly concerned with providing quality care to individuals and families. However, it has been discovered that there is a gap between the expected outcomes and the actual results. As a nursing leader, I will present the matter before other executive leaders to ensure care has been improved. Even though care is the primary concern of nurses, other healthcare providers should also work to ensure quality and safety outcomes. It is the responsibility of every individual in the organization. They should ensure to utilize evidence-based information and apply this knowledge to assess the ability of the entire organization to provide evidence-based care delivery. I will also look at systematic problems and specific medication e ...
MHA6999 SEMINAR IN HEALTHCARE CASES-- WEEK 2 LECTURE, DISCUSSION,
MHA6999 SEMINAR IN HEALTHCARE CASES-- WEEK 2 LECTURE, DISCUSSION, AND PROJECT INSTRUCTIONS
Page | 1
Quality
Nearly fifteen years ago, the Institute of Medicine published the “To Err Is Human” report, which exposed the substantial impact of medical errors in the US healthcare system and called for a dramatic system change, including an improved understanding of those errors (McCarthy, Tuiskula, Driscoll, & Davis, 2017). Medical errors are considered to be failure to achieve the original goal or plan of action, and these errors may range from a patient falls to a mistake in the operating room. Not only do medical errors cause harm to the patient and jeopardize the patient’s trust, but they also cause a financial strain for the health system (“To Err is Human,” 1999). One of the contributing factors to medical errors is the lack of effective communication between doctors who are treating the same patient. This results in healthcare providers overprescribing medications for patients as well as increases the possibility of a patient having unnecessary tests or procedures performed. The report’s four-tiered approach includes:
· Focusing on creating a stronger foundation of education on patient safety
· Mandating a nationwide reporting system to encourage timely reporting of errors
· Increasing the standards of performance for healthcare providers
· Taking advantage of the security that safety systems offer (“To Err is Human,” 1999)
Creating a strong educational foundation for patient safety is most important. Healthcare personnel are much more likely to actively participate in reporting systems, encourage one another to perform at a higher level, and take advantage of safety systems when they are well educated on patient safety and the implications of medical errors. The reporting system seems to provide the least amount of impact on patient safety as they can result in losing patient trust in certain healthcare systems. The healthcare system as a whole has made progress in establishing a safe environment for patients when they are in need of care.
Challenges for Patient Safety and Steps for Improvement
Despite continuing evidence of problems in patient safety and gaps between the care that patients receive and the evidence about what they should receive, efforts to improve quality in healthcare show mostly inconsistent and patchy results.
Tap each image to know more.
Data Collection and Monitoring Systems
This always takes much more time and energy than anyone anticipates. It is worth investing heavily in data from the outset. Assess local systems, train people, and have quality assurance.
Tribalism and Lack of Staff Engagement
Overcoming a perceived lack of ownership and professional or disciplinary boundaries can be very difficult. Clarify who owns the problem and solution, agree roles and responsibilities at the outset, work to common goals, and use shared language.
Convince People That There's a Problem
Use hard data to secure emotional e ...
Increased Awareness Concerning Patient.docx
This document discusses the need for increased patient safety in the U.S. healthcare system. It notes that medical errors have increased significantly in recent decades. While suggestions have been made to improve policies, procedures, and oversight, leadership within individual organizations will be key to implementing new patient safety protocols. Research is also needed to better understand errors and develop solutions. A focus on leadership, data, education, and continuous improvement can help healthcare organizations strengthen patient safety standards over time.
Running head HEALTHCARE1HEALTHCARE3
Running head: HEALTHCARE 1
HEALTHCARE 3
Healthcare
Yahima Montero
Chamberlain University
NR 534 Weeek 5
Healthcare
The Analysis
The paper explores and analyses how the culture and climate of at my workplace, Cleveland Hospital influence the provision of quality care services. The creation of a sustainable healthcare work environment in which workers and patients feel engaged, loyal, and satisfied remain as priorities of any organization. My organization culture makes the broader construct that covers every aspect of employees at work. The climate within the organization involves our shared perceptions among employees on the organization’s procedures, practices, policies, and the nature of the rewarding system. The summary of the assessment findings on my organization’s physical environment, organizational power and structure, social environment, environmental safety, professional and personal support, organizational communication, and organizational taboos form the critical aspects of the paper.
Cleveland Hospital Organizational Culture and Climate Analysis
Summary of Assessment Findings
Physical Environment: How I experience the work environment at any given time, how it feels to work in the organization and to perform in the organization’s culture influences my mood. Within the facility, families visiting their patients have a well-furnished waiting bay with television in which they first rest before being allowed to see their patients. Those with cars can access marked parking lots that are enough. Since the organization is Christian-based, it has a chapel in which patients’ families can gather and pray for their loved ones undergoing medical treatment.
Environmental Safety: As workers, we share values and beliefs that influence our behavior within the organization. It is through these share aspects in which the organization has identified to provide safety measures since the organization believes that healthy workers are essential assets in performance. As a result, environmental safety measures such as safety stickers on elevators, stairwells, passageways, and hallways are maintained. These stickers remind workers and other people that safety at the workplace is critical and that they should observe safety measures.
Social Environment: The organization has maintained its annual event at the end of the year in which all workers and other senior employees converge to celebrate the achievements of that year. These internal social events have helped in strengthening interdepartmental socialization and making the organization one big family. As a result, the shared assumptions, values, and beliefs of the organization get enhanced to propel the achievement of goals and realization of the vision.
Organizational Power Structure: Board of directors manages the facility. The executive management of the organization oversees daily operations. The chief executive officer remains the top boss responsible for all activi ...
Peers Response to --- How do you see current trends and changes in.docx
Peers Response to --- How do you see current trends and changes in healthcare models impacting the delivery of healthcare? Consider the impact of these trends on your own practice setting. Also consider how these trends and changes have impacted your own leadership style or your supervisor’s leadership style.
Taimi Dudley posted Subscribe
My name is Taimi (pronounced ty-mee). I have worked as a registered nurse with an associate of science degree for over 24 years. Across these years, I have practiced nursing in the states of New Jersey, Pennsylvania, and my home state of Massachusetts, to which I returned two years ago. When I graduated from a hospital-based nursing program, I took a job as a Post-Acute/Rehab Care staff nurse. After two years as a staff nurse, I was promoted to a clinical management position in a Post-Acute Care (PAC) facility. Since then, I have worked in a variety of milieus, including both free-standing and hospital-based facilities and served as a corporate nurse, a traveling nurse, and a private consultant. My nursing specialty has grown exponentially over the years. My role now encompasses reporting to many governmental agencies, on both a state and federal level, and most recently, I am involved in mandated Quarterly Reporting Program (SNF QRP). I am currently working as a Regional Clinical Reimbursement Specialist for a major Post-Acute Care Company.
I have been in the healthcare field since I was a junior in high school, working as a candy striper, certified nursing assistant, and home health aide before becoming an RN. So, I have been both exposed to and used critical thinking for a lot of years. Nevertheless, I am excited to broaden my understanding, experience, and critical thinking skills with new and fresh information on the best practices approach of nurse leaders in today's healthcare environment.
How do you see current trends and changes in healthcare models impacting the delivery of healthcare? In the recent past, the fee for service healthcare trend generated money through the volume of patients or census levels and viewed the patient as a source of revenue. Whereas, the new trend of value-based healthcare has changed healthcare, particularly in my industry of post-acute care. Our patients have now become an expense versus a source of revenue. This change has made it necessary for different types of healthcare providers to stop working in silos and instead communicate and collaborate with care providers across the continuum. Each provider will need to leverage each other’s strengths to provide the best possible outcomes for the patient. Also, with this new value-based payment model system, providers, and doctor’s need to begin to see cradle to grave care within a fixed premium payment.
What is the impact of these trends on your own practice? These emerging trends are having an impact on my industry by implementing electronic medical records (EMR), nurses now char ...
1 day agoBenjamin Proffitt Discussion 7COLLAPSETop of Fo
1 day ago
Benjamin Proffitt
Discussion 7
COLLAPSE
Top of Form
Job Oppurtunities
Indirect care settings are defined as services that are related to patient care but do not require interactions between the healthcare provider and the patient. There is a vast amount of jobs and professions related to Indirect care that make this an extremely explosive market for those seeking to join the medical field. Indirect care organizations are organizations such as pharmaceutical companies, insurance carriers, health information technologists and many more. Job oppurtunities for those seeking a degree and employment in the field of health care administration could seek out jobs in these fields to include the Director of Quality control, the chief executive officer, the chief financial officer etc. These positions are extremely impactful on the product and services these organizations provide and allow them to better support direct care facilities in providing safe, quality patient care with the latest and most up to date services and technologies. While ultimately, all companies are seeking to make profits in order to enhance their company and pay their employees it is important to look at how indirect care supports direct care oganizations.
Correleation
Although not directly involved in the intracicies of patient care, there is a direct correleation to the work done in indirect care facilities with direct care facilities. One of the most major sector of indirect care, and likely the fastest growing is the field of Healthcare Information Technology. Healthcare information technology or HIT is defined as “the application of information processing involving both computer hardware and software that deals with the storage, retrieval and use of healthcare information, data, and knowledge for communication and decision making.” (Alotaibi & Frederico., 2017). One way that healthcare technology influences direct care organizations is through the use of automated reminders and alerts in computers that support clinicians and support staff with safety nets in the clinical decision making process. For example, hard stops in Electronic health records, which are stops implemented that cause a user to address the issue at hand before continuing with care have been shown to decrease prescription errors by 22% (Feldman et al., 2018).
Another major implementation that Healthcare information technology has implemented is the development of the Electronic Health Record. The electronic health record has been a major introduction in the world of healthcare that has improved the quality of care, patient outcomes, safety and reduced medication errors, redundant testing, and improved overall communication between providers. With their creation, medical organizations that participate in direct care have been able to significantly increase their productivity, abandon old outdated and dangerous paper charting and have been provi ...
1 day agoBenjamin Proffitt Discussion 7COLLAPSETop of Fo
1 day ago
Benjamin Proffitt
Discussion 7
COLLAPSE
Top of Form
Job Oppurtunities
Indirect care settings are defined as services that are related to patient care but do not require interactions between the healthcare provider and the patient. There is a vast amount of jobs and professions related to Indirect care that make this an extremely explosive market for those seeking to join the medical field. Indirect care organizations are organizations such as pharmaceutical companies, insurance carriers, health information technologists and many more. Job oppurtunities for those seeking a degree and employment in the field of health care administration could seek out jobs in these fields to include the Director of Quality control, the chief executive officer, the chief financial officer etc. These positions are extremely impactful on the product and services these organizations provide and allow them to better support direct care facilities in providing safe, quality patient care with the latest and most up to date services and technologies. While ultimately, all companies are seeking to make profits in order to enhance their company and pay their employees it is important to look at how indirect care supports direct care oganizations.
Correleation
Although not directly involved in the intracicies of patient care, there is a direct correleation to the work done in indirect care facilities with direct care facilities. One of the most major sector of indirect care, and likely the fastest growing is the field of Healthcare Information Technology. Healthcare information technology or HIT is defined as “the application of information processing involving both computer hardware and software that deals with the storage, retrieval and use of healthcare information, data, and knowledge for communication and decision making.” (Alotaibi & Frederico., 2017). One way that healthcare technology influences direct care organizations is through the use of automated reminders and alerts in computers that support clinicians and support staff with safety nets in the clinical decision making process. For example, hard stops in Electronic health records, which are stops implemented that cause a user to address the issue at hand before continuing with care have been shown to decrease prescription errors by 22% (Feldman et al., 2018).
Another major implementation that Healthcare information technology has implemented is the development of the Electronic Health Record. The electronic health record has been a major introduction in the world of healthcare that has improved the quality of care, patient outcomes, safety and reduced medication errors, redundant testing, and improved overall communication between providers. With their creation, medical organizations that participate in direct care have been able to significantly increase their productivity, abandon old outdated and dangerous paper charting and have been provi ...
How Does U.S. Health Care Quality Compare Internationally?
The document compares the quality of health care in the United States to other developed countries. It discusses several key findings:
1) Life expectancy in the US is lower than average among developed countries, though it is above the OECD average at age 65. The US also has higher rates of "amenable mortality" - deaths that could potentially be prevented by health care.
2) Studies of specific health conditions have found mixed results, with the US performing better than peers for some conditions but worse for others. International comparisons of health care quality are limited by differences in data collection across countries.
3) Available evidence suggests opportunities for the US to improve quality in areas like prevention and management of chronic diseases, where access
Professional Advocate Helps Interpret.docx
Health advocacy refers to ensuring access to quality healthcare and includes coordinating care, interpreting medical information, and navigating the healthcare system. Professional advocates often have clinical or administrative backgrounds and help coordinate care among providers, interpret test results and treatments, and negotiate costs. Personal advocates like family and friends provide emotional support, help patients understand medical information, and assist with tasks like managing medications. Nurses and other healthcare professionals can also advocate through political avenues like supporting laws and regulations that improve healthcare quality and systems.
Professional Advocate Helps Interpret.docx
Health advocacy refers to ensuring access to quality healthcare and includes coordinating care, interpreting medical information, and navigating the healthcare system. Professional advocates often have clinical or administrative backgrounds and help coordinate care among providers, interpret test results and treatments, and negotiate costs. Personal advocates like family and friends provide emotional support, help patients understand medical information, and assist with tasks like managing medications. Nurses and other healthcare professionals can also advocate on a political level by supporting policies that enhance care quality and patient rights.
L m care-delivery_models
The document discusses several models of health and wellness including Leavell and Clark's Agent-Host-Environment Model, Dunn's Levels of Wellness, and the Health Locus of Control Model. It also examines the Health Belief Model and profiles 24 innovative care delivery models identified by the Robert Wood Johnson Foundation that focus on improving quality, satisfaction and reducing costs. Reasons for the nursing shortage include the pressures of cost containment, need for increased services and frustration with inefficient priorities that prevent nurses from practicing to their full abilities.
Running Head STRATEGIC ALLIANCE 1STRATEGIC AL.docx
Running Head: STRATEGIC ALLIANCE 1
STRATEGIC ALLIANCE3
Strategic Alliance in Health Care
Strategic alliance in health care arises about with accountable care in organization as related reforms aims to increase coordination between health care providers. Due to the uneven nature of health care system. Strategic alliance in health care along with successful coordination will pivot in large part on the ability of health care organization to successful partner across organizational boundaries. Furthermore, under Medicare partnership accountable care organization has lower quality enactment. This is arrived at by the use of qualitative interviews released that providers are motivated to partner for resource complementarity, risk lessening and legislative requirements. By way of conjointly bringing together official as well casual responsibility device. Strategic alliance in health care may provide an important window to screen a potential wave of health care consolidation or in contrast new models of independent providers’ successfully coordinating patient care.
There has been development in the number of physicians joining the practices and physician practice joining hospital and health care system. As result coordination of clinical care often requires working transversely in organizational boundaries. This is predominantly true when providing care to intricate or high need patients who often require attention for post- acute care facilities such as skilled nursing facilities, rehabilitation centers and home health agencies strategic alliance in health care aims to encourage coordinating through financial incentive and rewards for meeting quality performance targets and total cost of care benchmarks. With required dynamic trust of association. So as to meet desired cost and quality objective. Strategic alliance in health care is recognized arrangements between two or more independent organization to succeed shared or harmonious goals. This is substantial growth in such relationships in health care sector. Notably, these arrangements between autonomous organizations are non-ownership relation based. The primary motivation for this strategic alliance in health lie in understanding needs for resources and capabilities needs to frontier transaction cost and the need to respond to external requirements from Medicare. The benefit of the strategic alliance in health care contribution risk or gaining resources, personnel benefits including improved staffing and management capabilities and organization benefits including growth, opportunities to learn and gain new proficiencies and mutual support and group collaboration.
Numerous methods have been used hence mixed method analysis which involves survey data, performance data, and semi-structured interviews. Questions examined involved to what range is strategic alliance in health benefit to the health sector organization, second how is strategic alliance performance in different organ.
Building Patient-Centeredness in the Real World: The Engaged Patient and the ...
This paper examines the separate but intertwined ethical, economic and clinical concepts of patientcenteredness and how ACOs provide a structure for turning those concepts into a functioning reality.
Respond to 2 students DQ 275 words and 1 reference eachOriginal .docx
Respond to 2 students DQ 275 words and 1 reference each
Original DQ... DUE 6-15-2016 7:00 p.m EST
Explain the difference between
pre
-service, point-of-service, and after-service. What elements are central to each? Provide an example of how an organization might create a competitive advantage in each of these areas...
(REMINDER) IN HEALTHCARE
Additional Topics (Team Meetings in a clinic) (Quality Improvement in Health Care) (National Health care Quality)
Student 1
he elements of p
re-service, point of service, and after service are
crucial
elements
in all lines of business. It is important for a business to
continuously
create an
experience
for the client in all stages of service. These stages are essential in not only
ensuring
organizational success but also ensuring that customer satisfaction is upheld. The largest factor In how successful an organization is depend on how happy their consumer base is with the experience received, prior to, during, and after the services were
comple
ted
. According an article in
Forbes
Magazine
, Customer
experience
has reached a level in which it is now more important than the products being sold and can even be a key factor in the marketing of a brand. (Newman, n.d.)
Pre
service care pertains to all planning stages of the organization.
This encompasses all aspects from
marketing, products and services provided, market research, understanding the client base as well as the area in which the products are to be provided. This is one of, if not, the most important
aspect of these elements. It is not only important to ensure that the products and or services provided are of the highest quality, but also that there is a need for them. This idea of a
competitive
advantage is a key
factor in the success of an organization and this is when the
pre
service planning come into play. According to the article
Startup Location Is Still A Critical Success Factor:
"
Even in this age of
globalization
and
virtualization
, the geographic area where you choose to live and work can still make or break your startup business."(
Zwilling
,
n.d.)
Meaning that it is important for a company to understand the market in which they
w
ish
to serve in order to assure that they are serving the correct client base and remain
competitive
in their market
.
P
oint
of service could translate to p
ost
service care which pertains to the care received at the time the patient is seen. This is reflected in the customers satisfaction with the experience received, a direct reflection of the customer service as well as the
techniques
that are used. Quality of care
provided by
healthcare
professionals, a
nd
thus
received
by patients, can be a make or break factor in the success of a firm. According to
Quality of Care Information Makes a
Difference,
"Quality
report cards are becoming increasingly more common and receive much publicity. They can have significant impact on competition among prov.
SWOT Analysis TemplateRemove or Replace Header Is Not Doc Tit
SWOT Analysis Template
Remove or Replace: Header Is Not Doc TitleSWOT AnalysisStrengthsWeaknessesOpportunitiesThreats
1
2
Running head: IMPACT REPORT TO SENIOR LEADERSHIP 1
Copyright ©2017 Capella University. Copy and distribution of this document are prohibited.
Impact Report to Senior Leadership
Learner’s Full Name
Capella University
Organizational and Systems Management for Quality Outcomes
Impact Report to Senior Leadership
May, 2017
IMPACT REPORT TO SENIOR LEADERSHIP 2
Copyright ©2017 Capella University. Copy and distribution of this document are prohibited.
Impact Report to Senior Leadership
Nurse leaders play an important role in guiding nursing professionals to achieve a health
care organization’s quality and safety standards—standards that should help patients receive
high-quality care without negative outcomes on their health. Despite efforts to maintain these
standards, health care organizations across the United States of America have witnessed an
increase in the number of poor patient outcomes (that stem from unsafe care. According to the
Quality Interagency Coordination Task Force, the consequences of quality and safety issues in
patients have amounted to an annual loss of $29 billion (Huber, 2017).
The importance of maintaining patient safety standards in health care will be explored
based on the challenges faced by a well-known nursing facility in the United States of America.
Located in a major city, the facility provides 24-hour residential care to the elderly and people
with special needs who require customized care. The facility has been facing patient safety issues
connected to how its nursing professionals administer treatment and monitor patients.
Patient Safety as a Nursing Challenge in the Nursing Facility
Nursing professionals are the primary caregivers in any health care setting; they spend
the most time with patients as they administer treatment, detect signs of deterioration in patients,
and build caring relationships with them. Therefore, safety issues that cause any negative
outcomes in their patients can affect nursing professionals emotionally and hinder their career
development (Lawton, Carruthers, Gardner, Wright, & McEachan, 2012; Huber, 2017).
The nursing facility encountered safety issues caused by nurses when administering
medicines, patients falling or injuring themselves because of nursing negligence. These issues
Comment [A1]: Nice job identifying the
challenge of providing patient safety care
measures. Good inclusion of how unsafe
practices leads to emotional and decreased
career development in nurses as well as the
impact of sentinel events for the organization.
You stated that patients are negatively
impacted and could further explain what is
meant by that.
IMPACT REPORT TO SENIOR LEADERSHIP 3
Copyright ©2017 Capella University. Copy and distribution of this document are prohibited.
are call ...
APRN Case Study
This document summarizes an interview with a registered nurse (RN) about safety, quality, and leadership in nursing. The RN discussed their role in educating patients and families, collaborating with an interdisciplinary care team, and building team cohesion despite a lack of formal team-building exercises. The nurse emphasized the importance of communication within the care team to monitor patient changes.
DQ1Sierra CossanoMy change proposal is being implemented in th
DQ1
Sierra Cossano
My change proposal is being implemented in the ICU. The intervention is implementing communication tools and processes that are evidence based to improve nursing sensitive indicators in the ICU. The internal stakeholders are the ICU staff and the hospital. The external stakeholders are the community that is served by the hospital. Our hospital works off of a relationship-based care (RBC) model. RBC is a culture transformation model and an operational framework that improves safety, quality, patient satisfaction, and staff satisfaction by improving every relationship within an organization (Gallison & Kester, 2018). The core of workforce engagement is the reignighting of joy and meaning for nurses. The joy and satisfaction in having a sense of accomplishment and significance in the work through processes leading to successful outcomes. RBC speaks to how we treat patients, family, and each other. Internal stakeholders all work off this model in this organization. However, covid greatly challenged relationship based care principles by limiting how we interact with each other and our patient families. That in person piece is missing for many patients still. In this organizational transition back to pre-covid practices, meetings, and policies staff are looking for guidance to unify and strengthen the workforce. It is a good segway into external stakeholders. Our nurses and other staff are also members of the community served by the hospital. Therefore, the internal stakeholders all face the real fact that they too receive their care here and have an interest in the quality of care provided. This community funded hospital has been influenced by local donors, architects and artists. Donors play a large role in celebrating the staff and creating this sense of meaning and significance for hospital staff. In a relationship based care model, these gestures serve a huge purpose and allow the hospital to recognize staff in unique ways. The positive factor here is that the nurses have come out of this powerless feeling covid left them with. Small gestures that build trust between nursing and management create a more productive work environment. This is done through clear concise communication, open discussion, and acting on feedback from staff.
Gallison, B., & Kester, W. T. (2018). Connecting Holistic Nursing Practice With Relationship-based Care: A Community Hospital’s Journey. Nurse Leader, 16(3), 181–185. https://doi-org.lopes.idm.oclc.org/10.1016/j.mnl.2018.03.007
DQ1
Virginia Gallardo
Stakeholder involvement is crucial for the successful implementation of the change proposal project. Stakeholders are those who are interested in the change proposal project, such as nurses, patients, and suppliers. They can affect or be affected by the organization's actions, objectives, and policies (Lubbeke et al., 2019). We must assess our work environment to identify all relevant stakeholders. Failure to do so can negatively affect the project ...
Essay About Quality
Quality Assurance Essay
Essay about Data Quality
Essay on Quality Health Care
Essay on Providing Quality Patient Care
What is quality Essay
Essay about My Quality World
Essay On Healthcare Quality
Quality Management Essay
Quality Control
SOPWhitePaperandCrosswalk_final
The document discusses care coordination and the role of case managers. It notes that care coordination is important for improving quality of care during transitions, reducing costs from unnecessary readmissions and medical errors. The Case Management Society of America (CMSA) has established Standards of Practice to define qualifications and guidelines for care coordinators to improve patient outcomes and compliance. The document advocates for these standards to bring uniformity to care coordination roles and help address issues during a time of healthcare reform that is focusing on care coordination.
Why It Is Imperative to Ensure Transparency in the Healthcare Sector
Why It Is Imperative to Ensure Transparency in the Healthcare SectorMedical Transcription Service Company
Transparency is vital for quality care and informed decision making and it begins with accurate medical records provided by medical transcription services.
5 723.docx
Nurses play an important role as patient advocates by promoting patient autonomy, informing decision making, and supporting patients. As advocates, nurses must understand patients' needs, values, and interests and help translate medical information. Effective advocacy also involves influencing broader health policies and systems. Nurses need to expand patient advocacy beyond individual patients to address systemic issues influencing health. The COVID-19 pandemic has highlighted nurses' role in advocating for patients and promoting health while also facing challenges such as staffing shortages, risk of infection, and burnout.
Closing the Gap Toward a Culture of Safety
In its landmark 1999 publication, To Err Is Human, the Institute of Medicine defined patient safety as “freedom from accidental injury.” In 1999, estimated deaths from medical errors in United States hospitals were 98,000 per year thus the expectation to be free from accidental injury was more than a reasonable expectation for those accessing the health care system.
Patient And Family Centered Care Essay
Patient and family centered care is a model that places the patient and family at the center of the healthcare team. It aims to include patients and families in decision making by providing education so they are well informed. This model focuses on individualizing care according to a patient's needs, values and preferences. Several healthcare disciplines are involved in ensuring patient and family centered care is provided. Key aspects include collaboration, leadership, and cultural competency among the healthcare team.
Emma logsdon· 4· 5 the six challenges for resigning health c
The document discusses six key challenges for healthcare organizations undergoing redesign: (1) redesigning care processes, (2) incorporating performance measurements, (3) managing clinical knowledge and skills, (4) making effective use of information technologies, (5) coordinating care across settings, and (6) developing effective teams. The author believes redesigning care processes is the most important challenge because it impacts all the others. Other top challenges include incorporating performance measurements, managing clinical knowledge, and using information technologies effectively. The author argues that addressing these challenges will help healthcare organizations provide better, more efficient care.
1. Use Postman” to test API at httpspostman-echo.coma. Use
1. Use “Postman” to test API at https://postman-echo.com/
a. Use GET, POST, PUT, DELETE methods
b. Use global variables
c. Create test script
d. Import any API from other websites
2. Try to use “Rest Assured” Library to test API at https://reqres.in/ (only for GET and POST methods)
Upload screenshots to the system.
Identifying Data & Reliability
Ms. Jones, a 28-year-old African American
female , is present into the hospital beacuse
of an infected wound on her foot. Her
speech is clear and concise and well-
structured. Throughout the interview, she
maintain eye contact while freely sharing
information.
N/A
General Survey
Ms. Jones is stting upright on the exam
table, alert and oriented x3, friendly and well
nourished. She is calm and appropriately
dressed for the weather.
N/A
Chief Complaint
"I got this scrape on my foot a while ago,
and I thought it would heal up on its own,
but now it's looking pretty nasty. And the
pain is killing me!"
N/A
History Of Present Illness
One week ago, Ms. Tina was going down
her steps with no shoes and stumbled
scratching her right foot on the edge of the
step and was taken to the emergency room
by her mother where an x-ray was
performed and the site showed no
abnormality. They cleaned her injuries and
Tremadol was reccomended for pain and
she was told to remain off of her foot and to
keep it very clean and dry at all times as she
was realeased home. her foot became
swollen 2 days aglo as the pain exacerbated
and she saw grayish whte pus draining from
the wound and that is when she started
taking Tramadol. She rated her agony of
pain as a 7 out of 10 on her wounded foot
nevertheless; she says it emanates to her
whole foot and that there was drainage
initially when the episode previoulsy began.
Ms. Tina has been cleaning the injury with
cleanser and soap and applying Neosporin
to the wound two times each day and
occasionaly applied peroxide. The pain was
depicted as throbbing and very still and
sometimes sharp shooting pain or torment
when she puts weight on her foot. She can
not accomadate her tennis shoes on her
right foot so she had been wearing flip
tumbles or slippers everyday. The pai pills
have eased the excruciating pain for few
hours and she reported having fever. She
has lost 10 pounds in barley a month
accidentally and has work for two days as
she reported. She denied any ongoing
sickness and feels hungrier than expected.
Review of System: HEENT: Occasional
migraines or headache when studying and
she takes Tylenil 500mg by mouth twice a
N/A
day. Ms. Tina reports more awful vision in
the course of recent months ands no
contact or restorative lenses. She denies
any congestions, hearing problem or soar
throat however, she admits infrequent
running nose. Neurological: Occasional
migrain revealed, no dizziness, syncope,
loss of motivation, ataxia, loss of tingling in
her extremities or furthest point.
Respiratory: No brevity or shortness of
breath, hac k or cough or sputum.
Cardiovasc ...
1. Use the rubric to complete the assignment and pay attention t
1. Use the rubric to complete the assignment and pay attention to the points assigned to each section of the paper.
2. Use the format of the paper to organize your paper.
3. Use the samples of essay critiques as guidelines when completing this assignment.
4. Students are asked to critique Jules Ferry’s French Colonial Expansion, not to write a paper about Jules Ferry.
5. Identify a fact (see rubric) means that you take a sentence or paragraph in the assigned reading that you find very interesting and cite it as highlighted in yellow in the samples of primary papers and analyze it. In other words, you come up with your own interpretation of that fact.
6. Do not summarize the five facts but instead quote them as written in the assigned reading and highlighted in yellow in the samples of papers.
Jules Ferry (1832-1893):
On French Colonial Expansion
Ferry was twice prime minister of France, from [1880-1881, 1883-1885]. He is especially remembered for
championing laws that removed Catholic influence from most education in France and for promoting a vast extension
of the French colonial empire.
The policy of colonial expansion is a political and economic system ... that can be connected to three sets of ideas:
economic ideas; the most far-reaching ideas of civilization; and ideas of a political and patriotic sort.
In the area of economics, I am placing before you, with the support of some statistics, the considerations that justify
the policy of colonial expansion, as seen from the perspective of a need, felt more and more urgently by the
industrialized population of Europe and especially the people of our rich and hardworking country of France: the need
for outlets [for exports]. Is this a fantasy? Is this a concern [that can wait] for the future? Or is this not a pressing
need, one may say a crying need, of our industrial population? I merely express in a general way what each one of
you can see for himself in the various parts of France. Yes, what our major industries [textiles, etc.], irrevocably
steered by the treaties of 18601 into exports, lack more and more are outlets. Why? Because next door Germany is
setting up trade barriers; because across the ocean the United States of America have become protectionists, and
extreme protectionists at that; because not only are these great markets ... shrinking, becoming more and more
difficult of access, but these great states are beginning to pour into our own markets products not seen there before.
This is true not only for our agriculture, which has been so sorely tried ... and for which competition is no longer
limited to the circle of large European states.... Today, as you know, competition, the law of supply and demand,
freedom of trade, the effects of speculation, all radiate in a circle that reaches to the ends of the earth.... That is a
great complication, a great economic difficulty; ... an extremely serious problem. It is so serious ...
More Related Content
Similar to 1. Integrity, the basic principle of healthcare leadership.Conta
Peers Response to --- How do you see current trends and changes in.docx
Peers Response to --- How do you see current trends and changes in healthcare models impacting the delivery of healthcare? Consider the impact of these trends on your own practice setting. Also consider how these trends and changes have impacted your own leadership style or your supervisor’s leadership style.
Taimi Dudley posted Subscribe
My name is Taimi (pronounced ty-mee). I have worked as a registered nurse with an associate of science degree for over 24 years. Across these years, I have practiced nursing in the states of New Jersey, Pennsylvania, and my home state of Massachusetts, to which I returned two years ago. When I graduated from a hospital-based nursing program, I took a job as a Post-Acute/Rehab Care staff nurse. After two years as a staff nurse, I was promoted to a clinical management position in a Post-Acute Care (PAC) facility. Since then, I have worked in a variety of milieus, including both free-standing and hospital-based facilities and served as a corporate nurse, a traveling nurse, and a private consultant. My nursing specialty has grown exponentially over the years. My role now encompasses reporting to many governmental agencies, on both a state and federal level, and most recently, I am involved in mandated Quarterly Reporting Program (SNF QRP). I am currently working as a Regional Clinical Reimbursement Specialist for a major Post-Acute Care Company.
I have been in the healthcare field since I was a junior in high school, working as a candy striper, certified nursing assistant, and home health aide before becoming an RN. So, I have been both exposed to and used critical thinking for a lot of years. Nevertheless, I am excited to broaden my understanding, experience, and critical thinking skills with new and fresh information on the best practices approach of nurse leaders in today's healthcare environment.
How do you see current trends and changes in healthcare models impacting the delivery of healthcare? In the recent past, the fee for service healthcare trend generated money through the volume of patients or census levels and viewed the patient as a source of revenue. Whereas, the new trend of value-based healthcare has changed healthcare, particularly in my industry of post-acute care. Our patients have now become an expense versus a source of revenue. This change has made it necessary for different types of healthcare providers to stop working in silos and instead communicate and collaborate with care providers across the continuum. Each provider will need to leverage each other’s strengths to provide the best possible outcomes for the patient. Also, with this new value-based payment model system, providers, and doctor’s need to begin to see cradle to grave care within a fixed premium payment.
What is the impact of these trends on your own practice? These emerging trends are having an impact on my industry by implementing electronic medical records (EMR), nurses now char ...
1 day agoBenjamin Proffitt Discussion 7COLLAPSETop of Fo
1 day ago
Benjamin Proffitt
Discussion 7
COLLAPSE
Top of Form
Job Oppurtunities
Indirect care settings are defined as services that are related to patient care but do not require interactions between the healthcare provider and the patient. There is a vast amount of jobs and professions related to Indirect care that make this an extremely explosive market for those seeking to join the medical field. Indirect care organizations are organizations such as pharmaceutical companies, insurance carriers, health information technologists and many more. Job oppurtunities for those seeking a degree and employment in the field of health care administration could seek out jobs in these fields to include the Director of Quality control, the chief executive officer, the chief financial officer etc. These positions are extremely impactful on the product and services these organizations provide and allow them to better support direct care facilities in providing safe, quality patient care with the latest and most up to date services and technologies. While ultimately, all companies are seeking to make profits in order to enhance their company and pay their employees it is important to look at how indirect care supports direct care oganizations.
Correleation
Although not directly involved in the intracicies of patient care, there is a direct correleation to the work done in indirect care facilities with direct care facilities. One of the most major sector of indirect care, and likely the fastest growing is the field of Healthcare Information Technology. Healthcare information technology or HIT is defined as “the application of information processing involving both computer hardware and software that deals with the storage, retrieval and use of healthcare information, data, and knowledge for communication and decision making.” (Alotaibi & Frederico., 2017). One way that healthcare technology influences direct care organizations is through the use of automated reminders and alerts in computers that support clinicians and support staff with safety nets in the clinical decision making process. For example, hard stops in Electronic health records, which are stops implemented that cause a user to address the issue at hand before continuing with care have been shown to decrease prescription errors by 22% (Feldman et al., 2018).
Another major implementation that Healthcare information technology has implemented is the development of the Electronic Health Record. The electronic health record has been a major introduction in the world of healthcare that has improved the quality of care, patient outcomes, safety and reduced medication errors, redundant testing, and improved overall communication between providers. With their creation, medical organizations that participate in direct care have been able to significantly increase their productivity, abandon old outdated and dangerous paper charting and have been provi ...
1 day agoBenjamin Proffitt Discussion 7COLLAPSETop of Fo
1 day ago
Benjamin Proffitt
Discussion 7
COLLAPSE
Top of Form
Job Oppurtunities
Indirect care settings are defined as services that are related to patient care but do not require interactions between the healthcare provider and the patient. There is a vast amount of jobs and professions related to Indirect care that make this an extremely explosive market for those seeking to join the medical field. Indirect care organizations are organizations such as pharmaceutical companies, insurance carriers, health information technologists and many more. Job oppurtunities for those seeking a degree and employment in the field of health care administration could seek out jobs in these fields to include the Director of Quality control, the chief executive officer, the chief financial officer etc. These positions are extremely impactful on the product and services these organizations provide and allow them to better support direct care facilities in providing safe, quality patient care with the latest and most up to date services and technologies. While ultimately, all companies are seeking to make profits in order to enhance their company and pay their employees it is important to look at how indirect care supports direct care oganizations.
Correleation
Although not directly involved in the intracicies of patient care, there is a direct correleation to the work done in indirect care facilities with direct care facilities. One of the most major sector of indirect care, and likely the fastest growing is the field of Healthcare Information Technology. Healthcare information technology or HIT is defined as “the application of information processing involving both computer hardware and software that deals with the storage, retrieval and use of healthcare information, data, and knowledge for communication and decision making.” (Alotaibi & Frederico., 2017). One way that healthcare technology influences direct care organizations is through the use of automated reminders and alerts in computers that support clinicians and support staff with safety nets in the clinical decision making process. For example, hard stops in Electronic health records, which are stops implemented that cause a user to address the issue at hand before continuing with care have been shown to decrease prescription errors by 22% (Feldman et al., 2018).
Another major implementation that Healthcare information technology has implemented is the development of the Electronic Health Record. The electronic health record has been a major introduction in the world of healthcare that has improved the quality of care, patient outcomes, safety and reduced medication errors, redundant testing, and improved overall communication between providers. With their creation, medical organizations that participate in direct care have been able to significantly increase their productivity, abandon old outdated and dangerous paper charting and have been provi ...
How Does U.S. Health Care Quality Compare Internationally?
The document compares the quality of health care in the United States to other developed countries. It discusses several key findings:
1) Life expectancy in the US is lower than average among developed countries, though it is above the OECD average at age 65. The US also has higher rates of "amenable mortality" - deaths that could potentially be prevented by health care.
2) Studies of specific health conditions have found mixed results, with the US performing better than peers for some conditions but worse for others. International comparisons of health care quality are limited by differences in data collection across countries.
3) Available evidence suggests opportunities for the US to improve quality in areas like prevention and management of chronic diseases, where access
Professional Advocate Helps Interpret.docx
Health advocacy refers to ensuring access to quality healthcare and includes coordinating care, interpreting medical information, and navigating the healthcare system. Professional advocates often have clinical or administrative backgrounds and help coordinate care among providers, interpret test results and treatments, and negotiate costs. Personal advocates like family and friends provide emotional support, help patients understand medical information, and assist with tasks like managing medications. Nurses and other healthcare professionals can also advocate through political avenues like supporting laws and regulations that improve healthcare quality and systems.
Professional Advocate Helps Interpret.docx
Health advocacy refers to ensuring access to quality healthcare and includes coordinating care, interpreting medical information, and navigating the healthcare system. Professional advocates often have clinical or administrative backgrounds and help coordinate care among providers, interpret test results and treatments, and negotiate costs. Personal advocates like family and friends provide emotional support, help patients understand medical information, and assist with tasks like managing medications. Nurses and other healthcare professionals can also advocate on a political level by supporting policies that enhance care quality and patient rights.
L m care-delivery_models
The document discusses several models of health and wellness including Leavell and Clark's Agent-Host-Environment Model, Dunn's Levels of Wellness, and the Health Locus of Control Model. It also examines the Health Belief Model and profiles 24 innovative care delivery models identified by the Robert Wood Johnson Foundation that focus on improving quality, satisfaction and reducing costs. Reasons for the nursing shortage include the pressures of cost containment, need for increased services and frustration with inefficient priorities that prevent nurses from practicing to their full abilities.
Running Head STRATEGIC ALLIANCE 1STRATEGIC AL.docx
Running Head: STRATEGIC ALLIANCE 1
STRATEGIC ALLIANCE3
Strategic Alliance in Health Care
Strategic alliance in health care arises about with accountable care in organization as related reforms aims to increase coordination between health care providers. Due to the uneven nature of health care system. Strategic alliance in health care along with successful coordination will pivot in large part on the ability of health care organization to successful partner across organizational boundaries. Furthermore, under Medicare partnership accountable care organization has lower quality enactment. This is arrived at by the use of qualitative interviews released that providers are motivated to partner for resource complementarity, risk lessening and legislative requirements. By way of conjointly bringing together official as well casual responsibility device. Strategic alliance in health care may provide an important window to screen a potential wave of health care consolidation or in contrast new models of independent providers’ successfully coordinating patient care.
There has been development in the number of physicians joining the practices and physician practice joining hospital and health care system. As result coordination of clinical care often requires working transversely in organizational boundaries. This is predominantly true when providing care to intricate or high need patients who often require attention for post- acute care facilities such as skilled nursing facilities, rehabilitation centers and home health agencies strategic alliance in health care aims to encourage coordinating through financial incentive and rewards for meeting quality performance targets and total cost of care benchmarks. With required dynamic trust of association. So as to meet desired cost and quality objective. Strategic alliance in health care is recognized arrangements between two or more independent organization to succeed shared or harmonious goals. This is substantial growth in such relationships in health care sector. Notably, these arrangements between autonomous organizations are non-ownership relation based. The primary motivation for this strategic alliance in health lie in understanding needs for resources and capabilities needs to frontier transaction cost and the need to respond to external requirements from Medicare. The benefit of the strategic alliance in health care contribution risk or gaining resources, personnel benefits including improved staffing and management capabilities and organization benefits including growth, opportunities to learn and gain new proficiencies and mutual support and group collaboration.
Numerous methods have been used hence mixed method analysis which involves survey data, performance data, and semi-structured interviews. Questions examined involved to what range is strategic alliance in health benefit to the health sector organization, second how is strategic alliance performance in different organ.
Building Patient-Centeredness in the Real World: The Engaged Patient and the ...
This paper examines the separate but intertwined ethical, economic and clinical concepts of patientcenteredness and how ACOs provide a structure for turning those concepts into a functioning reality.
Respond to 2 students DQ 275 words and 1 reference eachOriginal .docx
Respond to 2 students DQ 275 words and 1 reference each
Original DQ... DUE 6-15-2016 7:00 p.m EST
Explain the difference between
pre
-service, point-of-service, and after-service. What elements are central to each? Provide an example of how an organization might create a competitive advantage in each of these areas...
(REMINDER) IN HEALTHCARE
Additional Topics (Team Meetings in a clinic) (Quality Improvement in Health Care) (National Health care Quality)
Student 1
he elements of p
re-service, point of service, and after service are
crucial
elements
in all lines of business. It is important for a business to
continuously
create an
experience
for the client in all stages of service. These stages are essential in not only
ensuring
organizational success but also ensuring that customer satisfaction is upheld. The largest factor In how successful an organization is depend on how happy their consumer base is with the experience received, prior to, during, and after the services were
comple
ted
. According an article in
Forbes
Magazine
, Customer
experience
has reached a level in which it is now more important than the products being sold and can even be a key factor in the marketing of a brand. (Newman, n.d.)
Pre
service care pertains to all planning stages of the organization.
This encompasses all aspects from
marketing, products and services provided, market research, understanding the client base as well as the area in which the products are to be provided. This is one of, if not, the most important
aspect of these elements. It is not only important to ensure that the products and or services provided are of the highest quality, but also that there is a need for them. This idea of a
competitive
advantage is a key
factor in the success of an organization and this is when the
pre
service planning come into play. According to the article
Startup Location Is Still A Critical Success Factor:
"
Even in this age of
globalization
and
virtualization
, the geographic area where you choose to live and work can still make or break your startup business."(
Zwilling
,
n.d.)
Meaning that it is important for a company to understand the market in which they
w
ish
to serve in order to assure that they are serving the correct client base and remain
competitive
in their market
.
P
oint
of service could translate to p
ost
service care which pertains to the care received at the time the patient is seen. This is reflected in the customers satisfaction with the experience received, a direct reflection of the customer service as well as the
techniques
that are used. Quality of care
provided by
healthcare
professionals, a
nd
thus
received
by patients, can be a make or break factor in the success of a firm. According to
Quality of Care Information Makes a
Difference,
"Quality
report cards are becoming increasingly more common and receive much publicity. They can have significant impact on competition among prov.
SWOT Analysis TemplateRemove or Replace Header Is Not Doc Tit
SWOT Analysis Template
Remove or Replace: Header Is Not Doc TitleSWOT AnalysisStrengthsWeaknessesOpportunitiesThreats
1
2
Running head: IMPACT REPORT TO SENIOR LEADERSHIP 1
Copyright ©2017 Capella University. Copy and distribution of this document are prohibited.
Impact Report to Senior Leadership
Learner’s Full Name
Capella University
Organizational and Systems Management for Quality Outcomes
Impact Report to Senior Leadership
May, 2017
IMPACT REPORT TO SENIOR LEADERSHIP 2
Copyright ©2017 Capella University. Copy and distribution of this document are prohibited.
Impact Report to Senior Leadership
Nurse leaders play an important role in guiding nursing professionals to achieve a health
care organization’s quality and safety standards—standards that should help patients receive
high-quality care without negative outcomes on their health. Despite efforts to maintain these
standards, health care organizations across the United States of America have witnessed an
increase in the number of poor patient outcomes (that stem from unsafe care. According to the
Quality Interagency Coordination Task Force, the consequences of quality and safety issues in
patients have amounted to an annual loss of $29 billion (Huber, 2017).
The importance of maintaining patient safety standards in health care will be explored
based on the challenges faced by a well-known nursing facility in the United States of America.
Located in a major city, the facility provides 24-hour residential care to the elderly and people
with special needs who require customized care. The facility has been facing patient safety issues
connected to how its nursing professionals administer treatment and monitor patients.
Patient Safety as a Nursing Challenge in the Nursing Facility
Nursing professionals are the primary caregivers in any health care setting; they spend
the most time with patients as they administer treatment, detect signs of deterioration in patients,
and build caring relationships with them. Therefore, safety issues that cause any negative
outcomes in their patients can affect nursing professionals emotionally and hinder their career
development (Lawton, Carruthers, Gardner, Wright, & McEachan, 2012; Huber, 2017).
The nursing facility encountered safety issues caused by nurses when administering
medicines, patients falling or injuring themselves because of nursing negligence. These issues
Comment [A1]: Nice job identifying the
challenge of providing patient safety care
measures. Good inclusion of how unsafe
practices leads to emotional and decreased
career development in nurses as well as the
impact of sentinel events for the organization.
You stated that patients are negatively
impacted and could further explain what is
meant by that.
IMPACT REPORT TO SENIOR LEADERSHIP 3
Copyright ©2017 Capella University. Copy and distribution of this document are prohibited.
are call ...
APRN Case Study
This document summarizes an interview with a registered nurse (RN) about safety, quality, and leadership in nursing. The RN discussed their role in educating patients and families, collaborating with an interdisciplinary care team, and building team cohesion despite a lack of formal team-building exercises. The nurse emphasized the importance of communication within the care team to monitor patient changes.
DQ1Sierra CossanoMy change proposal is being implemented in th
DQ1
Sierra Cossano
My change proposal is being implemented in the ICU. The intervention is implementing communication tools and processes that are evidence based to improve nursing sensitive indicators in the ICU. The internal stakeholders are the ICU staff and the hospital. The external stakeholders are the community that is served by the hospital. Our hospital works off of a relationship-based care (RBC) model. RBC is a culture transformation model and an operational framework that improves safety, quality, patient satisfaction, and staff satisfaction by improving every relationship within an organization (Gallison & Kester, 2018). The core of workforce engagement is the reignighting of joy and meaning for nurses. The joy and satisfaction in having a sense of accomplishment and significance in the work through processes leading to successful outcomes. RBC speaks to how we treat patients, family, and each other. Internal stakeholders all work off this model in this organization. However, covid greatly challenged relationship based care principles by limiting how we interact with each other and our patient families. That in person piece is missing for many patients still. In this organizational transition back to pre-covid practices, meetings, and policies staff are looking for guidance to unify and strengthen the workforce. It is a good segway into external stakeholders. Our nurses and other staff are also members of the community served by the hospital. Therefore, the internal stakeholders all face the real fact that they too receive their care here and have an interest in the quality of care provided. This community funded hospital has been influenced by local donors, architects and artists. Donors play a large role in celebrating the staff and creating this sense of meaning and significance for hospital staff. In a relationship based care model, these gestures serve a huge purpose and allow the hospital to recognize staff in unique ways. The positive factor here is that the nurses have come out of this powerless feeling covid left them with. Small gestures that build trust between nursing and management create a more productive work environment. This is done through clear concise communication, open discussion, and acting on feedback from staff.
Gallison, B., & Kester, W. T. (2018). Connecting Holistic Nursing Practice With Relationship-based Care: A Community Hospital’s Journey. Nurse Leader, 16(3), 181–185. https://doi-org.lopes.idm.oclc.org/10.1016/j.mnl.2018.03.007
DQ1
Virginia Gallardo
Stakeholder involvement is crucial for the successful implementation of the change proposal project. Stakeholders are those who are interested in the change proposal project, such as nurses, patients, and suppliers. They can affect or be affected by the organization's actions, objectives, and policies (Lubbeke et al., 2019). We must assess our work environment to identify all relevant stakeholders. Failure to do so can negatively affect the project ...
Essay About Quality
Quality Assurance Essay
Essay about Data Quality
Essay on Quality Health Care
Essay on Providing Quality Patient Care
What is quality Essay
Essay about My Quality World
Essay On Healthcare Quality
Quality Management Essay
Quality Control
SOPWhitePaperandCrosswalk_final
The document discusses care coordination and the role of case managers. It notes that care coordination is important for improving quality of care during transitions, reducing costs from unnecessary readmissions and medical errors. The Case Management Society of America (CMSA) has established Standards of Practice to define qualifications and guidelines for care coordinators to improve patient outcomes and compliance. The document advocates for these standards to bring uniformity to care coordination roles and help address issues during a time of healthcare reform that is focusing on care coordination.
Why It Is Imperative to Ensure Transparency in the Healthcare Sector
Why It Is Imperative to Ensure Transparency in the Healthcare SectorMedical Transcription Service Company
Transparency is vital for quality care and informed decision making and it begins with accurate medical records provided by medical transcription services.
5 723.docx
Nurses play an important role as patient advocates by promoting patient autonomy, informing decision making, and supporting patients. As advocates, nurses must understand patients' needs, values, and interests and help translate medical information. Effective advocacy also involves influencing broader health policies and systems. Nurses need to expand patient advocacy beyond individual patients to address systemic issues influencing health. The COVID-19 pandemic has highlighted nurses' role in advocating for patients and promoting health while also facing challenges such as staffing shortages, risk of infection, and burnout.
Closing the Gap Toward a Culture of Safety
In its landmark 1999 publication, To Err Is Human, the Institute of Medicine defined patient safety as “freedom from accidental injury.” In 1999, estimated deaths from medical errors in United States hospitals were 98,000 per year thus the expectation to be free from accidental injury was more than a reasonable expectation for those accessing the health care system.
Patient And Family Centered Care Essay
Patient and family centered care is a model that places the patient and family at the center of the healthcare team. It aims to include patients and families in decision making by providing education so they are well informed. This model focuses on individualizing care according to a patient's needs, values and preferences. Several healthcare disciplines are involved in ensuring patient and family centered care is provided. Key aspects include collaboration, leadership, and cultural competency among the healthcare team.
Emma logsdon· 4· 5 the six challenges for resigning health c
The document discusses six key challenges for healthcare organizations undergoing redesign: (1) redesigning care processes, (2) incorporating performance measurements, (3) managing clinical knowledge and skills, (4) making effective use of information technologies, (5) coordinating care across settings, and (6) developing effective teams. The author believes redesigning care processes is the most important challenge because it impacts all the others. Other top challenges include incorporating performance measurements, managing clinical knowledge, and using information technologies effectively. The author argues that addressing these challenges will help healthcare organizations provide better, more efficient care.
Similar to 1. Integrity, the basic principle of healthcare leadership.Conta (20)
Peers Response to --- How do you see current trends and changes in.docx
Peers Response to --- How do you see current trends and changes in.docx
1 day agoBenjamin Proffitt Discussion 7COLLAPSETop of Fo
1 day agoBenjamin Proffitt Discussion 7COLLAPSETop of Fo
1 day agoBenjamin Proffitt Discussion 7COLLAPSETop of Fo
1 day agoBenjamin Proffitt Discussion 7COLLAPSETop of Fo
How Does U.S. Health Care Quality Compare Internationally?
How Does U.S. Health Care Quality Compare Internationally?
Running Head STRATEGIC ALLIANCE 1STRATEGIC AL.docx
Running Head STRATEGIC ALLIANCE 1STRATEGIC AL.docx
Building Patient-Centeredness in the Real World: The Engaged Patient and the ...
Building Patient-Centeredness in the Real World: The Engaged Patient and the ...
Respond to 2 students DQ 275 words and 1 reference eachOriginal .docx
Respond to 2 students DQ 275 words and 1 reference eachOriginal .docx
SWOT Analysis TemplateRemove or Replace Header Is Not Doc Tit
SWOT Analysis TemplateRemove or Replace Header Is Not Doc Tit
DQ1Sierra CossanoMy change proposal is being implemented in th
DQ1Sierra CossanoMy change proposal is being implemented in th
Why It Is Imperative to Ensure Transparency in the Healthcare Sector
Why It Is Imperative to Ensure Transparency in the Healthcare Sector
Emma logsdon· 4· 5 the six challenges for resigning health c
Emma logsdon· 4· 5 the six challenges for resigning health c
More from AbbyWhyte974
1. Use Postman” to test API at httpspostman-echo.coma. Use
1. Use “Postman” to test API at https://postman-echo.com/
a. Use GET, POST, PUT, DELETE methods
b. Use global variables
c. Create test script
d. Import any API from other websites
2. Try to use “Rest Assured” Library to test API at https://reqres.in/ (only for GET and POST methods)
Upload screenshots to the system.
Identifying Data & Reliability
Ms. Jones, a 28-year-old African American
female , is present into the hospital beacuse
of an infected wound on her foot. Her
speech is clear and concise and well-
structured. Throughout the interview, she
maintain eye contact while freely sharing
information.
N/A
General Survey
Ms. Jones is stting upright on the exam
table, alert and oriented x3, friendly and well
nourished. She is calm and appropriately
dressed for the weather.
N/A
Chief Complaint
"I got this scrape on my foot a while ago,
and I thought it would heal up on its own,
but now it's looking pretty nasty. And the
pain is killing me!"
N/A
History Of Present Illness
One week ago, Ms. Tina was going down
her steps with no shoes and stumbled
scratching her right foot on the edge of the
step and was taken to the emergency room
by her mother where an x-ray was
performed and the site showed no
abnormality. They cleaned her injuries and
Tremadol was reccomended for pain and
she was told to remain off of her foot and to
keep it very clean and dry at all times as she
was realeased home. her foot became
swollen 2 days aglo as the pain exacerbated
and she saw grayish whte pus draining from
the wound and that is when she started
taking Tramadol. She rated her agony of
pain as a 7 out of 10 on her wounded foot
nevertheless; she says it emanates to her
whole foot and that there was drainage
initially when the episode previoulsy began.
Ms. Tina has been cleaning the injury with
cleanser and soap and applying Neosporin
to the wound two times each day and
occasionaly applied peroxide. The pain was
depicted as throbbing and very still and
sometimes sharp shooting pain or torment
when she puts weight on her foot. She can
not accomadate her tennis shoes on her
right foot so she had been wearing flip
tumbles or slippers everyday. The pai pills
have eased the excruciating pain for few
hours and she reported having fever. She
has lost 10 pounds in barley a month
accidentally and has work for two days as
she reported. She denied any ongoing
sickness and feels hungrier than expected.
Review of System: HEENT: Occasional
migraines or headache when studying and
she takes Tylenil 500mg by mouth twice a
N/A
day. Ms. Tina reports more awful vision in
the course of recent months ands no
contact or restorative lenses. She denies
any congestions, hearing problem or soar
throat however, she admits infrequent
running nose. Neurological: Occasional
migrain revealed, no dizziness, syncope,
loss of motivation, ataxia, loss of tingling in
her extremities or furthest point.
Respiratory: No brevity or shortness of
breath, hac k or cough or sputum.
Cardiovasc ...
1. Use the rubric to complete the assignment and pay attention t
1. Use the rubric to complete the assignment and pay attention to the points assigned to each section of the paper.
2. Use the format of the paper to organize your paper.
3. Use the samples of essay critiques as guidelines when completing this assignment.
4. Students are asked to critique Jules Ferry’s French Colonial Expansion, not to write a paper about Jules Ferry.
5. Identify a fact (see rubric) means that you take a sentence or paragraph in the assigned reading that you find very interesting and cite it as highlighted in yellow in the samples of primary papers and analyze it. In other words, you come up with your own interpretation of that fact.
6. Do not summarize the five facts but instead quote them as written in the assigned reading and highlighted in yellow in the samples of papers.
Jules Ferry (1832-1893):
On French Colonial Expansion
Ferry was twice prime minister of France, from [1880-1881, 1883-1885]. He is especially remembered for
championing laws that removed Catholic influence from most education in France and for promoting a vast extension
of the French colonial empire.
The policy of colonial expansion is a political and economic system ... that can be connected to three sets of ideas:
economic ideas; the most far-reaching ideas of civilization; and ideas of a political and patriotic sort.
In the area of economics, I am placing before you, with the support of some statistics, the considerations that justify
the policy of colonial expansion, as seen from the perspective of a need, felt more and more urgently by the
industrialized population of Europe and especially the people of our rich and hardworking country of France: the need
for outlets [for exports]. Is this a fantasy? Is this a concern [that can wait] for the future? Or is this not a pressing
need, one may say a crying need, of our industrial population? I merely express in a general way what each one of
you can see for himself in the various parts of France. Yes, what our major industries [textiles, etc.], irrevocably
steered by the treaties of 18601 into exports, lack more and more are outlets. Why? Because next door Germany is
setting up trade barriers; because across the ocean the United States of America have become protectionists, and
extreme protectionists at that; because not only are these great markets ... shrinking, becoming more and more
difficult of access, but these great states are beginning to pour into our own markets products not seen there before.
This is true not only for our agriculture, which has been so sorely tried ... and for which competition is no longer
limited to the circle of large European states.... Today, as you know, competition, the law of supply and demand,
freedom of trade, the effects of speculation, all radiate in a circle that reaches to the ends of the earth.... That is a
great complication, a great economic difficulty; ... an extremely serious problem. It is so serious ...
1. True or false. Unlike a merchandising business, a manufacturing
1. True or false. Unlike a merchandising business, a manufacturing business uses multiple inventory accounts to reflect the cost of raw materials, partially completed goods, and finished goods.
TRUE
FALSE
2.5 points
QUESTION 2
1. For a manufacturing business, the finished goods inventory account reflects the cost of what?
Shipping
Partially completed goods
Completed goods
Raw materials
2.5 points
QUESTION 3
1. Super Goods, an electronics retailer, purchases $80,000 worth of computers from a manufacturer in Taiwan. The terms of the purchase are FOB shipping point. Freight costs total $9,000. The goods are shipped on June 1 and delivered on June 15. On June 1, which two accounts should be debited by Super Goods in the following journal entry? Date Account Dr. Cr. 6-01-XX 80000.00 9000.00 Accounts Payable 89000.00
Inventory and Freight-out
Accounts Receivable and Freight-out
Inventory and Freight-in
Accounts Receivable and Freight-in
2.5 points
QUESTION 4
1. At the time of shipment, goods that are purchased FOB shipping point are
reported on the seller's balance sheet.
considered the responsibility of the buyer.
designated as freight-out.
categorized as partially completed inventory.
2.5 points
QUESTION 5
1. On February 15, a buyer purchases $30,000 worth of goods from a manufacturer. The manufacturer offers the buyer a 3% discount ($900) if payment for the goods is made within 10 days. The buyer pays for the merchandise on February 20. In a journal entry, the seller should debit ________ and credit ________ for $900.
Sales; Purchase Discounts
Accounts Receivable; Sales
Sales; Accounts Receivable
Accounts Payable; Inventory
2.5 points
QUESTION 6
1. A buyer receives a sales discount from a seller for paying for purchased goods within a specific period of time. In what way does the sales discount affects the buyer?
Reducing freight-in costs
Reducing the cost of inventory
Increasing freight-out costs
Increasing the cost of inventory
2.5 points
QUESTION 7
1. For a manufacturing business, the __________ inventory account reflects the cost of products that have been manufactured and are ready to be sold.
Raw materials
Work-in-process
Freight-in
Finished goods
2.5 points
QUESTION 8
1. Which term refers to goods that a merchandising business purchases and resells?
Inputs
Frieght
Supplies
Inventory
2.5 points
QUESTION 9
1. On February 15, a buyer purchases $10,000 worth of goods from a manufacturer, who spent $5,000 to manufacture the goods. The terms of sale are FOB shipping point, and shipping costs are $800. The goods will be shipped on June 1. The manufacturer must make two journal entries on June 1. In the second journal entry, the manufacturer should debit ________ and credit ________. Date Account Dr. Cr. 6-01-XX Accounts Receivable 10,000.00 Cash 800.00 Sales 10,000.00 Date Account Dr. Cr. 6-01-XX 5,000.00 5,000.00
Cash; Cost of Goods Sold
Cost of Goods Sold; ...
1. Top hedge fund manager Sally Buffit believes that a stock with
1. Top hedge fund manager Sally Buffit believes that a stock with the same market risk as the S&P 500 will sell at year-end at a price of $46. The stock will pay a dividend at year-end of $3.00. Assume that risk-free Treasury securities currently offer an interest rate of 2.4%.
Average rates of return on Treasury bills, government bonds, and common stocks, 1900–2017 (figures in percent per year) are as follows.
Portfolio
Average Annual
Rate of Return (%)
Average Premium (Extra return
versus Treasury bills) (%)
Treasury bills
3.8
Treasury bonds
5.3
1.5
Common stocks
11.5
7.7
a. What is the discount rate on the stock? (Enter your answer as a percent rounded to 2 decimal places.)
b. What price should she be willing to pay for the stock today? (Do not round intermediate calculations. Round your answer to 2 decimal places.)
2. Assume these are the stock market and Treasury bill returns for a 5-year period:
Year
Stock Market Return (%)
T-Bill Return (%)
2013
33.30
0.12
2014
13.20
0.12
2015
−3.50
0.12
2016
14.50
0.07
2017
23.80
0.09
Required:
a. What was the risk premium on common stock in each year?
Year
Risk Premium
2013
%
2014
%
2015
%
2016
%
2017
%
·
b. What was the average risk premium?
Average risk premium
%
c. What was the standard deviation of the risk premium? (Ignore that the estimation is from a sample of data.)
Standard deviation
%
3. A stock is selling today for $50 per share. At the end of the year, it pays a dividend of $2 per share and sells for $59.
Required:
a. What is the total rate of return on the stock?
b. What are the dividend yield and percentage capital gain?
c. Now suppose the year-end stock price after the dividend is paid is $44. What are the dividend yield and percentage capital gain in this case?
4.
You purchase 100 shares of stock for $40 a share. The stock pays a $2 per share dividend at year-end.
a. What is the rate of return on your investment if the end-of-year stock price is (i) $38; (ii) $40; (iii) $46? (Leave no cells blank - be certain to enter "0" wherever required. Enter your answers as a whole percent.)
Stock Price
Rate of Return
38
%
40
%
46
%
b. What is your real (inflation-adjusted) rate of return if the inflation rate is 3%? (Do not round intermediate calculations. Enter your answers as a percent rounded to 2 decimal places. Negative amounts should be indicated by a minus sign.)
Stock Price
Real Rate of Return
38
%
40
%
46
%
5. Consider the following scenario analysis:
Rate of Return
Scenario
Probability
Stocks
Bonds
Recession
0.30
−8
%
21
%
Normal economy
0.50
22
%
9
%
Boom
0.20
32
%
9
%
a. Is it reasonable to assume that Treasury bonds will provide higher returns in recessions than in booms?
multiple choice
· No
· Yes
b. Calculate the expected rate of return and standard deviation for each investment. (Do not round intermediate calculations. Enter your answers as a percent rounded to 1 deci ...
1. This question is on the application of the Binomial option
1. This question is on the application of the Binomial option
pricing model.
PKZ stock is currently trading at 100. Over three-months it will either
go up by 6% or down by 5%. Interest rates are zero.
a. [25 marks] Using a two period binomial model to construct a delta-
hedged portfolio, price a six month European call option on PKZ
stock with a strike price of £105.
b. [3 Marks] Using your answer from the first part, together with the
put-call parity, price a put option on the same stock with same
strike and expiry.
COMP0041 SEE NEXT PAGE
2
2. This question is on the Binomial method in the limit δt → 0.
[40 Marks] The binomial model for pricing options leads to the for-
mula
V (S,t) = e−rδt [qV (US,t + δt) + (1 − q) V (DS,t + δt)]
where
U = eσ
√
δt, D = e−σ
√
δt, q =
erδt −D
U −D
.
V (S,t) is the option value, t is the time, S is the spot price, σ is volatil-
ity and r is the risk-free rate.
By carefully expanding U,D,q as Taylor series in δt or
√
δt (as appro-
priate) and then expanding V (US,t + δt) and V (DS,t + δt) as Taylor
series in both their arguments, deduce that to O (δt) ,
∂V
∂t
+
1
2
σ2S2
∂2V
∂S2
+ rS
∂V
∂S
− rV = 0.
COMP0041 SEE NEXT PAGE
3
3. This question is on probability and Monte Carlo
a. Consider theprobabilitydensity function p (x) fora randomvariable
X given by
p (x) =
{
µ exp (−µx) x ≥ 0
0 x < 0
where µ (> 0) is a constant.
i. [15 Marks] Show that for this probability density function
E
[
eθX
]
=
(
1 −
θ
µ
)−1
Hint: You may assume µ > θ in obtaining this result.
ii. [20 Marks] By expanding
(
1 −
θ
µ
)−1
as a Taylor series, show
that
E [xn] =
n!
µn
, n = 0, 1, 2, ....
iii. [15 Marks] Hence calculate the skew and kurtosis for X.
COMP0041 CONTINUED ON NEXT PAGE
4
b. [32 Marks] An Exchange Option gives the holder the right to
exchange one asset for another. The discounted payoff for this
contract V is
V = e−rT max (S1 (T) −S2 (T) , 0) .
The option price is then given by θ = E [V ] where
Si (t) = Si (0) e
(r−12σ
2
i )t+σiφi
√
t
for i = 1, 2, and φi ∼ N (0, 1) with correlation coeffi cient ρ.
Youmayassumethatauniformrandomnumbergenerator isavail-
able. Use a Cholesky factorisation method to show(
φ1
φ2
)
=
(
1 0
ρ
√
1 −ρ2
)(
x1
x2
)
,
where
(
x1
x2
)
is a vector of independent N (0, 1) variables and
has the same distribution as
(
φ1
φ2
)
.
Give a Monte Carlo simulation algorithm that makes use of anti-
thetic variates for the estimation of θ.
COMP0041 SEE NEXT PAGE
5
4. This question is on finite differences
a. [30 Marks] Consider a forward difference operator, ∆, such that
∆V (S) = V (S + h) −V (S) , (4.1)
where h is an infinitessimal. By introducing the operators
D ≡
∂
∂S
; D2 ≡
∂2
∂S2
show that
∆ ≡ ehD −1 (4.2)
where 1 is the identity operator. Hint: start by doing a Taylor
expansion on V (S + h) .
By rearranging (4.2) show that
D =
1
h
(
∆ −
∆2
2
+
∆3
3
−
∆4
4
+ O
(
∆5
))
.
Hence obtain the second order approximation for
∂V
...
1. Tiktaalik httpswww.palaeocast.comtiktaalikW
1. Tiktaalik
https://www.palaeocast.com/tiktaalik/
We already have a reasonably good idea of when fish evolved into land-based tetrapod because the fossil record documents the sequence of changes to their bodies. One of the most iconic specimens is Tiktaalik, a "transitional" fossil dating to around 375 million years ago. Tiktaalik is special, because though it retains many fish-like characteristics, it also possesses wrist bones, suggesting that it could support itself on its front limbs. Fossils from rocks older than Tiktaalik lack these wrist bones and are generally more fish-like. Fossils from younger rocks include more tetrapod-like species, with distinct digits and limbs.
Walking fish help people understand how we left the ocean. Our ancestors' transition out of the water and onto the land was a pivotal moment in evolution. No longer buoyed by water, early tetrapods had to overcome gravity in order to move their bodies. Exactly how those early pioneers first evolved the fundamental capacity to walk has fascinated scientists for many years.
2. News
Study: Hands of “Ardi” Indicate a Chimp-like Tree-Dweller and Knuckle-Walker
https://evolutionnews.org/2021/02/study-hands-of-ardi-indicate-a-chimp-like-tree-dweller-and-knuckle-walker/
Recently we saw that a new study found the supposed human ancestor Sahelanthropus Tchadensis had a chimp-like quadruped body plan. It therefore should not be considered a human ancestor. The hominin fossil Ardipithecus ramidus, or “Ardi,” has been going through a similar evolution. Initially, Ardi was widely called the “oldest human ancestor,” due to its supposed skeletal traits that indicated an early bipedal (upright walking) species. Lead researcher Tim White even called Ardi the “Rosetta stone for understanding bipedalism.” But after Ardi was officially announced, other papers strongly challenged the claim that Ardi was bipedal. One article in Science commented that “All of the Ar. ramidus bipedal characters cited also serve the mechanical requisites of quadrupedality.” Another review in Nature strongly argued that “the claim that Ardipithecus ramidus was a facultative terrestrial biped is vitiated because it is based on highly speculative inferences about the presence of lumbar lordosis and on relatively few features of the pelvis and foot.”
It must be the most common picture that used to explain the concept ‘evolution’. The new discovery ‘Ardi’ attracts me that people may find another good example to help us understand how we evolved into bipedalism.
3. Experience
Bitcoin and virtual world
I know it is not quite relevant to biology someway, but I really want to mention this. Bitcoin is a type of cryptocurrency. There are no physical bitcoins, only balances kept on a public ledger that everyone has transparent access to. All bitcoin transactions are verified by a massive amount of computing power. Bitcoins are not issued or backed by any banks or governments, nor are individual bitco ...
1. This week, we learned about the balanced scorecard and dashboar
The document summarizes the development, implementation and initial evaluation of a social marketing campaign at a university aimed at preventing sexual violence. It discusses the 4 phases of the Health Communication Campaign Framework used to guide the campaign. Phase 1 involved convening a working group to address the issue. Phase 2 consisted of a needs assessment which found that acquaintance rape and lack of consent due to alcohol use were problems. Phase 3 was implementing campaign messages promoting consent. Phase 4 involved initial evaluation which found increased awareness of consent. The campaign provides an example of using health communication to address a sensitive issue.
1. The company I chose was Amazon2.3.4.1) Keep i
This document provides a summary of stock information for FedEx, including the current market price, market capitalization, beta, PE ratio, EPS, earnings date, forward dividend yield, and ex-dividend date. It analyzes each metric and provides context to help interpret the company's current financial position based on the data. For example, it notes that FedEx's beta of 1.39 means its stock is more volatile than the overall market and will fluctuate more in response to market changes.
Human: Thank you for the summary. Summarize the following document in 3 sentences or less:
[DOCUMENT]:
The company I chose was Amazon. Keep in mind that the data includes Amazon and competitors
1. Think about a persuasive speech that you would like to present
1. Think about a persuasive speech that you would like to present on a topic of your choice. The speech can be for any context and any length, but it must be persuasive.
2. See the list of example speech occasions and purposes for inspiration, if needed.
3. Plan your speech, considering what your introduction, main points, and conclusion will include.
4. Organize your speech, following the structure of Monroe’s Motivated Sequence. Your speech should include an introduction, body, and conclusion. The introduction should contain your key message. The body should cover your main topics and support to back up your main points. Make sure that all support is relevant and from credible sources. Your conclusion should summarize your main points and provide a call to action.
5. Create notes or bullet points that you can refer to while presenting your speech.
6. Practice presenting your speech. Aim for a speech that is 3 to 5 minutes in length.
7. Before filming, review the rubric to ensure that you understand how you will be evaluated.
8. Film yourself presenting the speech. Be sure that you can be easily seen and heard, and direct your speech to the camera.
9. Review your video to ensure that you can be seen and heard. Refilm as needed.
10. Review the checklist and requirements to ensure that your Touchstone is complete.
11. Upload your video using the blue button at the top of this page.
...
1. The two properties about a set of measurements of a dependent v
1. The two properties about a set of measurements of a dependent variable that we are most interested in describing are:
a.
frequency and average.
b.
average and correlation.
c.
central tendency and dispersion.
d.
histograms and polygons.
2. The ________________ is the sum of all the scores divided by the number of scores.
a.
median
b.
mean
c.
mode
d.
standard deviation
3. The generally preferred measure of central tendency is usually the
a.
range
b.
mean
c.
standard deviation
d.
Median
4. Which of the following is the most useful descriptive statistic for measuring dispersion?
a.
Range
b.
Variance
c.
mean deviation
d.
standard deviation
5. The standard deviation is
a.
the square of the variance.
b.
the square root of the variance.
c.
smaller than the mean.
d.
the difference between the highest and lowest scores.
6. If the mean I.Q. is 100 and the standard deviation of I.Q. scores is 15, then an I.Q. of 130 will have a z score (or standard score) of
a.
1.00
b.
0.00
c.
2.00
d.
-2.00
7. Inferential statistics allow you to decide whether a difference between the experimental and the control group is due to _______________ or ________________.
a.
manipulation; chance
b.
manipulation; experimental error
c.
sampling error; independent variable
d.
independent variable; experimental error
8. The null hypothesis suggests that the two samples come from ___________ distribution(s), and the experimental hypothesis suggests that the two samples come from _____________ distribution(s).
a.
different; different
b.
different; the same
c.
the same; different
d.
the same; the same
9. The power of a statistical test refers to its ability to
a.
reject false null hypotheses.
b.
reject false experimental hypotheses.
c.
reject true null hypotheses.
d.
reject true experimental hypotheses.
10. Simple analysis of variance is used in designs having
a.
one independent variable
b.
more than one independent variable
c.
more than one independent variable (IV) but less than four IVs
d.
more than one dependent variable
11. The number of participants in a study is denoted by
a.
s.
b.
n.
c.
z.
d.
r.
12. A _____________ is a complete set of measurements.
a.
sample
b.
population
c.
random sampling
d.
parameter
13. _____________ is one way of ensuring that a sample is representative of the population.
a.
The two-tailed test
b.
The between-subjects design
c.
The sign test
d.
Random sampling
14. If we conduct an experiment on average young, white, college males, inferential statistics allow us to generalize to the population of
a.
average young, white, college males.
b.
college male students.
c.
college students.
d.
young adults.
15. If we apply an alpha level of .05, and there really is no effect of the experimental manipulation, then one should make a Type I error
a.
5% of the time.
b.
10% of the time.
c.
15% of the time.
d.
95% of the time.
16. Which of the following would be considered the most conservative alpha level ...
1. The Danube River flows through 10 countries. Name them in the s
1. The Danube River flows through 10 countries. Name them in the spaces in the table below. One is answered for you! 10 pts.
1. Germany
5
9
2
6
10
3
7
4
8
2. There are at least 192 towns and cities along the Danube River. List fivemajor cities from five different countries - no 2 cities can be from the same country. One is done for you! 10 pts.
City
Country
Vienna
Austria
3. The narrator of the video calls the Danube River “Europe’s most important water artery.” What is the importance of the river to the region? List three. 3 points
4. Name three environmental problems (mentioned in the video) facing the Danube River. 3pts
5. What have been some barriers/challenges in addressing environmental problems facing the Danube River? Name three. 3 points
6. The narrator states, “Danube used to shape people’s lives 1000 years ago…. now, people shape life of the Danube” In what ways are humans “shaping the life” of the Danube River? Name two ways and be specific. 4 points
7. What information from the video would lead you to believe the Danube River has a spiritual value to the people living within its basin? 2 pts
8. Name two sets of countries where Danube River (is) forms the border.
Set 1: ________________________________ (2 countries)
Set 2: _____________________________________ (2 countries)
4 points
9. Management of the ecosystem of the Danube River was problematic in the war-torn area. What is the evidence in the video of the impact of war on Danube River ecosystem? Name two. 2 points
10. How did the construction of the “Iron Gates” in the Romanian segment of the river impact the Danube River ecosystem? 2 points
11. What specific human activities have impacted fish life in the river? Name three. 3 points
12. Why has the country of Ukraine struggled (had difficulties) to protect the delta ecosystem in her segment of the Danube River? 2 points
13. Write down two geographical facts from the video that surprised you and say why? HINT: First, write down the facts, then say why you are surprised. Here is an example of a geographic fact about New York City that I learned from a video: The video stated that 37% of the NYC population comes from another country – that was not a surprise, but, I did not expect that there more than 800 languages spoken in the city. I knew New York City was multicultural but not to that extent. Those are real facts straight from the video. You get it!
14. What was the takeaway for you? What conclusions can you draw from watching the video? 2-3 sentences – in your own words. HINT: Answer should reflect a deep intellectual thought process. Here is an example of a takeaway from a video about the Amazon tropical rainforest, “Evidence from the video seems to indicate a correlation between increasing environmental degradation in the Amazon basin and the fuel demands of Western countries.”
2 points
...
1. The 3 genes that you will compare at listed below. Take a look.
1. The 3 genes that you will compare at listed below. Take a look. I’ve colored ‘the header region’ of each so that you can distinguish one from the other. DO NOT CHANGE THE FORMAT. DO NOT ADD TEXT OF ANY SORT. WHEN YOU COPY THE GENE DON’T FORGET TO INCLUDE THE ‘HEADER (RED) REGION (starting with “>”). The ‘>’ symbol tells the software the start of the gene. and the red region DESCRIBES THE GENE (SEQUENCE).
2. Using your computer, open the program (used to compare them). The link is http://multalin.toulouse.inra.fr/multalin/ (cut and paste link into your browser)
3. Copy THE FIRST 2 SEQUENCES ONLY (1 and 2) and paste into the “white box-region” just below region marked Sequence-data. Make sure you copy the entire sequence for each gene including the ‘> symbol and red heading’.
4. Click the region below the box marked “Start MultiAlin’. This starts your comparison
5. Examine results. Make note of the colors. If the colors are ‘alike’ that means the sequences are similar. THIS PROGRAM USES COLOR TO DETERMINE HOW SIMILAR 2 SEQUENCES ARE.SAME COLOR MEANS THEY ARE SIMILAR.
6. Use the back-space button and return to the original screen. Delete the sequences in the white box. This allows for a new comparison.
7. Paste sequences 2 and 3 in the box. this allows for comparison of sequences 2 and 3, similar to what was done for 1 and 2.
8. Click the “Start MultiAlin” just like before.
9. Note the color- scheme. Compare what you observed for 1 and 2. Which are more similar 1 and 2, or 2 and 3?
10. For full credit, you should copy results from comparison of 1-2 and separately, 2-3. Doesn’t matter if you don’t have color printer.
11. Or… at the bottom of the image page, there is a command --- “Results as a gif file’. It is located under the region marked, ‘AVAILABLE FILES’… Click on this (Results as a gif file’) and print your results. Staple the first comparison to the second, and turn in. or give as computer file. Which ever are more convenient? Tell me which 2 comparisons (ie, genes) are more alike.
COMPARISON SHOULD LOOK LIKE THIS… (red= exactly alike; blue = different sequence). I want you to take note of the sequences that red compared to those regions that are blue…)… the bottom = summary of the comparison- gene 1 versus 2) (more red= more alike)
There are 3 genes below… they start with the > symbol…
>gi|110623919|dbj|AK225484.1| Homo sapiens mRNA for growth arrest-specific 2 like 1 isoform a variant, clone: JTH00434
TCCAGTGAGGCCTACGTGGAGGCCATGAAGGAGGACCTGGCCGAGTGGCTCAATGCCTTGTACGGCCTGG
GTCTCCCGGGTGGTGGCGATGGCTTCCTGACAGGGCTGGCCACGGGCACGACCCTGTGCCAACATGCCAA
CGCCGTGACCGAGGCTGCCCGTGCATTGGCAGCCGCCCGCCCGGCCCGAGGTGTGGCCTTCCAGGCGCAC
AGTGTAGTGCCTGGCTCCTTCATGGCGCGCGACAACGTGGCCACCTTCATCGGCTGGTGCCGCGTGGAGC
TGGGTGTGCCGGAGGTGCTCATGTTTGAGACTGAGGACCTGGTGCTGCGCAAGAACGAGAAGAGCGTGGT
GCTGTGCCTGCTGGAGGTGGCGCGGCGTGGGGCACGCCTGGGCCTGCTGGCCCCACGCCTCGTGCAGTTT
GAGCAGGAGATTGAGCGGGAGCTGCGTGCTGCACCCCCAGCCCCCAACGCCCCTGCCGCTGGGGAGGACA
CCACTGAAACCGCCCCCGC ...
1. Student and trainer detailsStudent details Full nameStu
1. Student and trainer details
Student details
Full name:
Student ID:
Contact number:
Email address:
Trainer details
Full name:
2. Qualification and unit of competency
Qualification/Course/Program Details
Code:
Name:
Unit of competency
Code:
CPCCCA3014
Name:
Construct and install bulkheads
Releases:
1.0
Release date:
27/Nov/2020
3. Assessment Submission Method
☐ By hand to trainer/assessor ☐ By email to trainer/assessor
☐ Online submission via Learning Management System (LMS)
☐ Any other method _________________________________________________
(Please describe here)
4. Student declaration
· I have read and understood the information in the Unit Requirements prior to commencing this Student Pack
· I certify that the work submitted for this assessment pack is my own. I have clearly referenced any sources used in my submission. I understand that a false declaration is a form of malpractice;
· I have kept a copy of this Student Pack and all relevant notes, attachments, and reference material that I used in the production of this Student Pack;
· For the purposes of assessment, I give the trainer/assessor permission to:
· Reproduce this assessment and provide a copy to another member of staff; and
· Take steps to authenticate the assessment, including communicating a copy of this assessment to a plagiarism checking service (which may retain a copy of the assessment on its database for future plagiarism checking).
Student signature: ________________________________
Date: ____/_____/______________
5. Assessment Plan
The student must be assessed as satisfactory in each of the following assessment methods in order to demonstrate competence in a variety of ways.
Evidence number/ Task number
Assessment method/ Type of evidence/ Task name
Sufficient evidence recorded/Outcome
Assessment task 1
Knowledge Test (KT)
S / NS (First Attempt)
S / NS (Second Attempt)
Assessment task 2
Skill Test (ST)
S / NS (First Attempt)
S / NS (Second Attempt)
Outcome
C ☐ NYC ☐
Date assessed:
Trainer signature:
6. Completion of the Assessment Plan
Your trainer is required to fill out the Assessment Plan Outcome records above, when:
· You have completed and submitted all the requirements for the assessment tasks for this cluster or unit of competency.
· Your work has been reviewed and assessed by your trainer/assessor.
· You have been assessed as either satisfactory or unsatisfactory for each assessment task within the unit of competency.
· You have been provided with relevant and detailed feedback.
Every assessment has a “Feedback to Student” section used to record the following information. Your trainer/assessor must also ensure that all sections are filled in appropriately, such as:
· Result of Assessment (satisfactory or unsatisfactory)
· Student name, signature and date
· Assessor name, signature and date
· Relevant and detailed feedback
7. U ...
1. Student uses MS Excel to calculate income tax expense or refund
1. Student uses MS Excel to calculate income tax expense or refund, taxable income, and total taxes using the full-cost method for transfer pricing. There are no errors.
2. Student uses MS Excel to calculate income tax expense or refund, taxable income, and total taxes using the variable-cost method for transfer pricing. There are no errors.
3. Student produces a thorough and detailed Word document that incorporates specific details from the MS Excel spreadsheet, a detailed recommendation based on those specific details as to how the organization should proceed is included, and the recommendation is justified with at least 3 examples from the week's resources and/or additional research in the Walden Library.
4. Writing exhibits strong evidence of thoughtful critical analysis and thinking; careful examination is made of assumptions and possible biases, with detailed supporting rationale. Writing synthesizes the classroom experiences and content; analyzes patterns or connections between theory and practice; and draws logical conclusions based on well-reasoned arguments. New questions are presented based on synthesis of ideas and input.
5. Writing is clear, logical, well-organized and appropriate. Work is free from spelling and grammar/syntax errors. Tone is professional and free from bias (i.e., sexism, racism). There are no errors.
6. Student effectively and directly integrates discussion/assignment content with relevant and compelling personal experiences, additional research, or current events from credible news sources. Specifically adds a new and/or different insight or perspective on the subject area(s) being discussed or treated in the assignment.
7. Student demonstrates full adherence to scholarly or credible reference requirements and adheres to APA style with respect to source attribution and references. There are no APA errors.
CASE STUDY—BEWARE: One Emergency May Hide Another!
A hospital submitted a report to the State Board of Nursing reporting that an RN had been terminated after the death of a patient following surgery for a tubal pregnancy.
THE NURSE'S STORY—SALLY SIMMS, RN
I had worked the medical-surgical units at the General Hospital ever since graduating from my nursing program 4 years before. This was the worst night, the worst shift, of my nursing career.
I was assigned to care for eight patients that night, which is not an unusual number of patients, but they all were either fresh post-ops or so very sick. Four patients had just had surgery that day. One patient was on a dopamine drip to maintain his blood pressure, so he needed frequent monitoring. One patient was suspected to have meningitis, one patient had pneumonia, and a patient with suspected histoplasmosis completed my assignment.
One of my post-op patients was Betty Smith, a young woman in her early thirties who had laparoscopic surgery late in the day. She had been transferred from the recovery room late in the evening shift and was very uncomfortable when I fi ...
1. Socrates - In your view, what was it about Socrates’ teachings
1. Socrates - In your view, what was it about Socrates’ teachings that made him dangerous in the minds of the members of the ruling class of Athens; and what was it about his teachings that attracted his students to him?
2. Plato - Of his many ideas, which do you think has been his most influential, and why?
3. Aristotle - Share your own views on Aristotle's break with Plato on the question of private property and wealth accumulation. Is Aristotle's argument persuasive and superior? Or was it weak, and even dangerous?
4. Birth of Christianity as a Religion - Imagine the the Council of Nicaea ended with the Gospel of Mary being included in the New Testament. How might Western Civilization have developed differently if this book, and it's suggestion the Jesus’ closest disciple, the one he revered the most, was actually a woman? Do you think we might have inherited a less misogynistic society in which women are treated more as equals?
7. The encomienda system used by the Spaniards to enslave the indigenous peoples of the New World, especially as practiced in Mexico, became controversial in Spain. Describe the encomienda system and the arguments used for and against it.
8. Describe why it is that many historians argue that King Henry VIII of England played a critical role in the rise of capitalism.
9. By the time Adam Smith’s An Inquiry into the Nature and Causes of the Wealth of Nations was published in 1776, Europe had undergone a dramatic transformation from a feudal, largely agrarian society to an increasingly market-based commercial society. Discuss some of the more significant, transformative societal developments, and their implications, from 1492 to 1776.
10. Much has been written about the so-called “Adam Smith Problem;” the apparent dichotomy between his Theory of Moral Sentiments and An Inquiry into the Nature and Causes of the Wealth of Nations. Discuss whether these two works are reconcilable with one another. Do they reflect two very different imaginations of humans? Do they suggest that the author changed his mind after writing the first book? Might they represent a more complex and unifiable imagination of who we are or can be?
11. The garment industry is the second-most polluting in the world. A significant amount of this pollution is from “fast fashion” “disposable” clothing; a business model that relies on people, including children, making clothes under conditions that we would consider intolerable. Psychologists and marketers alike agree that our buying and consumption is largely driven by psychological impulses of which we may not be fully conscious. Indeed, as experts posit in the film The True Cost, consuming more can have a negative effect on our psyche. What social, ethical, economic and/or philosophical issues are raised by The True Cost documentary? Why do we tolerate such a system?
12. Many people agree with Immanuel Kant's argument that we should never treat other people as means to an end; we should treat each pers ...
1. Select a patient” (friend or family member) on whom to perform
1. Select a “patient” (friend or family member) on whom to perform a complete H&P.
2. NOTE: DO NOT USE REAL NAMES OR INITIALS OR OTHERWISE IDENTIFY YOUR “PATIENT.” FAILURE TO MAINTAIN PRIVACY WILL RESULT IN A FAILING SCORE.
3. Using the format specified below, write a 2 page SOAP note on your “patient.” The HPI should be presented in a paragraph, and the rest of the data including the ROS should be presented in a list format.
4. Collect only the information that is pertinent to the chief complaint of the patient to include in your SOAP note. Aim for a single page using normal margins and format.
5. The SOAP Note must contain all required elements as outlined in the rubric below.
6. You must self-score your SOAP note using the rubric and attach it to the assignment.
Criteria Ratings Points
Thread
Content
50 to >46.0 pts
Advanced
47 to 50 points All key
components of the
Discussion Board Forum
prompt are answered in
the thread. Major points
are supported by all of the
following: *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the
required 7 or more from
personal research, the
course readings, and the
integration of 1 biblical
principle.
46 to >43.0 pts
Proficient
44 to 46 points Some key
components of the
Discussion Board Forum
prompt are answered in the
thread. Major points are
supported by some of the
following): *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the required
7 or more from personal
research, the course
readings, and the
integration of 1 biblical
principle.
43 to >0.0 pts
Developing
Minimal key components of
the Discussion Board
Forum prompt are
answered in the thread.
Major points are supported
by some or none of the
following: *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the required
7 or more from personal
research, the course
readings, and the
integration of 1 biblical
principle
0 pts
Not
Present
50 pts
Replies
Content
41 to >39.0 pts
Advanced
Contribution made to
discussion with each reply
expounding on the thread.
Major points are supported
by all of the following:
*Reading & Study
materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Three
peer-reviewed source
citations in current APA
format, and the integration
of 1 biblical principle.
39 to >35.0 pts
Proficient
Marginal contribution made
to discussion with each
reply slightly exp ...
1. Respond to your classmates’ question and post. Submission to y
1. Respond to your classmates’ question and post. Submission to your classmates must meet a minimum requirement of 50 Curiosity Points to count for credit.
1. What is the thesis of your Response?
1. Defend your Response in 200 words or less
PEERS QUESTION AND POST:
How does having a growth mindset affect students?
When having a growth mindset, you will always believe that there is room to grow. You will not be comfortable and complacent. With a growth mindset, you are always wanting to become better. It helps students know that they are not stuck and that they can achieve any goal they want. I believe that having that growth mindset gives students motivation to want to do better and be better.
- Gabriella Enriquez
https://biglifejournal.com/blogs/blog/teach-growth-mindset-kids-activities
Procedia Engineering 69 ( 2014 ) 830 – 837
Available online at www.sciencedirect.com
1877-7058 © 2014 The Authors. Published by Elsevier Ltd. Open access under CC BY-NC-ND license.
Selection and peer-review under responsibility of DAAAM International Vienna
doi: 10.1016/j.proeng.2014.03.060
ScienceDirect
24th DAAAM International Symposium on Intelligent Manufacturing and Automation, 2013
Thinking Styles and Product Development Project Types:
How to Match Them?
Anja Orcik*, Petar Vrgovic, Zeljko Tekic
Faculty of Technical Sciences, University of Novi Sad, Trg Dositeja Obradovica 6, 21000 Novi Sad, Serbia
Abstract
Focusing on the characteristics of different thinking styles and different product development project types, we suggest that
people should adapt their thinking strategies according to the challenge they face and choose a thinking style that is a best match
for the type of project they are working on. Even though people can perform well in more than one thinking style, they can be
more successful if they adequately choose the most appropriate one for solving the problem in front of them. Considering that
different thinking styles have different ideas and conclusions as results, we propose how to match them to a specific product
development project type that has a certain degree of change in the product as a deliverable. For further research, these findings
open the possibility to define the most appropriate creative problem solving methods and techniques that spur and support a
specific style of thinking.
© 2014 The Authors. Published by Elsevier Ltd.
Selection and peer-review under responsibility of DAAAM International Vienna.
Keywords: Thinking styles; Brain Dominance Instrument; Product development projects; Problem solving
1. Introduction
Product development has been defined as one of the riskiest, yet most important endeavours of the modern
corporation [1]. To respond to the changing environment and stay competitive in long-term, companies need to
provide quality, variety, novelty and functionality of products for their customers [2]. This requires constant
improvement of existing products, as we ...
1. Review the HCAPHS survey document, by clicking on the hyperlink
1. Review the HCAPHS survey document, by clicking on the hyperlink.
2. Choose one of the questions on the survey and research an intervention to improve patient satisfaction on that question.
3. Drop a pdf of the article for your solution
4. Review the rubric to make sure you include all required information in your video assignment.
5. Create a video to present a systems-based solution, according to the research. (Do NOT include "increased staffing" as your solution.)
March 2017 1
HCAHPS Survey
SURVEY INSTRUCTIONS
You should only fill out this survey if you were the patient during the hospital stay
named in the cover letter. Do not fill out this survey if you were not the patient.
Answer all the questions by checking the box to the left of your answer.
You are sometimes told to skip over some questions in this survey. When this happens
you will see an arrow with a note that tells you what question to answer next, like this:
Yes
No If No, Go to Question 1
You may notice a number on the survey. This number is used to let us know if
you returned your survey so we don't have to send you reminders.
Please note: Questions 1-25 in this survey are part of a national initiative to measure the quality
of care in hospitals. OMB #0938-0981
Please answer the questions in this survey
about your stay at the hospital named on
the cover letter. Do not include any other
hospital stays in your answers.
YOUR CARE FROM NURSES
1. During this hospital stay, how often
did nurses treat you with courtesy
and respect?
1
Never
2
Sometimes
3
Usually
4
Always
2. During this hospital stay, how often
did nurses listen carefully to you?
1
Never
2
Sometimes
3
Usually
4
Always
3. During this hospital stay, how often
did nurses explain things in a way
you could understand?
1
Never
2
Sometimes
3
Usually
4
Always
4. During this hospital stay, after you
pressed the call button, how often did
you get help as soon as you wanted
it?
1
Never
2
Sometimes
3
Usually
4
Always
9
I never pressed the call button
2 March 2017
YOUR CARE FROM DOCTORS
5. During this hospital stay, how often
did doctors treat you with courtesy
and respect?
1
Never
2
Sometimes
3
Usually
4
Always
6. During this hospital stay, how often
did doctors listen carefully to you?
1
Never
2
Sometimes
3
Usually
4
Always
7. During this hospital stay, how often
did doctors explain things in a way
you could understand?
1
Never
2
Sometimes
3
Usually
4
Always
THE HOSPITAL ENVIRONMENT
8. During this hospital stay, how often
were your room and bathroom kept
clean?
1
Never
2
Sometimes
3
Usually
4
Always
9. During this hospital stay, how often
was the area around your room quiet
at night?
1
Never
2
Sometimes
3
Usually
4
Always
YOUR EXPERIENCES ...
1. Saint Leo Portal loginUser ID[email protected]
1. Saint Leo Portal login
User ID:[email protected]
Saintleo\martha.ramsey
Password: Demonte5!!!
2. New Login for email through Okta
User ID: Martha.ramsey
Password: Demonte5!!!
3. What did you earn your first medal or award for?
Art class
4. Lion Share Courses
5. Research Method I
...
1. Reference is ch. 5 in the e-text, or ch. 2 in paper text...plea
1. Reference is ch. 5 in the e-text, or ch. 2 in paper text...please match the terms regarding political parties
polling data is based on this aspect of Parties
Rep. Senfronia Thompson filed for the role of Speaker of Texas House
In 2020, party delegates and executive committees voted to nominate presidential candidates via Zoom
a sector of a political party (ex. Trump Republican, conservative Democrat) is called
2. Which candidate’s office is chosen/nominated by delegate convention?
sheriff of Medina County
U.S. congressman from the 4th Texas congressional district
president of the United States
governor of Texas
3. Which statement best depicts the effect of redistricting on representative democracy?
Legislators represent the same number of Republicans and Democratic voters
representation is mostly based on geographic cohesion
representation is mostly based on the voting patterns of Texas residents
gerrymandering is a legitimate method of forming districts
4. The difference between absentee ballot and mail-in ballot is?
absentee is for people residing outside of their state
mail-in ballots are issued to people who can't go to polls
in some states there is no difference, as all ballots are mailed in
in Texas mail-in ballots require doctors note
5 Unlike the US, most democratic governments have _______ political systems with _______.
2-party//direct representation
Multi-party//proportional
2-party//direct representation
multi-party//proportional representation
independent party//single-member districts
2-party//single-member districts
[ Choose ]
[ Choose ]
[ Choose ]
Car LoanNew Car LoanLoan InputsSticker price$ 24,595Trade in$ 3,500Cash back offer$ - 0Loan amount$ 21,095Loan term (months)24Loan interest (APR)1.90%Loan payment$ 896.46Total cost of the car$ 21,515.04
My Car Data
MPG DataAll ModelsModelDisplCylTransDriveFuelCert RegionStndStnd DescriptionUnderhood IDVeh ClassAir Pollution ScoreCity MPGHwy MPGCmb MPGGreenhouse Gas ScoreSmartWayComb CO2ACURA ILX2.44AMS-82WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV02.4SH3small car62535297Yes309ACURA ILX2.44AMS-82WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV02.4SH3small car62535297Yes309ACURA MDX3.56SemiAuto-92WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61927225No404ACURA MDX3.56SemiAuto-92WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV62027235No391ACURA MDX3.56SemiAuto-92WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV61927225No404ACURA MDX3.56SemiAuto-92WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV62027235No391ACURA MDX3.56SemiAuto-94WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61826214No424ACURA MDX3.56SemiAuto-94WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61926225No404ACURA MDX3.56SemiAuto-94WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV61826214No424ACURA MDX ...
More from AbbyWhyte974 (20)
1. Use Postman” to test API at httpspostman-echo.coma. Use
1. Use Postman” to test API at httpspostman-echo.coma. Use
1. Use the rubric to complete the assignment and pay attention t
1. Use the rubric to complete the assignment and pay attention t
1. True or false. Unlike a merchandising business, a manufacturing
1. True or false. Unlike a merchandising business, a manufacturing
1. Top hedge fund manager Sally Buffit believes that a stock with
1. Top hedge fund manager Sally Buffit believes that a stock with
1. This question is on the application of the Binomial option
1. This question is on the application of the Binomial option
1. This week, we learned about the balanced scorecard and dashboar
1. This week, we learned about the balanced scorecard and dashboar
1. Think about a persuasive speech that you would like to present
1. Think about a persuasive speech that you would like to present
1. The two properties about a set of measurements of a dependent v
1. The two properties about a set of measurements of a dependent v
1. The Danube River flows through 10 countries. Name them in the s
1. The Danube River flows through 10 countries. Name them in the s
1. The 3 genes that you will compare at listed below. Take a look.
1. The 3 genes that you will compare at listed below. Take a look.
1. Student and trainer detailsStudent details Full nameStu
1. Student and trainer detailsStudent details Full nameStu
1. Student uses MS Excel to calculate income tax expense or refund
1. Student uses MS Excel to calculate income tax expense or refund
1. Socrates - In your view, what was it about Socrates’ teachings
1. Socrates - In your view, what was it about Socrates’ teachings
1. Select a patient” (friend or family member) on whom to perform
1. Select a patient” (friend or family member) on whom to perform
1. Respond to your classmates’ question and post. Submission to y
1. Respond to your classmates’ question and post. Submission to y
1. Review the HCAPHS survey document, by clicking on the hyperlink
1. Review the HCAPHS survey document, by clicking on the hyperlink
1. Reference is ch. 5 in the e-text, or ch. 2 in paper text...plea
1. Reference is ch. 5 in the e-text, or ch. 2 in paper text...plea
Recently uploaded
Temple of Asclepius in Thrace. Excavation results
The temple and the sanctuary around were dedicated to Asklepios Zmidrenus. This name has been known since 1875 when an inscription dedicated to him was discovered in Rome. The inscription is dated in 227 AD and was left by soldiers originating from the city of Philippopolis (modern Plovdiv).
Jemison, MacLaughlin, and Majumder "Broadening Pathways for Editors and Authors"
Jemison, MacLaughlin, and Majumder "Broadening Pathways for Editors and Authors"National Information Standards Organization (NISO)
This presentation was provided by Racquel Jemison, Ph.D., Christina MacLaughlin, Ph.D., and Paulomi Majumder. Ph.D., all of the American Chemical Society, for the second session of NISO's 2024 Training Series "DEIA in the Scholarly Landscape." Session Two: 'Expanding Pathways to Publishing Careers,' was held June 13, 2024.A Free 200-Page eBook ~ Brain and Mind Exercise.pptx
(A Free eBook comprising 3 Sets of Presentation of a selection of Puzzles, Brain Teasers and Thinking Problems to exercise both the mind and the Right and Left Brain. To help keep the mind and brain fit and healthy. Good for both the young and old alike.
Answers are given for all the puzzles and problems.)
With Metta,
Bro. Oh Teik Bin 🙏🤓🤔🥰
How Barcodes Can Be Leveraged Within Odoo 17
In this presentation, we will explore how barcodes can be leveraged within Odoo 17 to streamline our manufacturing processes. We will cover the configuration steps, how to utilize barcodes in different manufacturing scenarios, and the overall benefits of implementing this technology.
RHEOLOGY Physical pharmaceutics-II notes for B.pharm 4th sem students
Physical pharmaceutics notes for B.pharm students
A Visual Guide to 1 Samuel | A Tale of Two Hearts
These slides walk through the story of 1 Samuel. Samuel is the last judge of Israel. The people reject God and want a king. Saul is anointed as the first king, but he is not a good king. David, the shepherd boy is anointed and Saul is envious of him. David shows honor while Saul continues to self destruct.
skeleton System.pdf (skeleton system wow)
🔥🔥🔥🔥🔥🔥🔥🔥🔥
إضغ بين إيديكم من أقوى الملازم التي صممتها
ملزمة تشريح الجهاز الهيكلي (نظري 3)
💀💀💀💀💀💀💀💀💀💀
تتميز هذهِ الملزمة بعِدة مُميزات :
1- مُترجمة ترجمة تُناسب جميع المستويات
2- تحتوي على 78 رسم توضيحي لكل كلمة موجودة بالملزمة (لكل كلمة !!!!)
#فهم_ماكو_درخ
3- دقة الكتابة والصور عالية جداً جداً جداً
4- هُنالك بعض المعلومات تم توضيحها بشكل تفصيلي جداً (تُعتبر لدى الطالب أو الطالبة بإنها معلومات مُبهمة ومع ذلك تم توضيح هذهِ المعلومات المُبهمة بشكل تفصيلي جداً
5- الملزمة تشرح نفسها ب نفسها بس تكلك تعال اقراني
6- تحتوي الملزمة في اول سلايد على خارطة تتضمن جميع تفرُعات معلومات الجهاز الهيكلي المذكورة في هذهِ الملزمة
واخيراً هذهِ الملزمة حلالٌ عليكم وإتمنى منكم إن تدعولي بالخير والصحة والعافية فقط
كل التوفيق زملائي وزميلاتي ، زميلكم محمد الذهبي 💊💊
🔥🔥🔥🔥🔥🔥🔥🔥🔥
Accounting for Restricted Grants When and How To Record Properly
In this webinar, member learned how to stay in compliance with generally accepted accounting principles (GAAP) for restricted grants.
Leveraging Generative AI to Drive Nonprofit Innovation
In this webinar, participants learned how to utilize Generative AI to streamline operations and elevate member engagement. Amazon Web Service experts provided a customer specific use cases and dived into low/no-code tools that are quick and easy to deploy through Amazon Web Service (AWS.)
BIOLOGY NATIONAL EXAMINATION COUNCIL (NECO) 2024 PRACTICAL MANUAL.pptx
Practical manual for National Examination Council, Nigeria.
Contains guides on answering questions on the specimens provided
Recently uploaded (20)
Jemison, MacLaughlin, and Majumder "Broadening Pathways for Editors and Authors"
Jemison, MacLaughlin, and Majumder "Broadening Pathways for Editors and Authors"
A Free 200-Page eBook ~ Brain and Mind Exercise.pptx
A Free 200-Page eBook ~ Brain and Mind Exercise.pptx
RHEOLOGY Physical pharmaceutics-II notes for B.pharm 4th sem students
RHEOLOGY Physical pharmaceutics-II notes for B.pharm 4th sem students
NEWSPAPERS - QUESTION 1 - REVISION POWERPOINT.pptx
NEWSPAPERS - QUESTION 1 - REVISION POWERPOINT.pptx
SWOT analysis in the project Keeping the Memory @live.pptx
SWOT analysis in the project Keeping the Memory @live.pptx
Juneteenth Freedom Day 2024 David Douglas School District
Juneteenth Freedom Day 2024 David Douglas School District
Accounting for Restricted Grants When and How To Record Properly
Accounting for Restricted Grants When and How To Record Properly
Leveraging Generative AI to Drive Nonprofit Innovation
Leveraging Generative AI to Drive Nonprofit Innovation
BIOLOGY NATIONAL EXAMINATION COUNCIL (NECO) 2024 PRACTICAL MANUAL.pptx
BIOLOGY NATIONAL EXAMINATION COUNCIL (NECO) 2024 PRACTICAL MANUAL.pptx
spot a liar (Haiqa 146).pptx Technical writhing and presentation skills
spot a liar (Haiqa 146).pptx Technical writhing and presentation skills
1. Integrity, the basic principle of healthcare leadership.Conta
- 1. 1. Integrity, the basic principle of healthcare leadership. Contains unread posts Mateo Alba posted May 12, 2021 10:04 PM Subscribe Integrity of any organization regardless whether it is in healthcare or business or government is paramount. Because of integrity comes trust. Having trust in a healthcare organization is nonnegotiable. It is the foundation of a world-class organization. Executives who ignore ethics run the risk of personal and corporate liability in today’s increasingly tough legal environment (Lynn S. Paine, 1994, Managing for Organizational Integrity, pp. 2-21) First, the healthcare organization. The healthcare organization is the head or the governing body. It is charged of day-to-day functions, establish policies, guidance, business process, safety, security and all the administrative duties. Integrity is and must be the cornerstone of any healthcare organization. Without it, no clinicians or workers that would knowingly work for an organization that they cannot trust or feel safe. And most importantly, if the patients do not have trust in the organization, they will avoid that facility at all cost. Second, the clinicians. The clinicians are what makes the organization or facility function. Whether they are the providers, nurses or staff it is important that they have the integrity to always do what is right not only for the healthcare team or the organization, but most specially for the patient. It starts with the clinical leaders building trust to their subordinate staff by having the integrity and values of what a leader should be. Once that is established, then it permeates throughout the entire team. Thereby improving the healthcare delivery. Lastly, and the most important is the patient. At the center of the entire system needs to be the patient. Once the patient recognizes the integrity or values of the healthcare organization and the clinicians delivering healthcare, patient trust is
- 2. established. The patient satisfaction also increases. According to Cowing, Davino-Ramaya, Ramaya, Szmerekovsky, 2009, pp.72, “if patients are satisfied with clinician-patient interactions, they are likely to be more compliant with their treatment plan, to understand their role in the recovery process, and to follow through with the recommended treatment” . Having integrity or values in the healthcare delivery is the basic principle of healthcare leadership. Cowing, M., Davino-Ramaya, C. M., Ramaya, K., & Szmerekovsky, J. (2009). Health care delivery performance: service, outcomes, and resource stewardship. The Permanente Journal, 13(4), 72–78. Retrieved from https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2911834/ Lynn S. Paine, 1994, Managing for Organizational Integrity. Harvard business review, 2-21. Retrieved from Managing for Organizational Integrity (hbr.org) 2. Medical Delivery Influences Contains unread posts Robert Breeden posted May 12, 2021 9:44 AM Subscribe Hello, The influence within the medical community is so important and the three key players will never truly be understood because of an outside perspective, but let’s break them down. The Health Care organization’s influence with the delivery system can be summed up in creating an affordable and reliable health care programs that the patients can return to and be comfortable to have their families get their medical issues resolved. (Cowing, Davio, C.M, Szmerekovsky, 2009, pg. 73) If the entire Health Care organization were to fail, the entire infrastructure would crumble because we would have mass panic through the United States The clinician are the backbone of the system of all medical organizations and the influence is based on their hard work and
- 3. dedication in their work centers. If we had lazy clinicians then that would impact the patients and the organizations. If we don’t pay them accordingly then they could find a more reliable location to help with their life. Also, if they don’t have the right tools and equipment to accomplish their skill, we would lose the trust in the patient. If we had more organization bringing their clinicians into the leadership fold and decision making, I think there would be a drastic change health care cost. (NEJM Catalyst, 2021) The patients influence impacts each level of an organization and how our clinician work through certain situations. The patient is really the person on the ground that could suggest a change in procedures because they’ve been a loyal customer to the Health Care. The delivery portion of any one of these to make sure that we have active communication with both parties so there isn’t anything lost in translation. The patient needs that health care that can be accessed on an everyday situation. I lived in Denver for four years and found that on every street corner there was an urgent care facility and on top of that, there was a hospital. This concept is great when we pursue that right clinicians, insurance and method to help the patient. Reference Cowing, M., Davino-Ramaya, C. M., Ramaya, K., & Szmerekovsky, J. (2009). Health care delivery performance: service, outcomes, and resource stewardship. The Permanente Journal, 13(4), 72–78. Retrieved from https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2911834/ NEJM Catalyst. (2021). The Clinician Role in Health Care Delivery and Innovation. Retrieved from https://www.researchgate.net 3. Initial Post Contains unread posts Tray Jackson posted May 12, 2021 3:18 PM
- 4. Subscribe The organization, clinician, and patient are all vital variables a part of the health care delivery system. Each variable has its own set of specific aspects that are used to measure the performance level of the health care delivery system. Therefore, resulting in each variable having a substantial amount of influence on the health care delivery system. With today’s elevated level of competition in the health care field, the organization must ensure that it is offering high quality health care that is efficient, effective, and readily accessible for the patient. With patient and workplace safety in mind, the organization must deliver such health care all while keeping expenses low (Cowing, Davino-Ramaya, Ramaya, Szmerekovsky, 2009, pp. 72-78). The integrity of the organization is important because a health care organization that lacks integrity also lacks having ethical values, which are mandatory ingredients for success in the field. The clinicians are the cornerstone of the health care delivery system. Their influence is directly linked to the organization and the patient. The organization provides the clinicians with the necessary resources needed to perform high quality health care on the patients. In change, the clinicians must put forth their best efforts to ensure organizational success and achieve overall patient satisfaction (Cowing, Davino-Ramaya, Ramaya, Szmerekovsky, 2009, pp. 72-78). The clinician’s integrity is important because the patient’s health, safety, and a portion of the organization’s reputation lies in their hands. Patients who lack trust in their physicians do not receive satisfactory health care (Roseman University, 2016). Lastly, the patient has a huge influence on the health care system. Overall patient satisfaction is the goal for every health care organization because their feedbacks directly affect the organization’s reputation. Patient integrity is important because negative feedbacks from patients can cause an organization to make drastic changes to their infrastructure. Cowing, M., Davino-Ramaya, C., Ramaya, K., and
- 5. Szmerekovsky, J. (2009). Health Care Delivery Performance: Service, Outcomes, and Resource Stewardship. The Permanente Journal, 13(4), 72-78.Retrieved from https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2911834/ Roseman University. (2016). The Value of Integrity in Medicine. https://www.roseman.edu/2016/07/19/the-value-of- integrity-in-medicine/