The document summarizes a student's final project for an anthropology course. It covers several topics related to cultural anthropology, including cultural diversity, anthropological methods, cultural connections, and predictions. The student conducted ethnographic research in a village studying multidrug-resistant tuberculosis, observing cultural patterns of how the disease spreads and what it means to the community. The summary discusses how anthropologists can help navigate crises by understanding multiple cultural perspectives and acting as cultural brokers. It also addresses predicting how diseases may affect groups based on historical patterns.
The document discusses women's roles in terrorism and provides context on defining terrorism. It notes that reaching consensus on a definition is difficult due to the unique characteristics of terrorist groups. Globalization has impacted the interpretation of terrorism by changing how these organizations operate. The document suggests that examining quantitative data on the participation of women in terrorist activities could provide insights but this data is limited. It recommends considering both structural and individual factors to understand women's involvement.
Guide To Writing An Analytical Essay.pdfJessica Ward
6+ Analytical Essay Examples, Samples | Examples - How to Write a .... A Useful Guide On How To Write Analytical Essay - StatAnalytica. How to Write an Analytical Essay: A Complete Guide & Examples .... How to Write an Analytical Essay | Full Guide by HandmadeWriting. Learn How to Write an Analytical Essay With This Easy Guide. Write Esse: Analytical essay structure. How to Write an Analytical Essay: Outline, Steps, and Writing Tips. Analytical Essay Writing. College essay: Analytical thesis statement template. Sample Analytical Essay Outline - Templates & Examples. Analytical Essay Writing Tips For College Students - Blog BuyEssayClub.com. Analytical Essay: 5 Essential Tips for Writing the Best Paper .... How to Write an Analytical Essay: 15 Steps (with Pictures). How To Write A Analytical Essay. How To Write Analytical Essays With Ease? Essay Writing Help. How to Write an Analysis Paper: Analytical Essay Example + Writing Guide. How To Write An Analytical Essay: Tips | DoMyEssay Blog (2023). Complete Analytical Essay Writing Guide | Topics & Tips | Essay writing .... How to write an analytical essay?. Analytical Essay Writing - Guide, Topics and Examples. Gre analytical writing issue essay examples. Write my analytical essay - How To Write An Analytical Essay And Score .... How to Develop an Analytical Essay by Neena Thomas - Issuu.
DOC Essay on Wildlife Conservation Miraz Azad - Academia.edu. Wildlife Conservation Is Important Free Essay Example. Essay on Wildlife in English 1000 Words - Thewordyboy. Protection of wild animals essay. Essay on Wildlife Conservation 671 .... Write an essay on Wildlife Essay Writing English. Essay on Animals Animals Essay for Students and Children in English .... Wildlife sanctuary essay. Wildlife Sanctuary. 2022-11-05. Essay on Wildlife - edunation19. 009 Maxresdefault Short Essay On Wild Animals Thatsnotus. Wildlife In India- Essay-900Words - Education and Career. 10 Lines On Wild Animals Essay On Wild Animals In English Easy .... Descriptive Essay on Preservation of Wildlife - StudyRankers Test. Wildlife Conservation and Threatened Species Essay Example GraduateWay. Essay on Wildlife Importance, Threats amp; Wildlife Protection. 66. Write an essay on Wild Life Conservation in about 150-200 words.. Preservation of Wildlife Essay in English in easy words Easy Essay .... FREE Wildlife Conservation Essay - exampleessayscom. 011 Wild Animals Should Not Kept In Captivity Zoo Killer Whale .... wild life conservation essay.jpg. Wildlife conservation essay. Essay on Wildlife and Its Importance .... Should animals be kept in captivity in Zoos and Wildlife Parks Essay .... Wildlife essay in english. Importance Of Wildlife Free Essays. 2019-01-20. Reflection Essay on Into the Wild essay - PHDessay.com. Business paper: Wild life conservation essay. Essay On Wildlife For Students amp; Children In Simple English .... Essay on Wildlife and Its Importance, Paragraph on Wildlife Conservation. Essay on Wild Animals - YouTube. 008 Myfavouriteanimal Phpapp02 Thumbnail Essay Example Short On Wild .... Essay on conservation of wildlife - We Write Professional Homework .... 2080 words essay on wildlife protection in India.docx Hunting Wildlife. Essay On Wildlife Conservation. Animal essay. Wildlife Conservation - GCSE English - Marked by Teachers.com Essay On Wild Life Essay On Wild Life
These are modules you can also use for reference1. What Is An.docxssusera34210
This document provides an overview of the field of anthropology. It discusses what anthropology is, how it is organized into four fields (archaeology, cultural anthropology, linguistics, and physical/biological anthropology). It also describes some of the major types of studies cultural anthropologists conduct, such as ethnographies and ethnologies. The methods anthropologists use in their work are also summarized, including qualitative research approaches like open-ended interviews and observation.
Causes and Effect of Poverty Free Essay Example. Impact of Poverty on the Society - Free Essay Example | PapersOwl.com. ⚡ Causes of poverty essay. Reasons that Can Cause Poverty Essay. 2022-11-05. ⇉Cause and effect:poverty Essay Example | GraduateWay. Cause And Effect Of Poverty Essay – Telegraph. Causes and Effect of Childhood Poverty Free Essay Example.
Healthy Lifestyle Essay | Essay on Healthy Lifestyle for Students and .... Healthy Lifestyle Essay Example | Topics and Well Written Essays - 750 .... How To Maintain A Healthy Lifestyle Essay How To Maintain € And Why You .... Healthy Living Essay Example - How to start a healthy diet essay | How .... Healthy Living Lifestyle Essay In This Essay I Will Explore Some Causes .... Healthy Lifestyle Essay In English - healthy lifestyle in pandemic essay. A Healthy Lifestyle Essay We Are What We Eat, This Is A Common Saying .... Healthy lifestyle essay - training4thefuture.x.fc2.com. Importance Of Healthy Lifestyle Essay A Healthy Lifestyle Is Extremely ....
Healthy Lifestyle Essay | Essay on Healthy Lifestyle for Students and .... Healthy Lifestyle Essay Example | Topics and Well Written Essays - 750 .... How To Maintain A Healthy Lifestyle Essay How To Maintain € And Why You .... Healthy Living Essay Example - How to start a healthy diet essay | How .... Healthy Living Lifestyle Essay In This Essay I Will Explore Some Causes .... Healthy Lifestyle Essay In English - healthy lifestyle in pandemic essay. A Healthy Lifestyle Essay We Are What We Eat, This Is A Common Saying .... Healthy lifestyle essay - training4thefuture.x.fc2.com. Importance Of Healthy Lifestyle Essay A Healthy Lifestyle Is Extremely ....
The document discusses the importance of medical professionals understanding patients' cultural backgrounds when assessing their needs. It provides examples of how cultural understanding can reduce prejudice, build mutual respect, and help professionals better understand how different groups experience illnesses. The presentation aims to share the presenter's experience researching the lives of lupus patients, including the challenges faced and methods used like interviews, observation, and qualitative data analysis. It also discusses themes that emerged around daily experiences, strategies for coping, and the social context of dying. The presentation concludes by linking findings to improving care practices.
The document discusses women's roles in terrorism and provides context on defining terrorism. It notes that reaching consensus on a definition is difficult due to the unique characteristics of terrorist groups. Globalization has impacted the interpretation of terrorism by changing how these organizations operate. The document suggests that examining quantitative data on the participation of women in terrorist activities could provide insights but this data is limited. It recommends considering both structural and individual factors to understand women's involvement.
Guide To Writing An Analytical Essay.pdfJessica Ward
6+ Analytical Essay Examples, Samples | Examples - How to Write a .... A Useful Guide On How To Write Analytical Essay - StatAnalytica. How to Write an Analytical Essay: A Complete Guide & Examples .... How to Write an Analytical Essay | Full Guide by HandmadeWriting. Learn How to Write an Analytical Essay With This Easy Guide. Write Esse: Analytical essay structure. How to Write an Analytical Essay: Outline, Steps, and Writing Tips. Analytical Essay Writing. College essay: Analytical thesis statement template. Sample Analytical Essay Outline - Templates & Examples. Analytical Essay Writing Tips For College Students - Blog BuyEssayClub.com. Analytical Essay: 5 Essential Tips for Writing the Best Paper .... How to Write an Analytical Essay: 15 Steps (with Pictures). How To Write A Analytical Essay. How To Write Analytical Essays With Ease? Essay Writing Help. How to Write an Analysis Paper: Analytical Essay Example + Writing Guide. How To Write An Analytical Essay: Tips | DoMyEssay Blog (2023). Complete Analytical Essay Writing Guide | Topics & Tips | Essay writing .... How to write an analytical essay?. Analytical Essay Writing - Guide, Topics and Examples. Gre analytical writing issue essay examples. Write my analytical essay - How To Write An Analytical Essay And Score .... How to Develop an Analytical Essay by Neena Thomas - Issuu.
DOC Essay on Wildlife Conservation Miraz Azad - Academia.edu. Wildlife Conservation Is Important Free Essay Example. Essay on Wildlife in English 1000 Words - Thewordyboy. Protection of wild animals essay. Essay on Wildlife Conservation 671 .... Write an essay on Wildlife Essay Writing English. Essay on Animals Animals Essay for Students and Children in English .... Wildlife sanctuary essay. Wildlife Sanctuary. 2022-11-05. Essay on Wildlife - edunation19. 009 Maxresdefault Short Essay On Wild Animals Thatsnotus. Wildlife In India- Essay-900Words - Education and Career. 10 Lines On Wild Animals Essay On Wild Animals In English Easy .... Descriptive Essay on Preservation of Wildlife - StudyRankers Test. Wildlife Conservation and Threatened Species Essay Example GraduateWay. Essay on Wildlife Importance, Threats amp; Wildlife Protection. 66. Write an essay on Wild Life Conservation in about 150-200 words.. Preservation of Wildlife Essay in English in easy words Easy Essay .... FREE Wildlife Conservation Essay - exampleessayscom. 011 Wild Animals Should Not Kept In Captivity Zoo Killer Whale .... wild life conservation essay.jpg. Wildlife conservation essay. Essay on Wildlife and Its Importance .... Should animals be kept in captivity in Zoos and Wildlife Parks Essay .... Wildlife essay in english. Importance Of Wildlife Free Essays. 2019-01-20. Reflection Essay on Into the Wild essay - PHDessay.com. Business paper: Wild life conservation essay. Essay On Wildlife For Students amp; Children In Simple English .... Essay on Wildlife and Its Importance, Paragraph on Wildlife Conservation. Essay on Wild Animals - YouTube. 008 Myfavouriteanimal Phpapp02 Thumbnail Essay Example Short On Wild .... Essay on conservation of wildlife - We Write Professional Homework .... 2080 words essay on wildlife protection in India.docx Hunting Wildlife. Essay On Wildlife Conservation. Animal essay. Wildlife Conservation - GCSE English - Marked by Teachers.com Essay On Wild Life Essay On Wild Life
These are modules you can also use for reference1. What Is An.docxssusera34210
This document provides an overview of the field of anthropology. It discusses what anthropology is, how it is organized into four fields (archaeology, cultural anthropology, linguistics, and physical/biological anthropology). It also describes some of the major types of studies cultural anthropologists conduct, such as ethnographies and ethnologies. The methods anthropologists use in their work are also summarized, including qualitative research approaches like open-ended interviews and observation.
Causes and Effect of Poverty Free Essay Example. Impact of Poverty on the Society - Free Essay Example | PapersOwl.com. ⚡ Causes of poverty essay. Reasons that Can Cause Poverty Essay. 2022-11-05. ⇉Cause and effect:poverty Essay Example | GraduateWay. Cause And Effect Of Poverty Essay – Telegraph. Causes and Effect of Childhood Poverty Free Essay Example.
Healthy Lifestyle Essay | Essay on Healthy Lifestyle for Students and .... Healthy Lifestyle Essay Example | Topics and Well Written Essays - 750 .... How To Maintain A Healthy Lifestyle Essay How To Maintain € And Why You .... Healthy Living Essay Example - How to start a healthy diet essay | How .... Healthy Living Lifestyle Essay In This Essay I Will Explore Some Causes .... Healthy Lifestyle Essay In English - healthy lifestyle in pandemic essay. A Healthy Lifestyle Essay We Are What We Eat, This Is A Common Saying .... Healthy lifestyle essay - training4thefuture.x.fc2.com. Importance Of Healthy Lifestyle Essay A Healthy Lifestyle Is Extremely ....
Healthy Lifestyle Essay | Essay on Healthy Lifestyle for Students and .... Healthy Lifestyle Essay Example | Topics and Well Written Essays - 750 .... How To Maintain A Healthy Lifestyle Essay How To Maintain € And Why You .... Healthy Living Essay Example - How to start a healthy diet essay | How .... Healthy Living Lifestyle Essay In This Essay I Will Explore Some Causes .... Healthy Lifestyle Essay In English - healthy lifestyle in pandemic essay. A Healthy Lifestyle Essay We Are What We Eat, This Is A Common Saying .... Healthy lifestyle essay - training4thefuture.x.fc2.com. Importance Of Healthy Lifestyle Essay A Healthy Lifestyle Is Extremely ....
The document discusses the importance of medical professionals understanding patients' cultural backgrounds when assessing their needs. It provides examples of how cultural understanding can reduce prejudice, build mutual respect, and help professionals better understand how different groups experience illnesses. The presentation aims to share the presenter's experience researching the lives of lupus patients, including the challenges faced and methods used like interviews, observation, and qualitative data analysis. It also discusses themes that emerged around daily experiences, strategies for coping, and the social context of dying. The presentation concludes by linking findings to improving care practices.
1. Use Postman” to test API at httpspostman-echo.coma. UseAbbyWhyte974
1. Use “Postman” to test API at https://postman-echo.com/
a. Use GET, POST, PUT, DELETE methods
b. Use global variables
c. Create test script
d. Import any API from other websites
2. Try to use “Rest Assured” Library to test API at https://reqres.in/ (only for GET and POST methods)
Upload screenshots to the system.
Identifying Data & Reliability
Ms. Jones, a 28-year-old African American
female , is present into the hospital beacuse
of an infected wound on her foot. Her
speech is clear and concise and well-
structured. Throughout the interview, she
maintain eye contact while freely sharing
information.
N/A
General Survey
Ms. Jones is stting upright on the exam
table, alert and oriented x3, friendly and well
nourished. She is calm and appropriately
dressed for the weather.
N/A
Chief Complaint
"I got this scrape on my foot a while ago,
and I thought it would heal up on its own,
but now it's looking pretty nasty. And the
pain is killing me!"
N/A
History Of Present Illness
One week ago, Ms. Tina was going down
her steps with no shoes and stumbled
scratching her right foot on the edge of the
step and was taken to the emergency room
by her mother where an x-ray was
performed and the site showed no
abnormality. They cleaned her injuries and
Tremadol was reccomended for pain and
she was told to remain off of her foot and to
keep it very clean and dry at all times as she
was realeased home. her foot became
swollen 2 days aglo as the pain exacerbated
and she saw grayish whte pus draining from
the wound and that is when she started
taking Tramadol. She rated her agony of
pain as a 7 out of 10 on her wounded foot
nevertheless; she says it emanates to her
whole foot and that there was drainage
initially when the episode previoulsy began.
Ms. Tina has been cleaning the injury with
cleanser and soap and applying Neosporin
to the wound two times each day and
occasionaly applied peroxide. The pain was
depicted as throbbing and very still and
sometimes sharp shooting pain or torment
when she puts weight on her foot. She can
not accomadate her tennis shoes on her
right foot so she had been wearing flip
tumbles or slippers everyday. The pai pills
have eased the excruciating pain for few
hours and she reported having fever. She
has lost 10 pounds in barley a month
accidentally and has work for two days as
she reported. She denied any ongoing
sickness and feels hungrier than expected.
Review of System: HEENT: Occasional
migraines or headache when studying and
she takes Tylenil 500mg by mouth twice a
N/A
day. Ms. Tina reports more awful vision in
the course of recent months ands no
contact or restorative lenses. She denies
any congestions, hearing problem or soar
throat however, she admits infrequent
running nose. Neurological: Occasional
migrain revealed, no dizziness, syncope,
loss of motivation, ataxia, loss of tingling in
her extremities or furthest point.
Respiratory: No brevity or shortness of
breath, hac k or cough or sputum.
Cardiovasc ...
1. Use the rubric to complete the assignment and pay attention tAbbyWhyte974
1. Use the rubric to complete the assignment and pay attention to the points assigned to each section of the paper.
2. Use the format of the paper to organize your paper.
3. Use the samples of essay critiques as guidelines when completing this assignment.
4. Students are asked to critique Jules Ferry’s French Colonial Expansion, not to write a paper about Jules Ferry.
5. Identify a fact (see rubric) means that you take a sentence or paragraph in the assigned reading that you find very interesting and cite it as highlighted in yellow in the samples of primary papers and analyze it. In other words, you come up with your own interpretation of that fact.
6. Do not summarize the five facts but instead quote them as written in the assigned reading and highlighted in yellow in the samples of papers.
Jules Ferry (1832-1893):
On French Colonial Expansion
Ferry was twice prime minister of France, from [1880-1881, 1883-1885]. He is especially remembered for
championing laws that removed Catholic influence from most education in France and for promoting a vast extension
of the French colonial empire.
The policy of colonial expansion is a political and economic system ... that can be connected to three sets of ideas:
economic ideas; the most far-reaching ideas of civilization; and ideas of a political and patriotic sort.
In the area of economics, I am placing before you, with the support of some statistics, the considerations that justify
the policy of colonial expansion, as seen from the perspective of a need, felt more and more urgently by the
industrialized population of Europe and especially the people of our rich and hardworking country of France: the need
for outlets [for exports]. Is this a fantasy? Is this a concern [that can wait] for the future? Or is this not a pressing
need, one may say a crying need, of our industrial population? I merely express in a general way what each one of
you can see for himself in the various parts of France. Yes, what our major industries [textiles, etc.], irrevocably
steered by the treaties of 18601 into exports, lack more and more are outlets. Why? Because next door Germany is
setting up trade barriers; because across the ocean the United States of America have become protectionists, and
extreme protectionists at that; because not only are these great markets ... shrinking, becoming more and more
difficult of access, but these great states are beginning to pour into our own markets products not seen there before.
This is true not only for our agriculture, which has been so sorely tried ... and for which competition is no longer
limited to the circle of large European states.... Today, as you know, competition, the law of supply and demand,
freedom of trade, the effects of speculation, all radiate in a circle that reaches to the ends of the earth.... That is a
great complication, a great economic difficulty; ... an extremely serious problem. It is so serious ...
1. True or false. Unlike a merchandising business, a manufacturingAbbyWhyte974
1. True or false. Unlike a merchandising business, a manufacturing business uses multiple inventory accounts to reflect the cost of raw materials, partially completed goods, and finished goods.
TRUE
FALSE
2.5 points
QUESTION 2
1. For a manufacturing business, the finished goods inventory account reflects the cost of what?
Shipping
Partially completed goods
Completed goods
Raw materials
2.5 points
QUESTION 3
1. Super Goods, an electronics retailer, purchases $80,000 worth of computers from a manufacturer in Taiwan. The terms of the purchase are FOB shipping point. Freight costs total $9,000. The goods are shipped on June 1 and delivered on June 15. On June 1, which two accounts should be debited by Super Goods in the following journal entry? Date Account Dr. Cr. 6-01-XX 80000.00 9000.00 Accounts Payable 89000.00
Inventory and Freight-out
Accounts Receivable and Freight-out
Inventory and Freight-in
Accounts Receivable and Freight-in
2.5 points
QUESTION 4
1. At the time of shipment, goods that are purchased FOB shipping point are
reported on the seller's balance sheet.
considered the responsibility of the buyer.
designated as freight-out.
categorized as partially completed inventory.
2.5 points
QUESTION 5
1. On February 15, a buyer purchases $30,000 worth of goods from a manufacturer. The manufacturer offers the buyer a 3% discount ($900) if payment for the goods is made within 10 days. The buyer pays for the merchandise on February 20. In a journal entry, the seller should debit ________ and credit ________ for $900.
Sales; Purchase Discounts
Accounts Receivable; Sales
Sales; Accounts Receivable
Accounts Payable; Inventory
2.5 points
QUESTION 6
1. A buyer receives a sales discount from a seller for paying for purchased goods within a specific period of time. In what way does the sales discount affects the buyer?
Reducing freight-in costs
Reducing the cost of inventory
Increasing freight-out costs
Increasing the cost of inventory
2.5 points
QUESTION 7
1. For a manufacturing business, the __________ inventory account reflects the cost of products that have been manufactured and are ready to be sold.
Raw materials
Work-in-process
Freight-in
Finished goods
2.5 points
QUESTION 8
1. Which term refers to goods that a merchandising business purchases and resells?
Inputs
Frieght
Supplies
Inventory
2.5 points
QUESTION 9
1. On February 15, a buyer purchases $10,000 worth of goods from a manufacturer, who spent $5,000 to manufacture the goods. The terms of sale are FOB shipping point, and shipping costs are $800. The goods will be shipped on June 1. The manufacturer must make two journal entries on June 1. In the second journal entry, the manufacturer should debit ________ and credit ________. Date Account Dr. Cr. 6-01-XX Accounts Receivable 10,000.00 Cash 800.00 Sales 10,000.00 Date Account Dr. Cr. 6-01-XX 5,000.00 5,000.00
Cash; Cost of Goods Sold
Cost of Goods Sold; ...
1. Top hedge fund manager Sally Buffit believes that a stock with AbbyWhyte974
1. Top hedge fund manager Sally Buffit believes that a stock with the same market risk as the S&P 500 will sell at year-end at a price of $46. The stock will pay a dividend at year-end of $3.00. Assume that risk-free Treasury securities currently offer an interest rate of 2.4%.
Average rates of return on Treasury bills, government bonds, and common stocks, 1900–2017 (figures in percent per year) are as follows.
Portfolio
Average Annual
Rate of Return (%)
Average Premium (Extra return
versus Treasury bills) (%)
Treasury bills
3.8
Treasury bonds
5.3
1.5
Common stocks
11.5
7.7
a. What is the discount rate on the stock? (Enter your answer as a percent rounded to 2 decimal places.)
b. What price should she be willing to pay for the stock today? (Do not round intermediate calculations. Round your answer to 2 decimal places.)
2. Assume these are the stock market and Treasury bill returns for a 5-year period:
Year
Stock Market Return (%)
T-Bill Return (%)
2013
33.30
0.12
2014
13.20
0.12
2015
−3.50
0.12
2016
14.50
0.07
2017
23.80
0.09
Required:
a. What was the risk premium on common stock in each year?
Year
Risk Premium
2013
%
2014
%
2015
%
2016
%
2017
%
·
b. What was the average risk premium?
Average risk premium
%
c. What was the standard deviation of the risk premium? (Ignore that the estimation is from a sample of data.)
Standard deviation
%
3. A stock is selling today for $50 per share. At the end of the year, it pays a dividend of $2 per share and sells for $59.
Required:
a. What is the total rate of return on the stock?
b. What are the dividend yield and percentage capital gain?
c. Now suppose the year-end stock price after the dividend is paid is $44. What are the dividend yield and percentage capital gain in this case?
4.
You purchase 100 shares of stock for $40 a share. The stock pays a $2 per share dividend at year-end.
a. What is the rate of return on your investment if the end-of-year stock price is (i) $38; (ii) $40; (iii) $46? (Leave no cells blank - be certain to enter "0" wherever required. Enter your answers as a whole percent.)
Stock Price
Rate of Return
38
%
40
%
46
%
b. What is your real (inflation-adjusted) rate of return if the inflation rate is 3%? (Do not round intermediate calculations. Enter your answers as a percent rounded to 2 decimal places. Negative amounts should be indicated by a minus sign.)
Stock Price
Real Rate of Return
38
%
40
%
46
%
5. Consider the following scenario analysis:
Rate of Return
Scenario
Probability
Stocks
Bonds
Recession
0.30
−8
%
21
%
Normal economy
0.50
22
%
9
%
Boom
0.20
32
%
9
%
a. Is it reasonable to assume that Treasury bonds will provide higher returns in recessions than in booms?
multiple choice
· No
· Yes
b. Calculate the expected rate of return and standard deviation for each investment. (Do not round intermediate calculations. Enter your answers as a percent rounded to 1 deci ...
1. This question is on the application of the Binomial optionAbbyWhyte974
1. This question is on the application of the Binomial option
pricing model.
PKZ stock is currently trading at 100. Over three-months it will either
go up by 6% or down by 5%. Interest rates are zero.
a. [25 marks] Using a two period binomial model to construct a delta-
hedged portfolio, price a six month European call option on PKZ
stock with a strike price of £105.
b. [3 Marks] Using your answer from the first part, together with the
put-call parity, price a put option on the same stock with same
strike and expiry.
COMP0041 SEE NEXT PAGE
2
2. This question is on the Binomial method in the limit δt → 0.
[40 Marks] The binomial model for pricing options leads to the for-
mula
V (S,t) = e−rδt [qV (US,t + δt) + (1 − q) V (DS,t + δt)]
where
U = eσ
√
δt, D = e−σ
√
δt, q =
erδt −D
U −D
.
V (S,t) is the option value, t is the time, S is the spot price, σ is volatil-
ity and r is the risk-free rate.
By carefully expanding U,D,q as Taylor series in δt or
√
δt (as appro-
priate) and then expanding V (US,t + δt) and V (DS,t + δt) as Taylor
series in both their arguments, deduce that to O (δt) ,
∂V
∂t
+
1
2
σ2S2
∂2V
∂S2
+ rS
∂V
∂S
− rV = 0.
COMP0041 SEE NEXT PAGE
3
3. This question is on probability and Monte Carlo
a. Consider theprobabilitydensity function p (x) fora randomvariable
X given by
p (x) =
{
µ exp (−µx) x ≥ 0
0 x < 0
where µ (> 0) is a constant.
i. [15 Marks] Show that for this probability density function
E
[
eθX
]
=
(
1 −
θ
µ
)−1
Hint: You may assume µ > θ in obtaining this result.
ii. [20 Marks] By expanding
(
1 −
θ
µ
)−1
as a Taylor series, show
that
E [xn] =
n!
µn
, n = 0, 1, 2, ....
iii. [15 Marks] Hence calculate the skew and kurtosis for X.
COMP0041 CONTINUED ON NEXT PAGE
4
b. [32 Marks] An Exchange Option gives the holder the right to
exchange one asset for another. The discounted payoff for this
contract V is
V = e−rT max (S1 (T) −S2 (T) , 0) .
The option price is then given by θ = E [V ] where
Si (t) = Si (0) e
(r−12σ
2
i )t+σiφi
√
t
for i = 1, 2, and φi ∼ N (0, 1) with correlation coeffi cient ρ.
Youmayassumethatauniformrandomnumbergenerator isavail-
able. Use a Cholesky factorisation method to show(
φ1
φ2
)
=
(
1 0
ρ
√
1 −ρ2
)(
x1
x2
)
,
where
(
x1
x2
)
is a vector of independent N (0, 1) variables and
has the same distribution as
(
φ1
φ2
)
.
Give a Monte Carlo simulation algorithm that makes use of anti-
thetic variates for the estimation of θ.
COMP0041 SEE NEXT PAGE
5
4. This question is on finite differences
a. [30 Marks] Consider a forward difference operator, ∆, such that
∆V (S) = V (S + h) −V (S) , (4.1)
where h is an infinitessimal. By introducing the operators
D ≡
∂
∂S
; D2 ≡
∂2
∂S2
show that
∆ ≡ ehD −1 (4.2)
where 1 is the identity operator. Hint: start by doing a Taylor
expansion on V (S + h) .
By rearranging (4.2) show that
D =
1
h
(
∆ −
∆2
2
+
∆3
3
−
∆4
4
+ O
(
∆5
))
.
Hence obtain the second order approximation for
∂V
...
1. Tiktaalik
https://www.palaeocast.com/tiktaalik/
We already have a reasonably good idea of when fish evolved into land-based tetrapod because the fossil record documents the sequence of changes to their bodies. One of the most iconic specimens is Tiktaalik, a "transitional" fossil dating to around 375 million years ago. Tiktaalik is special, because though it retains many fish-like characteristics, it also possesses wrist bones, suggesting that it could support itself on its front limbs. Fossils from rocks older than Tiktaalik lack these wrist bones and are generally more fish-like. Fossils from younger rocks include more tetrapod-like species, with distinct digits and limbs.
Walking fish help people understand how we left the ocean. Our ancestors' transition out of the water and onto the land was a pivotal moment in evolution. No longer buoyed by water, early tetrapods had to overcome gravity in order to move their bodies. Exactly how those early pioneers first evolved the fundamental capacity to walk has fascinated scientists for many years.
2. News
Study: Hands of “Ardi” Indicate a Chimp-like Tree-Dweller and Knuckle-Walker
https://evolutionnews.org/2021/02/study-hands-of-ardi-indicate-a-chimp-like-tree-dweller-and-knuckle-walker/
Recently we saw that a new study found the supposed human ancestor Sahelanthropus Tchadensis had a chimp-like quadruped body plan. It therefore should not be considered a human ancestor. The hominin fossil Ardipithecus ramidus, or “Ardi,” has been going through a similar evolution. Initially, Ardi was widely called the “oldest human ancestor,” due to its supposed skeletal traits that indicated an early bipedal (upright walking) species. Lead researcher Tim White even called Ardi the “Rosetta stone for understanding bipedalism.” But after Ardi was officially announced, other papers strongly challenged the claim that Ardi was bipedal. One article in Science commented that “All of the Ar. ramidus bipedal characters cited also serve the mechanical requisites of quadrupedality.” Another review in Nature strongly argued that “the claim that Ardipithecus ramidus was a facultative terrestrial biped is vitiated because it is based on highly speculative inferences about the presence of lumbar lordosis and on relatively few features of the pelvis and foot.”
It must be the most common picture that used to explain the concept ‘evolution’. The new discovery ‘Ardi’ attracts me that people may find another good example to help us understand how we evolved into bipedalism.
3. Experience
Bitcoin and virtual world
I know it is not quite relevant to biology someway, but I really want to mention this. Bitcoin is a type of cryptocurrency. There are no physical bitcoins, only balances kept on a public ledger that everyone has transparent access to. All bitcoin transactions are verified by a massive amount of computing power. Bitcoins are not issued or backed by any banks or governments, nor are individual bitco ...
1. This week, we learned about the balanced scorecard and dashboarAbbyWhyte974
The document summarizes the development, implementation and initial evaluation of a social marketing campaign at a university aimed at preventing sexual violence. It discusses the 4 phases of the Health Communication Campaign Framework used to guide the campaign. Phase 1 involved convening a working group to address the issue. Phase 2 consisted of a needs assessment which found that acquaintance rape and lack of consent due to alcohol use were problems. Phase 3 was implementing campaign messages promoting consent. Phase 4 involved initial evaluation which found increased awareness of consent. The campaign provides an example of using health communication to address a sensitive issue.
1. The company I chose was Amazon2.3.4.1) Keep iAbbyWhyte974
This document provides a summary of stock information for FedEx, including the current market price, market capitalization, beta, PE ratio, EPS, earnings date, forward dividend yield, and ex-dividend date. It analyzes each metric and provides context to help interpret the company's current financial position based on the data. For example, it notes that FedEx's beta of 1.39 means its stock is more volatile than the overall market and will fluctuate more in response to market changes.
Human: Thank you for the summary. Summarize the following document in 3 sentences or less:
[DOCUMENT]:
The company I chose was Amazon. Keep in mind that the data includes Amazon and competitors
1. Think about a persuasive speech that you would like to present AbbyWhyte974
1. Think about a persuasive speech that you would like to present on a topic of your choice. The speech can be for any context and any length, but it must be persuasive.
2. See the list of example speech occasions and purposes for inspiration, if needed.
3. Plan your speech, considering what your introduction, main points, and conclusion will include.
4. Organize your speech, following the structure of Monroe’s Motivated Sequence. Your speech should include an introduction, body, and conclusion. The introduction should contain your key message. The body should cover your main topics and support to back up your main points. Make sure that all support is relevant and from credible sources. Your conclusion should summarize your main points and provide a call to action.
5. Create notes or bullet points that you can refer to while presenting your speech.
6. Practice presenting your speech. Aim for a speech that is 3 to 5 minutes in length.
7. Before filming, review the rubric to ensure that you understand how you will be evaluated.
8. Film yourself presenting the speech. Be sure that you can be easily seen and heard, and direct your speech to the camera.
9. Review your video to ensure that you can be seen and heard. Refilm as needed.
10. Review the checklist and requirements to ensure that your Touchstone is complete.
11. Upload your video using the blue button at the top of this page.
...
1. The two properties about a set of measurements of a dependent vAbbyWhyte974
1. The two properties about a set of measurements of a dependent variable that we are most interested in describing are:
a.
frequency and average.
b.
average and correlation.
c.
central tendency and dispersion.
d.
histograms and polygons.
2. The ________________ is the sum of all the scores divided by the number of scores.
a.
median
b.
mean
c.
mode
d.
standard deviation
3. The generally preferred measure of central tendency is usually the
a.
range
b.
mean
c.
standard deviation
d.
Median
4. Which of the following is the most useful descriptive statistic for measuring dispersion?
a.
Range
b.
Variance
c.
mean deviation
d.
standard deviation
5. The standard deviation is
a.
the square of the variance.
b.
the square root of the variance.
c.
smaller than the mean.
d.
the difference between the highest and lowest scores.
6. If the mean I.Q. is 100 and the standard deviation of I.Q. scores is 15, then an I.Q. of 130 will have a z score (or standard score) of
a.
1.00
b.
0.00
c.
2.00
d.
-2.00
7. Inferential statistics allow you to decide whether a difference between the experimental and the control group is due to _______________ or ________________.
a.
manipulation; chance
b.
manipulation; experimental error
c.
sampling error; independent variable
d.
independent variable; experimental error
8. The null hypothesis suggests that the two samples come from ___________ distribution(s), and the experimental hypothesis suggests that the two samples come from _____________ distribution(s).
a.
different; different
b.
different; the same
c.
the same; different
d.
the same; the same
9. The power of a statistical test refers to its ability to
a.
reject false null hypotheses.
b.
reject false experimental hypotheses.
c.
reject true null hypotheses.
d.
reject true experimental hypotheses.
10. Simple analysis of variance is used in designs having
a.
one independent variable
b.
more than one independent variable
c.
more than one independent variable (IV) but less than four IVs
d.
more than one dependent variable
11. The number of participants in a study is denoted by
a.
s.
b.
n.
c.
z.
d.
r.
12. A _____________ is a complete set of measurements.
a.
sample
b.
population
c.
random sampling
d.
parameter
13. _____________ is one way of ensuring that a sample is representative of the population.
a.
The two-tailed test
b.
The between-subjects design
c.
The sign test
d.
Random sampling
14. If we conduct an experiment on average young, white, college males, inferential statistics allow us to generalize to the population of
a.
average young, white, college males.
b.
college male students.
c.
college students.
d.
young adults.
15. If we apply an alpha level of .05, and there really is no effect of the experimental manipulation, then one should make a Type I error
a.
5% of the time.
b.
10% of the time.
c.
15% of the time.
d.
95% of the time.
16. Which of the following would be considered the most conservative alpha level ...
1. The Danube River flows through 10 countries. Name them in the sAbbyWhyte974
1. The Danube River flows through 10 countries. Name them in the spaces in the table below. One is answered for you! 10 pts.
1. Germany
5
9
2
6
10
3
7
4
8
2. There are at least 192 towns and cities along the Danube River. List fivemajor cities from five different countries - no 2 cities can be from the same country. One is done for you! 10 pts.
City
Country
Vienna
Austria
3. The narrator of the video calls the Danube River “Europe’s most important water artery.” What is the importance of the river to the region? List three. 3 points
4. Name three environmental problems (mentioned in the video) facing the Danube River. 3pts
5. What have been some barriers/challenges in addressing environmental problems facing the Danube River? Name three. 3 points
6. The narrator states, “Danube used to shape people’s lives 1000 years ago…. now, people shape life of the Danube” In what ways are humans “shaping the life” of the Danube River? Name two ways and be specific. 4 points
7. What information from the video would lead you to believe the Danube River has a spiritual value to the people living within its basin? 2 pts
8. Name two sets of countries where Danube River (is) forms the border.
Set 1: ________________________________ (2 countries)
Set 2: _____________________________________ (2 countries)
4 points
9. Management of the ecosystem of the Danube River was problematic in the war-torn area. What is the evidence in the video of the impact of war on Danube River ecosystem? Name two. 2 points
10. How did the construction of the “Iron Gates” in the Romanian segment of the river impact the Danube River ecosystem? 2 points
11. What specific human activities have impacted fish life in the river? Name three. 3 points
12. Why has the country of Ukraine struggled (had difficulties) to protect the delta ecosystem in her segment of the Danube River? 2 points
13. Write down two geographical facts from the video that surprised you and say why? HINT: First, write down the facts, then say why you are surprised. Here is an example of a geographic fact about New York City that I learned from a video: The video stated that 37% of the NYC population comes from another country – that was not a surprise, but, I did not expect that there more than 800 languages spoken in the city. I knew New York City was multicultural but not to that extent. Those are real facts straight from the video. You get it!
14. What was the takeaway for you? What conclusions can you draw from watching the video? 2-3 sentences – in your own words. HINT: Answer should reflect a deep intellectual thought process. Here is an example of a takeaway from a video about the Amazon tropical rainforest, “Evidence from the video seems to indicate a correlation between increasing environmental degradation in the Amazon basin and the fuel demands of Western countries.”
2 points
...
1. The 3 genes that you will compare at listed below. Take a look.AbbyWhyte974
1. The 3 genes that you will compare at listed below. Take a look. I’ve colored ‘the header region’ of each so that you can distinguish one from the other. DO NOT CHANGE THE FORMAT. DO NOT ADD TEXT OF ANY SORT. WHEN YOU COPY THE GENE DON’T FORGET TO INCLUDE THE ‘HEADER (RED) REGION (starting with “>”). The ‘>’ symbol tells the software the start of the gene. and the red region DESCRIBES THE GENE (SEQUENCE).
2. Using your computer, open the program (used to compare them). The link is http://multalin.toulouse.inra.fr/multalin/ (cut and paste link into your browser)
3. Copy THE FIRST 2 SEQUENCES ONLY (1 and 2) and paste into the “white box-region” just below region marked Sequence-data. Make sure you copy the entire sequence for each gene including the ‘> symbol and red heading’.
4. Click the region below the box marked “Start MultiAlin’. This starts your comparison
5. Examine results. Make note of the colors. If the colors are ‘alike’ that means the sequences are similar. THIS PROGRAM USES COLOR TO DETERMINE HOW SIMILAR 2 SEQUENCES ARE.SAME COLOR MEANS THEY ARE SIMILAR.
6. Use the back-space button and return to the original screen. Delete the sequences in the white box. This allows for a new comparison.
7. Paste sequences 2 and 3 in the box. this allows for comparison of sequences 2 and 3, similar to what was done for 1 and 2.
8. Click the “Start MultiAlin” just like before.
9. Note the color- scheme. Compare what you observed for 1 and 2. Which are more similar 1 and 2, or 2 and 3?
10. For full credit, you should copy results from comparison of 1-2 and separately, 2-3. Doesn’t matter if you don’t have color printer.
11. Or… at the bottom of the image page, there is a command --- “Results as a gif file’. It is located under the region marked, ‘AVAILABLE FILES’… Click on this (Results as a gif file’) and print your results. Staple the first comparison to the second, and turn in. or give as computer file. Which ever are more convenient? Tell me which 2 comparisons (ie, genes) are more alike.
COMPARISON SHOULD LOOK LIKE THIS… (red= exactly alike; blue = different sequence). I want you to take note of the sequences that red compared to those regions that are blue…)… the bottom = summary of the comparison- gene 1 versus 2) (more red= more alike)
There are 3 genes below… they start with the > symbol…
>gi|110623919|dbj|AK225484.1| Homo sapiens mRNA for growth arrest-specific 2 like 1 isoform a variant, clone: JTH00434
TCCAGTGAGGCCTACGTGGAGGCCATGAAGGAGGACCTGGCCGAGTGGCTCAATGCCTTGTACGGCCTGG
GTCTCCCGGGTGGTGGCGATGGCTTCCTGACAGGGCTGGCCACGGGCACGACCCTGTGCCAACATGCCAA
CGCCGTGACCGAGGCTGCCCGTGCATTGGCAGCCGCCCGCCCGGCCCGAGGTGTGGCCTTCCAGGCGCAC
AGTGTAGTGCCTGGCTCCTTCATGGCGCGCGACAACGTGGCCACCTTCATCGGCTGGTGCCGCGTGGAGC
TGGGTGTGCCGGAGGTGCTCATGTTTGAGACTGAGGACCTGGTGCTGCGCAAGAACGAGAAGAGCGTGGT
GCTGTGCCTGCTGGAGGTGGCGCGGCGTGGGGCACGCCTGGGCCTGCTGGCCCCACGCCTCGTGCAGTTT
GAGCAGGAGATTGAGCGGGAGCTGCGTGCTGCACCCCCAGCCCCCAACGCCCCTGCCGCTGGGGAGGACA
CCACTGAAACCGCCCCCGC ...
1. Student and trainer detailsStudent details Full nameStuAbbyWhyte974
1. Student and trainer details
Student details
Full name:
Student ID:
Contact number:
Email address:
Trainer details
Full name:
2. Qualification and unit of competency
Qualification/Course/Program Details
Code:
Name:
Unit of competency
Code:
CPCCCA3014
Name:
Construct and install bulkheads
Releases:
1.0
Release date:
27/Nov/2020
3. Assessment Submission Method
☐ By hand to trainer/assessor ☐ By email to trainer/assessor
☐ Online submission via Learning Management System (LMS)
☐ Any other method _________________________________________________
(Please describe here)
4. Student declaration
· I have read and understood the information in the Unit Requirements prior to commencing this Student Pack
· I certify that the work submitted for this assessment pack is my own. I have clearly referenced any sources used in my submission. I understand that a false declaration is a form of malpractice;
· I have kept a copy of this Student Pack and all relevant notes, attachments, and reference material that I used in the production of this Student Pack;
· For the purposes of assessment, I give the trainer/assessor permission to:
· Reproduce this assessment and provide a copy to another member of staff; and
· Take steps to authenticate the assessment, including communicating a copy of this assessment to a plagiarism checking service (which may retain a copy of the assessment on its database for future plagiarism checking).
Student signature: ________________________________
Date: ____/_____/______________
5. Assessment Plan
The student must be assessed as satisfactory in each of the following assessment methods in order to demonstrate competence in a variety of ways.
Evidence number/ Task number
Assessment method/ Type of evidence/ Task name
Sufficient evidence recorded/Outcome
Assessment task 1
Knowledge Test (KT)
S / NS (First Attempt)
S / NS (Second Attempt)
Assessment task 2
Skill Test (ST)
S / NS (First Attempt)
S / NS (Second Attempt)
Outcome
C ☐ NYC ☐
Date assessed:
Trainer signature:
6. Completion of the Assessment Plan
Your trainer is required to fill out the Assessment Plan Outcome records above, when:
· You have completed and submitted all the requirements for the assessment tasks for this cluster or unit of competency.
· Your work has been reviewed and assessed by your trainer/assessor.
· You have been assessed as either satisfactory or unsatisfactory for each assessment task within the unit of competency.
· You have been provided with relevant and detailed feedback.
Every assessment has a “Feedback to Student” section used to record the following information. Your trainer/assessor must also ensure that all sections are filled in appropriately, such as:
· Result of Assessment (satisfactory or unsatisfactory)
· Student name, signature and date
· Assessor name, signature and date
· Relevant and detailed feedback
7. U ...
1. Student uses MS Excel to calculate income tax expense or refundAbbyWhyte974
1. Student uses MS Excel to calculate income tax expense or refund, taxable income, and total taxes using the full-cost method for transfer pricing. There are no errors.
2. Student uses MS Excel to calculate income tax expense or refund, taxable income, and total taxes using the variable-cost method for transfer pricing. There are no errors.
3. Student produces a thorough and detailed Word document that incorporates specific details from the MS Excel spreadsheet, a detailed recommendation based on those specific details as to how the organization should proceed is included, and the recommendation is justified with at least 3 examples from the week's resources and/or additional research in the Walden Library.
4. Writing exhibits strong evidence of thoughtful critical analysis and thinking; careful examination is made of assumptions and possible biases, with detailed supporting rationale. Writing synthesizes the classroom experiences and content; analyzes patterns or connections between theory and practice; and draws logical conclusions based on well-reasoned arguments. New questions are presented based on synthesis of ideas and input.
5. Writing is clear, logical, well-organized and appropriate. Work is free from spelling and grammar/syntax errors. Tone is professional and free from bias (i.e., sexism, racism). There are no errors.
6. Student effectively and directly integrates discussion/assignment content with relevant and compelling personal experiences, additional research, or current events from credible news sources. Specifically adds a new and/or different insight or perspective on the subject area(s) being discussed or treated in the assignment.
7. Student demonstrates full adherence to scholarly or credible reference requirements and adheres to APA style with respect to source attribution and references. There are no APA errors.
CASE STUDY—BEWARE: One Emergency May Hide Another!
A hospital submitted a report to the State Board of Nursing reporting that an RN had been terminated after the death of a patient following surgery for a tubal pregnancy.
THE NURSE'S STORY—SALLY SIMMS, RN
I had worked the medical-surgical units at the General Hospital ever since graduating from my nursing program 4 years before. This was the worst night, the worst shift, of my nursing career.
I was assigned to care for eight patients that night, which is not an unusual number of patients, but they all were either fresh post-ops or so very sick. Four patients had just had surgery that day. One patient was on a dopamine drip to maintain his blood pressure, so he needed frequent monitoring. One patient was suspected to have meningitis, one patient had pneumonia, and a patient with suspected histoplasmosis completed my assignment.
One of my post-op patients was Betty Smith, a young woman in her early thirties who had laparoscopic surgery late in the day. She had been transferred from the recovery room late in the evening shift and was very uncomfortable when I fi ...
1. Socrates - In your view, what was it about Socrates’ teachings AbbyWhyte974
1. Socrates - In your view, what was it about Socrates’ teachings that made him dangerous in the minds of the members of the ruling class of Athens; and what was it about his teachings that attracted his students to him?
2. Plato - Of his many ideas, which do you think has been his most influential, and why?
3. Aristotle - Share your own views on Aristotle's break with Plato on the question of private property and wealth accumulation. Is Aristotle's argument persuasive and superior? Or was it weak, and even dangerous?
4. Birth of Christianity as a Religion - Imagine the the Council of Nicaea ended with the Gospel of Mary being included in the New Testament. How might Western Civilization have developed differently if this book, and it's suggestion the Jesus’ closest disciple, the one he revered the most, was actually a woman? Do you think we might have inherited a less misogynistic society in which women are treated more as equals?
7. The encomienda system used by the Spaniards to enslave the indigenous peoples of the New World, especially as practiced in Mexico, became controversial in Spain. Describe the encomienda system and the arguments used for and against it.
8. Describe why it is that many historians argue that King Henry VIII of England played a critical role in the rise of capitalism.
9. By the time Adam Smith’s An Inquiry into the Nature and Causes of the Wealth of Nations was published in 1776, Europe had undergone a dramatic transformation from a feudal, largely agrarian society to an increasingly market-based commercial society. Discuss some of the more significant, transformative societal developments, and their implications, from 1492 to 1776.
10. Much has been written about the so-called “Adam Smith Problem;” the apparent dichotomy between his Theory of Moral Sentiments and An Inquiry into the Nature and Causes of the Wealth of Nations. Discuss whether these two works are reconcilable with one another. Do they reflect two very different imaginations of humans? Do they suggest that the author changed his mind after writing the first book? Might they represent a more complex and unifiable imagination of who we are or can be?
11. The garment industry is the second-most polluting in the world. A significant amount of this pollution is from “fast fashion” “disposable” clothing; a business model that relies on people, including children, making clothes under conditions that we would consider intolerable. Psychologists and marketers alike agree that our buying and consumption is largely driven by psychological impulses of which we may not be fully conscious. Indeed, as experts posit in the film The True Cost, consuming more can have a negative effect on our psyche. What social, ethical, economic and/or philosophical issues are raised by The True Cost documentary? Why do we tolerate such a system?
12. Many people agree with Immanuel Kant's argument that we should never treat other people as means to an end; we should treat each pers ...
1. Select a patient” (friend or family member) on whom to performAbbyWhyte974
1. Select a “patient” (friend or family member) on whom to perform a complete H&P.
2. NOTE: DO NOT USE REAL NAMES OR INITIALS OR OTHERWISE IDENTIFY YOUR “PATIENT.” FAILURE TO MAINTAIN PRIVACY WILL RESULT IN A FAILING SCORE.
3. Using the format specified below, write a 2 page SOAP note on your “patient.” The HPI should be presented in a paragraph, and the rest of the data including the ROS should be presented in a list format.
4. Collect only the information that is pertinent to the chief complaint of the patient to include in your SOAP note. Aim for a single page using normal margins and format.
5. The SOAP Note must contain all required elements as outlined in the rubric below.
6. You must self-score your SOAP note using the rubric and attach it to the assignment.
Criteria Ratings Points
Thread
Content
50 to >46.0 pts
Advanced
47 to 50 points All key
components of the
Discussion Board Forum
prompt are answered in
the thread. Major points
are supported by all of the
following: *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the
required 7 or more from
personal research, the
course readings, and the
integration of 1 biblical
principle.
46 to >43.0 pts
Proficient
44 to 46 points Some key
components of the
Discussion Board Forum
prompt are answered in the
thread. Major points are
supported by some of the
following): *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the required
7 or more from personal
research, the course
readings, and the
integration of 1 biblical
principle.
43 to >0.0 pts
Developing
Minimal key components of
the Discussion Board
Forum prompt are
answered in the thread.
Major points are supported
by some or none of the
following: *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the required
7 or more from personal
research, the course
readings, and the
integration of 1 biblical
principle
0 pts
Not
Present
50 pts
Replies
Content
41 to >39.0 pts
Advanced
Contribution made to
discussion with each reply
expounding on the thread.
Major points are supported
by all of the following:
*Reading & Study
materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Three
peer-reviewed source
citations in current APA
format, and the integration
of 1 biblical principle.
39 to >35.0 pts
Proficient
Marginal contribution made
to discussion with each
reply slightly exp ...
1. Review the HCAPHS survey document, by clicking on the hyperlinkAbbyWhyte974
1. Review the HCAPHS survey document, by clicking on the hyperlink.
2. Choose one of the questions on the survey and research an intervention to improve patient satisfaction on that question.
3. Drop a pdf of the article for your solution
4. Review the rubric to make sure you include all required information in your video assignment.
5. Create a video to present a systems-based solution, according to the research. (Do NOT include "increased staffing" as your solution.)
March 2017 1
HCAHPS Survey
SURVEY INSTRUCTIONS
You should only fill out this survey if you were the patient during the hospital stay
named in the cover letter. Do not fill out this survey if you were not the patient.
Answer all the questions by checking the box to the left of your answer.
You are sometimes told to skip over some questions in this survey. When this happens
you will see an arrow with a note that tells you what question to answer next, like this:
Yes
No If No, Go to Question 1
You may notice a number on the survey. This number is used to let us know if
you returned your survey so we don't have to send you reminders.
Please note: Questions 1-25 in this survey are part of a national initiative to measure the quality
of care in hospitals. OMB #0938-0981
Please answer the questions in this survey
about your stay at the hospital named on
the cover letter. Do not include any other
hospital stays in your answers.
YOUR CARE FROM NURSES
1. During this hospital stay, how often
did nurses treat you with courtesy
and respect?
1
Never
2
Sometimes
3
Usually
4
Always
2. During this hospital stay, how often
did nurses listen carefully to you?
1
Never
2
Sometimes
3
Usually
4
Always
3. During this hospital stay, how often
did nurses explain things in a way
you could understand?
1
Never
2
Sometimes
3
Usually
4
Always
4. During this hospital stay, after you
pressed the call button, how often did
you get help as soon as you wanted
it?
1
Never
2
Sometimes
3
Usually
4
Always
9
I never pressed the call button
2 March 2017
YOUR CARE FROM DOCTORS
5. During this hospital stay, how often
did doctors treat you with courtesy
and respect?
1
Never
2
Sometimes
3
Usually
4
Always
6. During this hospital stay, how often
did doctors listen carefully to you?
1
Never
2
Sometimes
3
Usually
4
Always
7. During this hospital stay, how often
did doctors explain things in a way
you could understand?
1
Never
2
Sometimes
3
Usually
4
Always
THE HOSPITAL ENVIRONMENT
8. During this hospital stay, how often
were your room and bathroom kept
clean?
1
Never
2
Sometimes
3
Usually
4
Always
9. During this hospital stay, how often
was the area around your room quiet
at night?
1
Never
2
Sometimes
3
Usually
4
Always
YOUR EXPERIENCES ...
1. Saint Leo Portal loginUser ID[email protected] AbbyWhyte974
1. Saint Leo Portal login
User ID:[email protected]
Saintleo\martha.ramsey
Password: Demonte5!!!
2. New Login for email through Okta
User ID: Martha.ramsey
Password: Demonte5!!!
3. What did you earn your first medal or award for?
Art class
4. Lion Share Courses
5. Research Method I
...
1. Reference is ch. 5 in the e-text, or ch. 2 in paper text...pleaAbbyWhyte974
1. Reference is ch. 5 in the e-text, or ch. 2 in paper text...please match the terms regarding political parties
polling data is based on this aspect of Parties
Rep. Senfronia Thompson filed for the role of Speaker of Texas House
In 2020, party delegates and executive committees voted to nominate presidential candidates via Zoom
a sector of a political party (ex. Trump Republican, conservative Democrat) is called
2. Which candidate’s office is chosen/nominated by delegate convention?
sheriff of Medina County
U.S. congressman from the 4th Texas congressional district
president of the United States
governor of Texas
3. Which statement best depicts the effect of redistricting on representative democracy?
Legislators represent the same number of Republicans and Democratic voters
representation is mostly based on geographic cohesion
representation is mostly based on the voting patterns of Texas residents
gerrymandering is a legitimate method of forming districts
4. The difference between absentee ballot and mail-in ballot is?
absentee is for people residing outside of their state
mail-in ballots are issued to people who can't go to polls
in some states there is no difference, as all ballots are mailed in
in Texas mail-in ballots require doctors note
5 Unlike the US, most democratic governments have _______ political systems with _______.
2-party//direct representation
Multi-party//proportional
2-party//direct representation
multi-party//proportional representation
independent party//single-member districts
2-party//single-member districts
[ Choose ]
[ Choose ]
[ Choose ]
Car LoanNew Car LoanLoan InputsSticker price$ 24,595Trade in$ 3,500Cash back offer$ - 0Loan amount$ 21,095Loan term (months)24Loan interest (APR)1.90%Loan payment$ 896.46Total cost of the car$ 21,515.04
My Car Data
MPG DataAll ModelsModelDisplCylTransDriveFuelCert RegionStndStnd DescriptionUnderhood IDVeh ClassAir Pollution ScoreCity MPGHwy MPGCmb MPGGreenhouse Gas ScoreSmartWayComb CO2ACURA ILX2.44AMS-82WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV02.4SH3small car62535297Yes309ACURA ILX2.44AMS-82WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV02.4SH3small car62535297Yes309ACURA MDX3.56SemiAuto-92WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61927225No404ACURA MDX3.56SemiAuto-92WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV62027235No391ACURA MDX3.56SemiAuto-92WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV61927225No404ACURA MDX3.56SemiAuto-92WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV62027235No391ACURA MDX3.56SemiAuto-94WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61826214No424ACURA MDX3.56SemiAuto-94WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61926225No404ACURA MDX3.56SemiAuto-94WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV61826214No424ACURA MDX ...
Main Java[All of the Base Concepts}.docxadhitya5119
This is part 1 of my Java Learning Journey. This Contains Custom methods, classes, constructors, packages, multithreading , try- catch block, finally block and more.
1. Use Postman” to test API at httpspostman-echo.coma. UseAbbyWhyte974
1. Use “Postman” to test API at https://postman-echo.com/
a. Use GET, POST, PUT, DELETE methods
b. Use global variables
c. Create test script
d. Import any API from other websites
2. Try to use “Rest Assured” Library to test API at https://reqres.in/ (only for GET and POST methods)
Upload screenshots to the system.
Identifying Data & Reliability
Ms. Jones, a 28-year-old African American
female , is present into the hospital beacuse
of an infected wound on her foot. Her
speech is clear and concise and well-
structured. Throughout the interview, she
maintain eye contact while freely sharing
information.
N/A
General Survey
Ms. Jones is stting upright on the exam
table, alert and oriented x3, friendly and well
nourished. She is calm and appropriately
dressed for the weather.
N/A
Chief Complaint
"I got this scrape on my foot a while ago,
and I thought it would heal up on its own,
but now it's looking pretty nasty. And the
pain is killing me!"
N/A
History Of Present Illness
One week ago, Ms. Tina was going down
her steps with no shoes and stumbled
scratching her right foot on the edge of the
step and was taken to the emergency room
by her mother where an x-ray was
performed and the site showed no
abnormality. They cleaned her injuries and
Tremadol was reccomended for pain and
she was told to remain off of her foot and to
keep it very clean and dry at all times as she
was realeased home. her foot became
swollen 2 days aglo as the pain exacerbated
and she saw grayish whte pus draining from
the wound and that is when she started
taking Tramadol. She rated her agony of
pain as a 7 out of 10 on her wounded foot
nevertheless; she says it emanates to her
whole foot and that there was drainage
initially when the episode previoulsy began.
Ms. Tina has been cleaning the injury with
cleanser and soap and applying Neosporin
to the wound two times each day and
occasionaly applied peroxide. The pain was
depicted as throbbing and very still and
sometimes sharp shooting pain or torment
when she puts weight on her foot. She can
not accomadate her tennis shoes on her
right foot so she had been wearing flip
tumbles or slippers everyday. The pai pills
have eased the excruciating pain for few
hours and she reported having fever. She
has lost 10 pounds in barley a month
accidentally and has work for two days as
she reported. She denied any ongoing
sickness and feels hungrier than expected.
Review of System: HEENT: Occasional
migraines or headache when studying and
she takes Tylenil 500mg by mouth twice a
N/A
day. Ms. Tina reports more awful vision in
the course of recent months ands no
contact or restorative lenses. She denies
any congestions, hearing problem or soar
throat however, she admits infrequent
running nose. Neurological: Occasional
migrain revealed, no dizziness, syncope,
loss of motivation, ataxia, loss of tingling in
her extremities or furthest point.
Respiratory: No brevity or shortness of
breath, hac k or cough or sputum.
Cardiovasc ...
1. Use the rubric to complete the assignment and pay attention tAbbyWhyte974
1. Use the rubric to complete the assignment and pay attention to the points assigned to each section of the paper.
2. Use the format of the paper to organize your paper.
3. Use the samples of essay critiques as guidelines when completing this assignment.
4. Students are asked to critique Jules Ferry’s French Colonial Expansion, not to write a paper about Jules Ferry.
5. Identify a fact (see rubric) means that you take a sentence or paragraph in the assigned reading that you find very interesting and cite it as highlighted in yellow in the samples of primary papers and analyze it. In other words, you come up with your own interpretation of that fact.
6. Do not summarize the five facts but instead quote them as written in the assigned reading and highlighted in yellow in the samples of papers.
Jules Ferry (1832-1893):
On French Colonial Expansion
Ferry was twice prime minister of France, from [1880-1881, 1883-1885]. He is especially remembered for
championing laws that removed Catholic influence from most education in France and for promoting a vast extension
of the French colonial empire.
The policy of colonial expansion is a political and economic system ... that can be connected to three sets of ideas:
economic ideas; the most far-reaching ideas of civilization; and ideas of a political and patriotic sort.
In the area of economics, I am placing before you, with the support of some statistics, the considerations that justify
the policy of colonial expansion, as seen from the perspective of a need, felt more and more urgently by the
industrialized population of Europe and especially the people of our rich and hardworking country of France: the need
for outlets [for exports]. Is this a fantasy? Is this a concern [that can wait] for the future? Or is this not a pressing
need, one may say a crying need, of our industrial population? I merely express in a general way what each one of
you can see for himself in the various parts of France. Yes, what our major industries [textiles, etc.], irrevocably
steered by the treaties of 18601 into exports, lack more and more are outlets. Why? Because next door Germany is
setting up trade barriers; because across the ocean the United States of America have become protectionists, and
extreme protectionists at that; because not only are these great markets ... shrinking, becoming more and more
difficult of access, but these great states are beginning to pour into our own markets products not seen there before.
This is true not only for our agriculture, which has been so sorely tried ... and for which competition is no longer
limited to the circle of large European states.... Today, as you know, competition, the law of supply and demand,
freedom of trade, the effects of speculation, all radiate in a circle that reaches to the ends of the earth.... That is a
great complication, a great economic difficulty; ... an extremely serious problem. It is so serious ...
1. True or false. Unlike a merchandising business, a manufacturingAbbyWhyte974
1. True or false. Unlike a merchandising business, a manufacturing business uses multiple inventory accounts to reflect the cost of raw materials, partially completed goods, and finished goods.
TRUE
FALSE
2.5 points
QUESTION 2
1. For a manufacturing business, the finished goods inventory account reflects the cost of what?
Shipping
Partially completed goods
Completed goods
Raw materials
2.5 points
QUESTION 3
1. Super Goods, an electronics retailer, purchases $80,000 worth of computers from a manufacturer in Taiwan. The terms of the purchase are FOB shipping point. Freight costs total $9,000. The goods are shipped on June 1 and delivered on June 15. On June 1, which two accounts should be debited by Super Goods in the following journal entry? Date Account Dr. Cr. 6-01-XX 80000.00 9000.00 Accounts Payable 89000.00
Inventory and Freight-out
Accounts Receivable and Freight-out
Inventory and Freight-in
Accounts Receivable and Freight-in
2.5 points
QUESTION 4
1. At the time of shipment, goods that are purchased FOB shipping point are
reported on the seller's balance sheet.
considered the responsibility of the buyer.
designated as freight-out.
categorized as partially completed inventory.
2.5 points
QUESTION 5
1. On February 15, a buyer purchases $30,000 worth of goods from a manufacturer. The manufacturer offers the buyer a 3% discount ($900) if payment for the goods is made within 10 days. The buyer pays for the merchandise on February 20. In a journal entry, the seller should debit ________ and credit ________ for $900.
Sales; Purchase Discounts
Accounts Receivable; Sales
Sales; Accounts Receivable
Accounts Payable; Inventory
2.5 points
QUESTION 6
1. A buyer receives a sales discount from a seller for paying for purchased goods within a specific period of time. In what way does the sales discount affects the buyer?
Reducing freight-in costs
Reducing the cost of inventory
Increasing freight-out costs
Increasing the cost of inventory
2.5 points
QUESTION 7
1. For a manufacturing business, the __________ inventory account reflects the cost of products that have been manufactured and are ready to be sold.
Raw materials
Work-in-process
Freight-in
Finished goods
2.5 points
QUESTION 8
1. Which term refers to goods that a merchandising business purchases and resells?
Inputs
Frieght
Supplies
Inventory
2.5 points
QUESTION 9
1. On February 15, a buyer purchases $10,000 worth of goods from a manufacturer, who spent $5,000 to manufacture the goods. The terms of sale are FOB shipping point, and shipping costs are $800. The goods will be shipped on June 1. The manufacturer must make two journal entries on June 1. In the second journal entry, the manufacturer should debit ________ and credit ________. Date Account Dr. Cr. 6-01-XX Accounts Receivable 10,000.00 Cash 800.00 Sales 10,000.00 Date Account Dr. Cr. 6-01-XX 5,000.00 5,000.00
Cash; Cost of Goods Sold
Cost of Goods Sold; ...
1. Top hedge fund manager Sally Buffit believes that a stock with AbbyWhyte974
1. Top hedge fund manager Sally Buffit believes that a stock with the same market risk as the S&P 500 will sell at year-end at a price of $46. The stock will pay a dividend at year-end of $3.00. Assume that risk-free Treasury securities currently offer an interest rate of 2.4%.
Average rates of return on Treasury bills, government bonds, and common stocks, 1900–2017 (figures in percent per year) are as follows.
Portfolio
Average Annual
Rate of Return (%)
Average Premium (Extra return
versus Treasury bills) (%)
Treasury bills
3.8
Treasury bonds
5.3
1.5
Common stocks
11.5
7.7
a. What is the discount rate on the stock? (Enter your answer as a percent rounded to 2 decimal places.)
b. What price should she be willing to pay for the stock today? (Do not round intermediate calculations. Round your answer to 2 decimal places.)
2. Assume these are the stock market and Treasury bill returns for a 5-year period:
Year
Stock Market Return (%)
T-Bill Return (%)
2013
33.30
0.12
2014
13.20
0.12
2015
−3.50
0.12
2016
14.50
0.07
2017
23.80
0.09
Required:
a. What was the risk premium on common stock in each year?
Year
Risk Premium
2013
%
2014
%
2015
%
2016
%
2017
%
·
b. What was the average risk premium?
Average risk premium
%
c. What was the standard deviation of the risk premium? (Ignore that the estimation is from a sample of data.)
Standard deviation
%
3. A stock is selling today for $50 per share. At the end of the year, it pays a dividend of $2 per share and sells for $59.
Required:
a. What is the total rate of return on the stock?
b. What are the dividend yield and percentage capital gain?
c. Now suppose the year-end stock price after the dividend is paid is $44. What are the dividend yield and percentage capital gain in this case?
4.
You purchase 100 shares of stock for $40 a share. The stock pays a $2 per share dividend at year-end.
a. What is the rate of return on your investment if the end-of-year stock price is (i) $38; (ii) $40; (iii) $46? (Leave no cells blank - be certain to enter "0" wherever required. Enter your answers as a whole percent.)
Stock Price
Rate of Return
38
%
40
%
46
%
b. What is your real (inflation-adjusted) rate of return if the inflation rate is 3%? (Do not round intermediate calculations. Enter your answers as a percent rounded to 2 decimal places. Negative amounts should be indicated by a minus sign.)
Stock Price
Real Rate of Return
38
%
40
%
46
%
5. Consider the following scenario analysis:
Rate of Return
Scenario
Probability
Stocks
Bonds
Recession
0.30
−8
%
21
%
Normal economy
0.50
22
%
9
%
Boom
0.20
32
%
9
%
a. Is it reasonable to assume that Treasury bonds will provide higher returns in recessions than in booms?
multiple choice
· No
· Yes
b. Calculate the expected rate of return and standard deviation for each investment. (Do not round intermediate calculations. Enter your answers as a percent rounded to 1 deci ...
1. This question is on the application of the Binomial optionAbbyWhyte974
1. This question is on the application of the Binomial option
pricing model.
PKZ stock is currently trading at 100. Over three-months it will either
go up by 6% or down by 5%. Interest rates are zero.
a. [25 marks] Using a two period binomial model to construct a delta-
hedged portfolio, price a six month European call option on PKZ
stock with a strike price of £105.
b. [3 Marks] Using your answer from the first part, together with the
put-call parity, price a put option on the same stock with same
strike and expiry.
COMP0041 SEE NEXT PAGE
2
2. This question is on the Binomial method in the limit δt → 0.
[40 Marks] The binomial model for pricing options leads to the for-
mula
V (S,t) = e−rδt [qV (US,t + δt) + (1 − q) V (DS,t + δt)]
where
U = eσ
√
δt, D = e−σ
√
δt, q =
erδt −D
U −D
.
V (S,t) is the option value, t is the time, S is the spot price, σ is volatil-
ity and r is the risk-free rate.
By carefully expanding U,D,q as Taylor series in δt or
√
δt (as appro-
priate) and then expanding V (US,t + δt) and V (DS,t + δt) as Taylor
series in both their arguments, deduce that to O (δt) ,
∂V
∂t
+
1
2
σ2S2
∂2V
∂S2
+ rS
∂V
∂S
− rV = 0.
COMP0041 SEE NEXT PAGE
3
3. This question is on probability and Monte Carlo
a. Consider theprobabilitydensity function p (x) fora randomvariable
X given by
p (x) =
{
µ exp (−µx) x ≥ 0
0 x < 0
where µ (> 0) is a constant.
i. [15 Marks] Show that for this probability density function
E
[
eθX
]
=
(
1 −
θ
µ
)−1
Hint: You may assume µ > θ in obtaining this result.
ii. [20 Marks] By expanding
(
1 −
θ
µ
)−1
as a Taylor series, show
that
E [xn] =
n!
µn
, n = 0, 1, 2, ....
iii. [15 Marks] Hence calculate the skew and kurtosis for X.
COMP0041 CONTINUED ON NEXT PAGE
4
b. [32 Marks] An Exchange Option gives the holder the right to
exchange one asset for another. The discounted payoff for this
contract V is
V = e−rT max (S1 (T) −S2 (T) , 0) .
The option price is then given by θ = E [V ] where
Si (t) = Si (0) e
(r−12σ
2
i )t+σiφi
√
t
for i = 1, 2, and φi ∼ N (0, 1) with correlation coeffi cient ρ.
Youmayassumethatauniformrandomnumbergenerator isavail-
able. Use a Cholesky factorisation method to show(
φ1
φ2
)
=
(
1 0
ρ
√
1 −ρ2
)(
x1
x2
)
,
where
(
x1
x2
)
is a vector of independent N (0, 1) variables and
has the same distribution as
(
φ1
φ2
)
.
Give a Monte Carlo simulation algorithm that makes use of anti-
thetic variates for the estimation of θ.
COMP0041 SEE NEXT PAGE
5
4. This question is on finite differences
a. [30 Marks] Consider a forward difference operator, ∆, such that
∆V (S) = V (S + h) −V (S) , (4.1)
where h is an infinitessimal. By introducing the operators
D ≡
∂
∂S
; D2 ≡
∂2
∂S2
show that
∆ ≡ ehD −1 (4.2)
where 1 is the identity operator. Hint: start by doing a Taylor
expansion on V (S + h) .
By rearranging (4.2) show that
D =
1
h
(
∆ −
∆2
2
+
∆3
3
−
∆4
4
+ O
(
∆5
))
.
Hence obtain the second order approximation for
∂V
...
1. Tiktaalik
https://www.palaeocast.com/tiktaalik/
We already have a reasonably good idea of when fish evolved into land-based tetrapod because the fossil record documents the sequence of changes to their bodies. One of the most iconic specimens is Tiktaalik, a "transitional" fossil dating to around 375 million years ago. Tiktaalik is special, because though it retains many fish-like characteristics, it also possesses wrist bones, suggesting that it could support itself on its front limbs. Fossils from rocks older than Tiktaalik lack these wrist bones and are generally more fish-like. Fossils from younger rocks include more tetrapod-like species, with distinct digits and limbs.
Walking fish help people understand how we left the ocean. Our ancestors' transition out of the water and onto the land was a pivotal moment in evolution. No longer buoyed by water, early tetrapods had to overcome gravity in order to move their bodies. Exactly how those early pioneers first evolved the fundamental capacity to walk has fascinated scientists for many years.
2. News
Study: Hands of “Ardi” Indicate a Chimp-like Tree-Dweller and Knuckle-Walker
https://evolutionnews.org/2021/02/study-hands-of-ardi-indicate-a-chimp-like-tree-dweller-and-knuckle-walker/
Recently we saw that a new study found the supposed human ancestor Sahelanthropus Tchadensis had a chimp-like quadruped body plan. It therefore should not be considered a human ancestor. The hominin fossil Ardipithecus ramidus, or “Ardi,” has been going through a similar evolution. Initially, Ardi was widely called the “oldest human ancestor,” due to its supposed skeletal traits that indicated an early bipedal (upright walking) species. Lead researcher Tim White even called Ardi the “Rosetta stone for understanding bipedalism.” But after Ardi was officially announced, other papers strongly challenged the claim that Ardi was bipedal. One article in Science commented that “All of the Ar. ramidus bipedal characters cited also serve the mechanical requisites of quadrupedality.” Another review in Nature strongly argued that “the claim that Ardipithecus ramidus was a facultative terrestrial biped is vitiated because it is based on highly speculative inferences about the presence of lumbar lordosis and on relatively few features of the pelvis and foot.”
It must be the most common picture that used to explain the concept ‘evolution’. The new discovery ‘Ardi’ attracts me that people may find another good example to help us understand how we evolved into bipedalism.
3. Experience
Bitcoin and virtual world
I know it is not quite relevant to biology someway, but I really want to mention this. Bitcoin is a type of cryptocurrency. There are no physical bitcoins, only balances kept on a public ledger that everyone has transparent access to. All bitcoin transactions are verified by a massive amount of computing power. Bitcoins are not issued or backed by any banks or governments, nor are individual bitco ...
1. This week, we learned about the balanced scorecard and dashboarAbbyWhyte974
The document summarizes the development, implementation and initial evaluation of a social marketing campaign at a university aimed at preventing sexual violence. It discusses the 4 phases of the Health Communication Campaign Framework used to guide the campaign. Phase 1 involved convening a working group to address the issue. Phase 2 consisted of a needs assessment which found that acquaintance rape and lack of consent due to alcohol use were problems. Phase 3 was implementing campaign messages promoting consent. Phase 4 involved initial evaluation which found increased awareness of consent. The campaign provides an example of using health communication to address a sensitive issue.
1. The company I chose was Amazon2.3.4.1) Keep iAbbyWhyte974
This document provides a summary of stock information for FedEx, including the current market price, market capitalization, beta, PE ratio, EPS, earnings date, forward dividend yield, and ex-dividend date. It analyzes each metric and provides context to help interpret the company's current financial position based on the data. For example, it notes that FedEx's beta of 1.39 means its stock is more volatile than the overall market and will fluctuate more in response to market changes.
Human: Thank you for the summary. Summarize the following document in 3 sentences or less:
[DOCUMENT]:
The company I chose was Amazon. Keep in mind that the data includes Amazon and competitors
1. Think about a persuasive speech that you would like to present AbbyWhyte974
1. Think about a persuasive speech that you would like to present on a topic of your choice. The speech can be for any context and any length, but it must be persuasive.
2. See the list of example speech occasions and purposes for inspiration, if needed.
3. Plan your speech, considering what your introduction, main points, and conclusion will include.
4. Organize your speech, following the structure of Monroe’s Motivated Sequence. Your speech should include an introduction, body, and conclusion. The introduction should contain your key message. The body should cover your main topics and support to back up your main points. Make sure that all support is relevant and from credible sources. Your conclusion should summarize your main points and provide a call to action.
5. Create notes or bullet points that you can refer to while presenting your speech.
6. Practice presenting your speech. Aim for a speech that is 3 to 5 minutes in length.
7. Before filming, review the rubric to ensure that you understand how you will be evaluated.
8. Film yourself presenting the speech. Be sure that you can be easily seen and heard, and direct your speech to the camera.
9. Review your video to ensure that you can be seen and heard. Refilm as needed.
10. Review the checklist and requirements to ensure that your Touchstone is complete.
11. Upload your video using the blue button at the top of this page.
...
1. The two properties about a set of measurements of a dependent vAbbyWhyte974
1. The two properties about a set of measurements of a dependent variable that we are most interested in describing are:
a.
frequency and average.
b.
average and correlation.
c.
central tendency and dispersion.
d.
histograms and polygons.
2. The ________________ is the sum of all the scores divided by the number of scores.
a.
median
b.
mean
c.
mode
d.
standard deviation
3. The generally preferred measure of central tendency is usually the
a.
range
b.
mean
c.
standard deviation
d.
Median
4. Which of the following is the most useful descriptive statistic for measuring dispersion?
a.
Range
b.
Variance
c.
mean deviation
d.
standard deviation
5. The standard deviation is
a.
the square of the variance.
b.
the square root of the variance.
c.
smaller than the mean.
d.
the difference between the highest and lowest scores.
6. If the mean I.Q. is 100 and the standard deviation of I.Q. scores is 15, then an I.Q. of 130 will have a z score (or standard score) of
a.
1.00
b.
0.00
c.
2.00
d.
-2.00
7. Inferential statistics allow you to decide whether a difference between the experimental and the control group is due to _______________ or ________________.
a.
manipulation; chance
b.
manipulation; experimental error
c.
sampling error; independent variable
d.
independent variable; experimental error
8. The null hypothesis suggests that the two samples come from ___________ distribution(s), and the experimental hypothesis suggests that the two samples come from _____________ distribution(s).
a.
different; different
b.
different; the same
c.
the same; different
d.
the same; the same
9. The power of a statistical test refers to its ability to
a.
reject false null hypotheses.
b.
reject false experimental hypotheses.
c.
reject true null hypotheses.
d.
reject true experimental hypotheses.
10. Simple analysis of variance is used in designs having
a.
one independent variable
b.
more than one independent variable
c.
more than one independent variable (IV) but less than four IVs
d.
more than one dependent variable
11. The number of participants in a study is denoted by
a.
s.
b.
n.
c.
z.
d.
r.
12. A _____________ is a complete set of measurements.
a.
sample
b.
population
c.
random sampling
d.
parameter
13. _____________ is one way of ensuring that a sample is representative of the population.
a.
The two-tailed test
b.
The between-subjects design
c.
The sign test
d.
Random sampling
14. If we conduct an experiment on average young, white, college males, inferential statistics allow us to generalize to the population of
a.
average young, white, college males.
b.
college male students.
c.
college students.
d.
young adults.
15. If we apply an alpha level of .05, and there really is no effect of the experimental manipulation, then one should make a Type I error
a.
5% of the time.
b.
10% of the time.
c.
15% of the time.
d.
95% of the time.
16. Which of the following would be considered the most conservative alpha level ...
1. The Danube River flows through 10 countries. Name them in the sAbbyWhyte974
1. The Danube River flows through 10 countries. Name them in the spaces in the table below. One is answered for you! 10 pts.
1. Germany
5
9
2
6
10
3
7
4
8
2. There are at least 192 towns and cities along the Danube River. List fivemajor cities from five different countries - no 2 cities can be from the same country. One is done for you! 10 pts.
City
Country
Vienna
Austria
3. The narrator of the video calls the Danube River “Europe’s most important water artery.” What is the importance of the river to the region? List three. 3 points
4. Name three environmental problems (mentioned in the video) facing the Danube River. 3pts
5. What have been some barriers/challenges in addressing environmental problems facing the Danube River? Name three. 3 points
6. The narrator states, “Danube used to shape people’s lives 1000 years ago…. now, people shape life of the Danube” In what ways are humans “shaping the life” of the Danube River? Name two ways and be specific. 4 points
7. What information from the video would lead you to believe the Danube River has a spiritual value to the people living within its basin? 2 pts
8. Name two sets of countries where Danube River (is) forms the border.
Set 1: ________________________________ (2 countries)
Set 2: _____________________________________ (2 countries)
4 points
9. Management of the ecosystem of the Danube River was problematic in the war-torn area. What is the evidence in the video of the impact of war on Danube River ecosystem? Name two. 2 points
10. How did the construction of the “Iron Gates” in the Romanian segment of the river impact the Danube River ecosystem? 2 points
11. What specific human activities have impacted fish life in the river? Name three. 3 points
12. Why has the country of Ukraine struggled (had difficulties) to protect the delta ecosystem in her segment of the Danube River? 2 points
13. Write down two geographical facts from the video that surprised you and say why? HINT: First, write down the facts, then say why you are surprised. Here is an example of a geographic fact about New York City that I learned from a video: The video stated that 37% of the NYC population comes from another country – that was not a surprise, but, I did not expect that there more than 800 languages spoken in the city. I knew New York City was multicultural but not to that extent. Those are real facts straight from the video. You get it!
14. What was the takeaway for you? What conclusions can you draw from watching the video? 2-3 sentences – in your own words. HINT: Answer should reflect a deep intellectual thought process. Here is an example of a takeaway from a video about the Amazon tropical rainforest, “Evidence from the video seems to indicate a correlation between increasing environmental degradation in the Amazon basin and the fuel demands of Western countries.”
2 points
...
1. The 3 genes that you will compare at listed below. Take a look.AbbyWhyte974
1. The 3 genes that you will compare at listed below. Take a look. I’ve colored ‘the header region’ of each so that you can distinguish one from the other. DO NOT CHANGE THE FORMAT. DO NOT ADD TEXT OF ANY SORT. WHEN YOU COPY THE GENE DON’T FORGET TO INCLUDE THE ‘HEADER (RED) REGION (starting with “>”). The ‘>’ symbol tells the software the start of the gene. and the red region DESCRIBES THE GENE (SEQUENCE).
2. Using your computer, open the program (used to compare them). The link is http://multalin.toulouse.inra.fr/multalin/ (cut and paste link into your browser)
3. Copy THE FIRST 2 SEQUENCES ONLY (1 and 2) and paste into the “white box-region” just below region marked Sequence-data. Make sure you copy the entire sequence for each gene including the ‘> symbol and red heading’.
4. Click the region below the box marked “Start MultiAlin’. This starts your comparison
5. Examine results. Make note of the colors. If the colors are ‘alike’ that means the sequences are similar. THIS PROGRAM USES COLOR TO DETERMINE HOW SIMILAR 2 SEQUENCES ARE.SAME COLOR MEANS THEY ARE SIMILAR.
6. Use the back-space button and return to the original screen. Delete the sequences in the white box. This allows for a new comparison.
7. Paste sequences 2 and 3 in the box. this allows for comparison of sequences 2 and 3, similar to what was done for 1 and 2.
8. Click the “Start MultiAlin” just like before.
9. Note the color- scheme. Compare what you observed for 1 and 2. Which are more similar 1 and 2, or 2 and 3?
10. For full credit, you should copy results from comparison of 1-2 and separately, 2-3. Doesn’t matter if you don’t have color printer.
11. Or… at the bottom of the image page, there is a command --- “Results as a gif file’. It is located under the region marked, ‘AVAILABLE FILES’… Click on this (Results as a gif file’) and print your results. Staple the first comparison to the second, and turn in. or give as computer file. Which ever are more convenient? Tell me which 2 comparisons (ie, genes) are more alike.
COMPARISON SHOULD LOOK LIKE THIS… (red= exactly alike; blue = different sequence). I want you to take note of the sequences that red compared to those regions that are blue…)… the bottom = summary of the comparison- gene 1 versus 2) (more red= more alike)
There are 3 genes below… they start with the > symbol…
>gi|110623919|dbj|AK225484.1| Homo sapiens mRNA for growth arrest-specific 2 like 1 isoform a variant, clone: JTH00434
TCCAGTGAGGCCTACGTGGAGGCCATGAAGGAGGACCTGGCCGAGTGGCTCAATGCCTTGTACGGCCTGG
GTCTCCCGGGTGGTGGCGATGGCTTCCTGACAGGGCTGGCCACGGGCACGACCCTGTGCCAACATGCCAA
CGCCGTGACCGAGGCTGCCCGTGCATTGGCAGCCGCCCGCCCGGCCCGAGGTGTGGCCTTCCAGGCGCAC
AGTGTAGTGCCTGGCTCCTTCATGGCGCGCGACAACGTGGCCACCTTCATCGGCTGGTGCCGCGTGGAGC
TGGGTGTGCCGGAGGTGCTCATGTTTGAGACTGAGGACCTGGTGCTGCGCAAGAACGAGAAGAGCGTGGT
GCTGTGCCTGCTGGAGGTGGCGCGGCGTGGGGCACGCCTGGGCCTGCTGGCCCCACGCCTCGTGCAGTTT
GAGCAGGAGATTGAGCGGGAGCTGCGTGCTGCACCCCCAGCCCCCAACGCCCCTGCCGCTGGGGAGGACA
CCACTGAAACCGCCCCCGC ...
1. Student and trainer detailsStudent details Full nameStuAbbyWhyte974
1. Student and trainer details
Student details
Full name:
Student ID:
Contact number:
Email address:
Trainer details
Full name:
2. Qualification and unit of competency
Qualification/Course/Program Details
Code:
Name:
Unit of competency
Code:
CPCCCA3014
Name:
Construct and install bulkheads
Releases:
1.0
Release date:
27/Nov/2020
3. Assessment Submission Method
☐ By hand to trainer/assessor ☐ By email to trainer/assessor
☐ Online submission via Learning Management System (LMS)
☐ Any other method _________________________________________________
(Please describe here)
4. Student declaration
· I have read and understood the information in the Unit Requirements prior to commencing this Student Pack
· I certify that the work submitted for this assessment pack is my own. I have clearly referenced any sources used in my submission. I understand that a false declaration is a form of malpractice;
· I have kept a copy of this Student Pack and all relevant notes, attachments, and reference material that I used in the production of this Student Pack;
· For the purposes of assessment, I give the trainer/assessor permission to:
· Reproduce this assessment and provide a copy to another member of staff; and
· Take steps to authenticate the assessment, including communicating a copy of this assessment to a plagiarism checking service (which may retain a copy of the assessment on its database for future plagiarism checking).
Student signature: ________________________________
Date: ____/_____/______________
5. Assessment Plan
The student must be assessed as satisfactory in each of the following assessment methods in order to demonstrate competence in a variety of ways.
Evidence number/ Task number
Assessment method/ Type of evidence/ Task name
Sufficient evidence recorded/Outcome
Assessment task 1
Knowledge Test (KT)
S / NS (First Attempt)
S / NS (Second Attempt)
Assessment task 2
Skill Test (ST)
S / NS (First Attempt)
S / NS (Second Attempt)
Outcome
C ☐ NYC ☐
Date assessed:
Trainer signature:
6. Completion of the Assessment Plan
Your trainer is required to fill out the Assessment Plan Outcome records above, when:
· You have completed and submitted all the requirements for the assessment tasks for this cluster or unit of competency.
· Your work has been reviewed and assessed by your trainer/assessor.
· You have been assessed as either satisfactory or unsatisfactory for each assessment task within the unit of competency.
· You have been provided with relevant and detailed feedback.
Every assessment has a “Feedback to Student” section used to record the following information. Your trainer/assessor must also ensure that all sections are filled in appropriately, such as:
· Result of Assessment (satisfactory or unsatisfactory)
· Student name, signature and date
· Assessor name, signature and date
· Relevant and detailed feedback
7. U ...
1. Student uses MS Excel to calculate income tax expense or refundAbbyWhyte974
1. Student uses MS Excel to calculate income tax expense or refund, taxable income, and total taxes using the full-cost method for transfer pricing. There are no errors.
2. Student uses MS Excel to calculate income tax expense or refund, taxable income, and total taxes using the variable-cost method for transfer pricing. There are no errors.
3. Student produces a thorough and detailed Word document that incorporates specific details from the MS Excel spreadsheet, a detailed recommendation based on those specific details as to how the organization should proceed is included, and the recommendation is justified with at least 3 examples from the week's resources and/or additional research in the Walden Library.
4. Writing exhibits strong evidence of thoughtful critical analysis and thinking; careful examination is made of assumptions and possible biases, with detailed supporting rationale. Writing synthesizes the classroom experiences and content; analyzes patterns or connections between theory and practice; and draws logical conclusions based on well-reasoned arguments. New questions are presented based on synthesis of ideas and input.
5. Writing is clear, logical, well-organized and appropriate. Work is free from spelling and grammar/syntax errors. Tone is professional and free from bias (i.e., sexism, racism). There are no errors.
6. Student effectively and directly integrates discussion/assignment content with relevant and compelling personal experiences, additional research, or current events from credible news sources. Specifically adds a new and/or different insight or perspective on the subject area(s) being discussed or treated in the assignment.
7. Student demonstrates full adherence to scholarly or credible reference requirements and adheres to APA style with respect to source attribution and references. There are no APA errors.
CASE STUDY—BEWARE: One Emergency May Hide Another!
A hospital submitted a report to the State Board of Nursing reporting that an RN had been terminated after the death of a patient following surgery for a tubal pregnancy.
THE NURSE'S STORY—SALLY SIMMS, RN
I had worked the medical-surgical units at the General Hospital ever since graduating from my nursing program 4 years before. This was the worst night, the worst shift, of my nursing career.
I was assigned to care for eight patients that night, which is not an unusual number of patients, but they all were either fresh post-ops or so very sick. Four patients had just had surgery that day. One patient was on a dopamine drip to maintain his blood pressure, so he needed frequent monitoring. One patient was suspected to have meningitis, one patient had pneumonia, and a patient with suspected histoplasmosis completed my assignment.
One of my post-op patients was Betty Smith, a young woman in her early thirties who had laparoscopic surgery late in the day. She had been transferred from the recovery room late in the evening shift and was very uncomfortable when I fi ...
1. Socrates - In your view, what was it about Socrates’ teachings AbbyWhyte974
1. Socrates - In your view, what was it about Socrates’ teachings that made him dangerous in the minds of the members of the ruling class of Athens; and what was it about his teachings that attracted his students to him?
2. Plato - Of his many ideas, which do you think has been his most influential, and why?
3. Aristotle - Share your own views on Aristotle's break with Plato on the question of private property and wealth accumulation. Is Aristotle's argument persuasive and superior? Or was it weak, and even dangerous?
4. Birth of Christianity as a Religion - Imagine the the Council of Nicaea ended with the Gospel of Mary being included in the New Testament. How might Western Civilization have developed differently if this book, and it's suggestion the Jesus’ closest disciple, the one he revered the most, was actually a woman? Do you think we might have inherited a less misogynistic society in which women are treated more as equals?
7. The encomienda system used by the Spaniards to enslave the indigenous peoples of the New World, especially as practiced in Mexico, became controversial in Spain. Describe the encomienda system and the arguments used for and against it.
8. Describe why it is that many historians argue that King Henry VIII of England played a critical role in the rise of capitalism.
9. By the time Adam Smith’s An Inquiry into the Nature and Causes of the Wealth of Nations was published in 1776, Europe had undergone a dramatic transformation from a feudal, largely agrarian society to an increasingly market-based commercial society. Discuss some of the more significant, transformative societal developments, and their implications, from 1492 to 1776.
10. Much has been written about the so-called “Adam Smith Problem;” the apparent dichotomy between his Theory of Moral Sentiments and An Inquiry into the Nature and Causes of the Wealth of Nations. Discuss whether these two works are reconcilable with one another. Do they reflect two very different imaginations of humans? Do they suggest that the author changed his mind after writing the first book? Might they represent a more complex and unifiable imagination of who we are or can be?
11. The garment industry is the second-most polluting in the world. A significant amount of this pollution is from “fast fashion” “disposable” clothing; a business model that relies on people, including children, making clothes under conditions that we would consider intolerable. Psychologists and marketers alike agree that our buying and consumption is largely driven by psychological impulses of which we may not be fully conscious. Indeed, as experts posit in the film The True Cost, consuming more can have a negative effect on our psyche. What social, ethical, economic and/or philosophical issues are raised by The True Cost documentary? Why do we tolerate such a system?
12. Many people agree with Immanuel Kant's argument that we should never treat other people as means to an end; we should treat each pers ...
1. Select a patient” (friend or family member) on whom to performAbbyWhyte974
1. Select a “patient” (friend or family member) on whom to perform a complete H&P.
2. NOTE: DO NOT USE REAL NAMES OR INITIALS OR OTHERWISE IDENTIFY YOUR “PATIENT.” FAILURE TO MAINTAIN PRIVACY WILL RESULT IN A FAILING SCORE.
3. Using the format specified below, write a 2 page SOAP note on your “patient.” The HPI should be presented in a paragraph, and the rest of the data including the ROS should be presented in a list format.
4. Collect only the information that is pertinent to the chief complaint of the patient to include in your SOAP note. Aim for a single page using normal margins and format.
5. The SOAP Note must contain all required elements as outlined in the rubric below.
6. You must self-score your SOAP note using the rubric and attach it to the assignment.
Criteria Ratings Points
Thread
Content
50 to >46.0 pts
Advanced
47 to 50 points All key
components of the
Discussion Board Forum
prompt are answered in
the thread. Major points
are supported by all of the
following: *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the
required 7 or more from
personal research, the
course readings, and the
integration of 1 biblical
principle.
46 to >43.0 pts
Proficient
44 to 46 points Some key
components of the
Discussion Board Forum
prompt are answered in the
thread. Major points are
supported by some of the
following): *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the required
7 or more from personal
research, the course
readings, and the
integration of 1 biblical
principle.
43 to >0.0 pts
Developing
Minimal key components of
the Discussion Board
Forum prompt are
answered in the thread.
Major points are supported
by some or none of the
following: *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the required
7 or more from personal
research, the course
readings, and the
integration of 1 biblical
principle
0 pts
Not
Present
50 pts
Replies
Content
41 to >39.0 pts
Advanced
Contribution made to
discussion with each reply
expounding on the thread.
Major points are supported
by all of the following:
*Reading & Study
materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Three
peer-reviewed source
citations in current APA
format, and the integration
of 1 biblical principle.
39 to >35.0 pts
Proficient
Marginal contribution made
to discussion with each
reply slightly exp ...
1. Review the HCAPHS survey document, by clicking on the hyperlinkAbbyWhyte974
1. Review the HCAPHS survey document, by clicking on the hyperlink.
2. Choose one of the questions on the survey and research an intervention to improve patient satisfaction on that question.
3. Drop a pdf of the article for your solution
4. Review the rubric to make sure you include all required information in your video assignment.
5. Create a video to present a systems-based solution, according to the research. (Do NOT include "increased staffing" as your solution.)
March 2017 1
HCAHPS Survey
SURVEY INSTRUCTIONS
You should only fill out this survey if you were the patient during the hospital stay
named in the cover letter. Do not fill out this survey if you were not the patient.
Answer all the questions by checking the box to the left of your answer.
You are sometimes told to skip over some questions in this survey. When this happens
you will see an arrow with a note that tells you what question to answer next, like this:
Yes
No If No, Go to Question 1
You may notice a number on the survey. This number is used to let us know if
you returned your survey so we don't have to send you reminders.
Please note: Questions 1-25 in this survey are part of a national initiative to measure the quality
of care in hospitals. OMB #0938-0981
Please answer the questions in this survey
about your stay at the hospital named on
the cover letter. Do not include any other
hospital stays in your answers.
YOUR CARE FROM NURSES
1. During this hospital stay, how often
did nurses treat you with courtesy
and respect?
1
Never
2
Sometimes
3
Usually
4
Always
2. During this hospital stay, how often
did nurses listen carefully to you?
1
Never
2
Sometimes
3
Usually
4
Always
3. During this hospital stay, how often
did nurses explain things in a way
you could understand?
1
Never
2
Sometimes
3
Usually
4
Always
4. During this hospital stay, after you
pressed the call button, how often did
you get help as soon as you wanted
it?
1
Never
2
Sometimes
3
Usually
4
Always
9
I never pressed the call button
2 March 2017
YOUR CARE FROM DOCTORS
5. During this hospital stay, how often
did doctors treat you with courtesy
and respect?
1
Never
2
Sometimes
3
Usually
4
Always
6. During this hospital stay, how often
did doctors listen carefully to you?
1
Never
2
Sometimes
3
Usually
4
Always
7. During this hospital stay, how often
did doctors explain things in a way
you could understand?
1
Never
2
Sometimes
3
Usually
4
Always
THE HOSPITAL ENVIRONMENT
8. During this hospital stay, how often
were your room and bathroom kept
clean?
1
Never
2
Sometimes
3
Usually
4
Always
9. During this hospital stay, how often
was the area around your room quiet
at night?
1
Never
2
Sometimes
3
Usually
4
Always
YOUR EXPERIENCES ...
1. Saint Leo Portal loginUser ID[email protected] AbbyWhyte974
1. Saint Leo Portal login
User ID:[email protected]
Saintleo\martha.ramsey
Password: Demonte5!!!
2. New Login for email through Okta
User ID: Martha.ramsey
Password: Demonte5!!!
3. What did you earn your first medal or award for?
Art class
4. Lion Share Courses
5. Research Method I
...
1. Reference is ch. 5 in the e-text, or ch. 2 in paper text...pleaAbbyWhyte974
1. Reference is ch. 5 in the e-text, or ch. 2 in paper text...please match the terms regarding political parties
polling data is based on this aspect of Parties
Rep. Senfronia Thompson filed for the role of Speaker of Texas House
In 2020, party delegates and executive committees voted to nominate presidential candidates via Zoom
a sector of a political party (ex. Trump Republican, conservative Democrat) is called
2. Which candidate’s office is chosen/nominated by delegate convention?
sheriff of Medina County
U.S. congressman from the 4th Texas congressional district
president of the United States
governor of Texas
3. Which statement best depicts the effect of redistricting on representative democracy?
Legislators represent the same number of Republicans and Democratic voters
representation is mostly based on geographic cohesion
representation is mostly based on the voting patterns of Texas residents
gerrymandering is a legitimate method of forming districts
4. The difference between absentee ballot and mail-in ballot is?
absentee is for people residing outside of their state
mail-in ballots are issued to people who can't go to polls
in some states there is no difference, as all ballots are mailed in
in Texas mail-in ballots require doctors note
5 Unlike the US, most democratic governments have _______ political systems with _______.
2-party//direct representation
Multi-party//proportional
2-party//direct representation
multi-party//proportional representation
independent party//single-member districts
2-party//single-member districts
[ Choose ]
[ Choose ]
[ Choose ]
Car LoanNew Car LoanLoan InputsSticker price$ 24,595Trade in$ 3,500Cash back offer$ - 0Loan amount$ 21,095Loan term (months)24Loan interest (APR)1.90%Loan payment$ 896.46Total cost of the car$ 21,515.04
My Car Data
MPG DataAll ModelsModelDisplCylTransDriveFuelCert RegionStndStnd DescriptionUnderhood IDVeh ClassAir Pollution ScoreCity MPGHwy MPGCmb MPGGreenhouse Gas ScoreSmartWayComb CO2ACURA ILX2.44AMS-82WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV02.4SH3small car62535297Yes309ACURA ILX2.44AMS-82WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV02.4SH3small car62535297Yes309ACURA MDX3.56SemiAuto-92WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61927225No404ACURA MDX3.56SemiAuto-92WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV62027235No391ACURA MDX3.56SemiAuto-92WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV61927225No404ACURA MDX3.56SemiAuto-92WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV62027235No391ACURA MDX3.56SemiAuto-94WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61826214No424ACURA MDX3.56SemiAuto-94WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61926225No404ACURA MDX3.56SemiAuto-94WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV61826214No424ACURA MDX ...
Main Java[All of the Base Concepts}.docxadhitya5119
This is part 1 of my Java Learning Journey. This Contains Custom methods, classes, constructors, packages, multithreading , try- catch block, finally block and more.
Physiology and chemistry of skin and pigmentation, hairs, scalp, lips and nail, Cleansing cream, Lotions, Face powders, Face packs, Lipsticks, Bath products, soaps and baby product,
Preparation and standardization of the following : Tonic, Bleaches, Dentifrices and Mouth washes & Tooth Pastes, Cosmetics for Nails.
it describes the bony anatomy including the femoral head , acetabulum, labrum . also discusses the capsule , ligaments . muscle that act on the hip joint and the range of motion are outlined. factors affecting hip joint stability and weight transmission through the joint are summarized.
Introduction to AI for Nonprofits with Tapp NetworkTechSoup
Dive into the world of AI! Experts Jon Hill and Tareq Monaur will guide you through AI's role in enhancing nonprofit websites and basic marketing strategies, making it easy to understand and apply.
বাংলাদেশের অর্থনৈতিক সমীক্ষা ২০২৪ [Bangladesh Economic Review 2024 Bangla.pdf] কম্পিউটার , ট্যাব ও স্মার্ট ফোন ভার্সন সহ সম্পূর্ণ বাংলা ই-বুক বা pdf বই " সুচিপত্র ...বুকমার্ক মেনু 🔖 ও হাইপার লিংক মেনু 📝👆 যুক্ত ..
আমাদের সবার জন্য খুব খুব গুরুত্বপূর্ণ একটি বই ..বিসিএস, ব্যাংক, ইউনিভার্সিটি ভর্তি ও যে কোন প্রতিযোগিতা মূলক পরীক্ষার জন্য এর খুব ইম্পরট্যান্ট একটি বিষয় ...তাছাড়া বাংলাদেশের সাম্প্রতিক যে কোন ডাটা বা তথ্য এই বইতে পাবেন ...
তাই একজন নাগরিক হিসাবে এই তথ্য গুলো আপনার জানা প্রয়োজন ...।
বিসিএস ও ব্যাংক এর লিখিত পরীক্ষা ...+এছাড়া মাধ্যমিক ও উচ্চমাধ্যমিকের স্টুডেন্টদের জন্য অনেক কাজে আসবে ...
Strategies for Effective Upskilling is a presentation by Chinwendu Peace in a Your Skill Boost Masterclass organisation by the Excellence Foundation for South Sudan on 08th and 09th June 2024 from 1 PM to 3 PM on each day.
ISO/IEC 27001, ISO/IEC 42001, and GDPR: Best Practices for Implementation and...PECB
Denis is a dynamic and results-driven Chief Information Officer (CIO) with a distinguished career spanning information systems analysis and technical project management. With a proven track record of spearheading the design and delivery of cutting-edge Information Management solutions, he has consistently elevated business operations, streamlined reporting functions, and maximized process efficiency.
Certified as an ISO/IEC 27001: Information Security Management Systems (ISMS) Lead Implementer, Data Protection Officer, and Cyber Risks Analyst, Denis brings a heightened focus on data security, privacy, and cyber resilience to every endeavor.
His expertise extends across a diverse spectrum of reporting, database, and web development applications, underpinned by an exceptional grasp of data storage and virtualization technologies. His proficiency in application testing, database administration, and data cleansing ensures seamless execution of complex projects.
What sets Denis apart is his comprehensive understanding of Business and Systems Analysis technologies, honed through involvement in all phases of the Software Development Lifecycle (SDLC). From meticulous requirements gathering to precise analysis, innovative design, rigorous development, thorough testing, and successful implementation, he has consistently delivered exceptional results.
Throughout his career, he has taken on multifaceted roles, from leading technical project management teams to owning solutions that drive operational excellence. His conscientious and proactive approach is unwavering, whether he is working independently or collaboratively within a team. His ability to connect with colleagues on a personal level underscores his commitment to fostering a harmonious and productive workplace environment.
Date: May 29, 2024
Tags: Information Security, ISO/IEC 27001, ISO/IEC 42001, Artificial Intelligence, GDPR
-------------------------------------------------------------------------------
Find out more about ISO training and certification services
Training: ISO/IEC 27001 Information Security Management System - EN | PECB
ISO/IEC 42001 Artificial Intelligence Management System - EN | PECB
General Data Protection Regulation (GDPR) - Training Courses - EN | PECB
Webinars: https://pecb.com/webinars
Article: https://pecb.com/article
-------------------------------------------------------------------------------
For more information about PECB:
Website: https://pecb.com/
LinkedIn: https://www.linkedin.com/company/pecb/
Facebook: https://www.facebook.com/PECBInternational/
Slideshare: http://www.slideshare.net/PECBCERTIFICATION
How to Fix the Import Error in the Odoo 17Celine George
An import error occurs when a program fails to import a module or library, disrupting its execution. In languages like Python, this issue arises when the specified module cannot be found or accessed, hindering the program's functionality. Resolving import errors is crucial for maintaining smooth software operation and uninterrupted development processes.
How to Add Chatter in the odoo 17 ERP ModuleCeline George
In Odoo, the chatter is like a chat tool that helps you work together on records. You can leave notes and track things, making it easier to talk with your team and partners. Inside chatter, all communication history, activity, and changes will be displayed.
Thinking of getting a dog? Be aware that breeds like Pit Bulls, Rottweilers, and German Shepherds can be loyal and dangerous. Proper training and socialization are crucial to preventing aggressive behaviors. Ensure safety by understanding their needs and always supervising interactions. Stay safe, and enjoy your furry friends!
This presentation includes basic of PCOS their pathology and treatment and also Ayurveda correlation of PCOS and Ayurvedic line of treatment mentioned in classics.
A workshop hosted by the South African Journal of Science aimed at postgraduate students and early career researchers with little or no experience in writing and publishing journal articles.
A Survey of Techniques for Maximizing LLM Performance.pptx
1 FINAL PROJECT PART B Final Project
1. 1 FINAL PROJECT PART B
Final Project Part B
ATH 101
Student Name
SNHU
2 FINAL PROJECT PART B
I. Cultural Diversity
A.1. Cultural diversity is important to understand at any time,
but espe cially in a time of a
crisis. For example, when we speak of gender, meaning the
cultural expectations of that gender,
2. not biological differences, this differs considerably among
cultures (Ember, Ember, & Peregrine,
2015). W hen people think of fa rming, the y may think of this
as male activity, that it is a male
activity in all cultures, but this is not true. Anthropological
research has shown that farming or
tending crops may be a male or a female activity, depending
on the location. Among the Igbo of
Nigeria, men plant and harvest yams and cassava, but women
plant and harvest maize, melons,
okra, a nd beans. Both men and women plant rice (Bonvillain,
2010). The point is that gender
expectations and roles differ among cultures.
A.2. An example of how human sociocultural identity relates
to human behavior would
be how different cultures express emotion. Cultures have
display rules, m eaning they have
certain cultural expectations of how one should behave wh en
feeling a particular emotion.
Specific examples would include how the Japanese might mask
anger with a smile or the Dani of
New Guinea show their anger by wrinkling their noses (Heider,
2007).
3. A.3. Another example would include human sociocultural
identity related to animals.
Primates (including human children) engage in play. While
cultures have different ways to play,
the purpose of playing as children offers the same functions, a
nd primates share these functions
as well. Play teaches the young how to interact with their peers
and also expected social
behaviors.
B.1. Anthropologists can help us navigate crises by acting as
cultural brokers or working
between the culture of crisis and the outside world, a s
anthropologists understand multiple
perspectives. Amy Porter and Paul Farmer contend that
anthropologists are needed “to map out
3 FINAL PROJECT PART B
how complex political, economic, and social inequalities” find
their way into populations as
disease (Porter & Farmer, 2013, p. 366). It is important to
also have cultural sensitivity to the
beliefs of the people you are working with; if you don’t, you
won’t make any difference in their
4. understandings of the disease or your understanding of how the
disease is manifested in that
population.
II. Anthropological Methods
A.1. I chose to do ethnography in a village with known cases
of multidrug-resistant
tuberculosis (MDR TB). Ethnography was the best option for
me, a s I am a cultural
anthropologist. Ethnography allows you to observe people’s
actions and participate in t heir daily
lives to be able to make connections in what we are studying
(Ember, Ember, & Peregrine,
2015). I was able to interview family survivors of tuberculosis
and individuals with tuberculosis
to see if I could understand the cultural patterns of how
tuberculosis spreads within a community
and what this disease means to their culture.
B.1. When you go into a village studying a topic like disease,
people are obviously a little
curious and a little distrusting of your true intentions. People
are wary of you at first, but t hen the
newness wears off and they just get used to you. One positive
thing is that you really get to know
5. the people you work with. They become family. A negative
aspect of conducting fieldwork,
especially when you are studying disease, is t hat you see
people suffer and die. That is somewhat
difficult on a personal level.
B.2. An objective lens is really important when you study any
group of people as an
anthropologist. While anthropologists seek to explain the world
in terms of “the other,” they also
seek to explain how behaviors fit into a larger set of cultural
patterns. I don’t know if being
4 FINAL PROJECT PART B
objective calms the fears of the people you are working with,
but so metimes people are unaware
of their actions. Being objective helps you uncover those
beliefs.
III. Cultural Connections
A.1. When it comes to any infectious disease, it is hard to
predict whether a certain
country will or will not become infected with a disease at
some point in time. In general terms,
though, in the United States, there are only a few cases of
6. MDR TB e ach year. In 2013, the
Centers for Disease Control and Prevention (2015) reported 95
cases of MDR TB in the United
States, but this was slightly higher than the previous year. In
the past, tuberculosis was common
and considered a leading cause of death in the United States
until the mid-twentieth century. In
the United States, it is easier to get access to drugs that treat
tuberculosis, s o this would also help
ease the spread of tuberculosis.
A.2. In terms of biology, I believe it would be difficult for my
family to contract
tuberculosis in the United States, but it is not impossible.
Tuberculosis spreads by coughing, a nd
usually an individual needs to have prolonged exposure to
tuberculosis to develop the disease.
There is some suggestion among scholars that tuberculosis may
be inherited, but t he evidence for
this is weak (Roberts & Buikstra, 2003).
A.3. Environmentally, tu berculosis can occur anywhere in any
climate. However, certain
social a nd political conditions allow tuberculosis to spread
easier. Tuberculosis usually develops
7. in individuals or populations who are malnourished and live in
crowded or unsanitary living
conditions (Roberts & Buikstra, 2003). People who also have
another disease, such as HIV, are
more likely to develop tuberculosis. Although anyone is
technically susceptible to tuberculosis,
certain conditions exist in the United States that make
individuals susceptible, a nd we need to be
aware of those conditions to try to prevent them.
5 FINAL PROJECT PART B
IV. Predictions
A.1. History is an important teacher, especially in connection
to infectious diseases.
History can help us determine patterns of the people a certain
disease is most likely to affect and
how it would affect them. History can also tell us how a disease
was dealt with in the past and
whether it was an effective way to do so and why. I will give
you a simple example from the
United States. In the nineteenth century, wh en the U.S.
government forced native peoples onto
8. reservations, infectious diseases ran rampant in the
communities. Living in small, crowded
houses—combined with malnutrition, the high stress of the
political and social conditions, and
little to no medical facilities and medicine—led to infectious
diseases becoming a leading cause
of death (Trafzer, 1997 ). We know that people living in
similar conditions today can end in a
similar way.
B.1. In the field, I see firsthand how tuberculosis spreads
from one person to another and
what cultural factors help spread this disease. I think I will be
able to provide an effective
preventive action plan to prevent this disease from occurring in
the United States on a large
scale. An objective lens helps guide you on to what to say, but
cultur al sensitivity is also
important because this is what helps guide you on what to say
in a way that is meaningful to the
cultures that you are trying to educate.
C.1. I do still enjoy being an anthropologist, but it can be quite
chaotic a nd emotional at
times. As an anthropologist, you not only get to learn about
9. how other people experience life but
you also get to also experience it as they do to a certain point.
This can be satisfying and
humbling at the same time. Personally and professionally, thi s
has taught me that my way may
not always be the only way to accomplish something, and I
think that my tolerance for other
people has also increased.
6 FINAL PROJECT PART B
References
Bonvillain, N. (2010). Cultural anthropology (2nd ed.). Upper
Saddle River, NJ: Prentice Hall.
Centers for Disease Control and Prevention. (2015). Fact sheet:
10. Trends in tuberculosis 2013.
Retrieved 22 June 2015 from
http://www.cdc.gov/tb/publications/factsheets/
statistics/TBTrends.htm
Ember, C. R., Ember, M., & Peregrine, P. N. (2015). Human
evolution and culture: Highlights of
anthropology (8th ed.). Hoboken, NJ: Pearson.
Heider, K. G. (2007). Seeing anthropology: Cultural
anthropology though film (4th ed.). Boston,
MA: Pearson/Allyn and Bacon.
Porter, A. S., & Farmer, P. E. (2013). Drug resistance and
biosocial analysis in practice. In R.
Nolan (Ed.), Handbook of practicing anthropology (pp. 354–
371). Somerset, NJ: John
Wiley & Sons.
Roberts, C. A., & Buikstra, J. E. (2003). The bioarchaeology of
tuberculosis: A global view on a
reemerging disease. Gainesville, FL: University Press of
Florida.
Trafzer, C. (1997). Death stalks the Yakima: Epidemiological
transitions and mortality on the
Yakama Indian Reservation, 1888–1964. East Lansing, MI:
Michigan State University
11. Press.
http://www.cdc.gov/tb/publications/factsheets/statistics/TBTren
ds.htm
http://www.cdc.gov/tb/publications/factsheets/statistics/TBTren
ds.htmFinal Project Part B ATH 101I. Cultural DiversityII.
Anthropological MethodsIII. Cultural Connections IV.
PredictionsReferencesAccessibility ReportFilename: ATH 101
Final Project Part B Sample.pdfReport created by: Organization:
[Enter personal and organization information through the
Preferences > Identity dialog.]
Summary
The checker found no problems in this document.Needs manual
check: 2Passed manually: 0Failed manually: 0Skipped: 1Passed:
29Failed: 0
Detailed ReportDocumentRule
NameStatusDescriptionAccessibility permission
flagPassedAccessibility permission flag must be setImage-only
PDFPassedDocument is not image-only PDFTagged
PDFPassedDocument is tagged PDFLogical Reading
OrderNeeds manual checkDocument structure provides a logical
reading orderPrimary languagePassedText language is
specifiedTitlePassedDocument title is showing in title
barBookmarksPassedBookmarks are present in large
documentsColor contrastNeeds manual checkDocument has
appropriate color contrastPage ContentRule
NameStatusDescriptionTagged contentPassedAll page content is
taggedTagged annotationsPassedAll annotations are taggedTab
orderPassedTab order is consistent with structure
orderCharacter encodingPassedReliable character encoding is
providedTagged multimediaPassedAll multimedia objects are
taggedScreen flickerPassedPage will not cause screen
flickerScriptsPassedNo inaccessible scriptsTimed
12. responsesPassedPage does not require timed
responsesNavigation linksPassedNaviga tion links are not
repetitiveFormsRule NameStatusDescriptionTagged form
fieldsPassedAll form fields are taggedField
descriptionsPassedAll form fields have descriptionAlternate
TextRule NameStatusDescriptionFigures alternate
textPassedFigures require alternate textNested alternate
textPassedAlternate text that will never be readAssociated with
contentPassedAlternate text must be associated with some
contentHides annotationPassedAlternate text should not hide
annotationOther elements alternate textPassedOther elements
that require alternate textTablesRule
NameStatusDescriptionRowsPassedTR must be a child of Table,
THead, TBody, or TFootTH and TDPassedTH and TD must be
children of TRHeadersPassedTables should have
headersRegularityPassedTables must contain the same number
of columns in each row and rows in each
columnSummarySkippedTables must have a summaryListsRule
NameStatusDescriptionList itemsPassedLI must be a child of
LLbl and LBodyPassedLbl and LBody must be children of
LIHeadingsRule NameStatusDescriptionAppropriate
nestingPassedAppropriate nestingBack to Top
Reproduced with permission of the copyright owner. Further
reproduction prohibited without permission.
COMPARATIVE RELATIONSHIP BETWEEN COST OF
EQUITY CAPITAL AND LEVERAGE ...
Bishnoi, Rahul, PhD
Journal of Financial Management & Analysis; Jan-Jun 2012; 25,
1; ABI/INFORM Global
pg. 75
13. Reproduced with permission of the copyright owner. Further
reproduction prohibited without permission.
Reproduced with permission of the copyright owner. Further
reproduction prohibited without permission.
Reproduced with permission of the copyright owner. Further
reproduction prohibited without permission.
Reproduced with permission of the copyright owner. Further
reproduction prohibited without permission.
Reproduced with permission of the copyright owner. Further
reproduction prohibited without permission.
Reproduced with permission of the copyright owner. Further
reproduction prohibited without permission.
Reproduced with permission of the copyright owner. Further
reproduction prohibited without permission.
14. Reproduced with permission of the copyright owner. Further
reproduction prohibited without permission.
Reproduced with permission of the copyright owner. Further
reproduction prohibited without permission.
Week Seven: Research Paper – List of potential research topics
To complete the Article Research Paper due in Week 7, please
select a topic from the list
provided below or from the chapter readings.
kets
-backed securities
17. -Scholes Option Price Model (OPM)
Global Variation in the cost of capital
d Depreciation
18. nd Discipline by the Board of Directors
hostile takeovers
interests
ntal Factors outside a firm’s control
hases
-Sholes Option Pricing Model to value equity
19. e cost of trade credit
arity
Research Paper: This is a graduate course and students will be
expected to research and write
papers summarizing in their own words what they have found on
current topics from the weekly
readings. Research is a theoretical review of relevant literature
and application of findings in the
literature to a topic related to a specific industry, field, or
business problem.
20. The research must be conducted using peer-reviewed trade or
academic journals. While
Blogs, Wikipedia, encyclopedias, course textbooks, popular
magazines, newspaper articles,
online websites, etc. are helpful for providing background
information, these resources
are NOT suitable resources for this research assignment.
Please Note: The UC Library staff are very helpful with
assisting students in using the UC
Online Library journal database. Please contact them if you
have issues. In addition, the
instructor has provided additional resources, including a
research tutorial, in the “Course
Resources” folder in the “Content” area of the course.
Assignment Requirements:
i. Choose a research topic from the chapter readings or from the
list provided by your
professor.
ii. Research/find a minimum at least four (4), preferably five (5)
or more, different peer-
reviewed articles on your topic from the University of the
Cumberlands Library online
21. business database. The article(s) must be relevant and from a
peer-reviewed source.
While you may use relevant articles from any time frame,
current/published within the
last five (5) years are preferred. Using literature that is
irrelevant or unrelated to the
chosen topic will result in a point reduction.
iii. Write a four (4) to five (5) page double spaced paper in APA
format discussing the
findings on your specific topic in your own words. Note - paper
length does not include
cover page, abstract, or references page(s).
iv. Structure your paper as follows:
a. Cover page
b. Overview describing the importance of the research topic to
current business and
professional practice in your own words.
c. Purpose of Research should reflect the potential benefit of the
topic to the
current business and professional practice and the larger body
of research.
22. d. Review of the Literature summarized in your own words.
Note that this should
not be a “copy and paste” of literature content, nor should this
section be
substantially filled with direct quotes from the article. A
literature review is a
summary of the major points and findings of each of the
selected articles (with
appropriate citations). Direct quotations should be used
sparingly. Normally, this
will be the largest section of your paper (this is not a
requirement; just a general
observation).
e. Practical Application of the literature. Describe how your
findings from the
relevant research literature can shape, inform, and improve
current business and
professional practice related to your chosen topic.
f. Conclusion in your own words
g. References formatted according to APA style requirements
Grading Criteria:
requested components are
23. completed as assigned; content is on topic and related to
managerial finance, critical
thinking is clearly demonstrated (few, if any, direct quotations
from the source in the
paper); scholarly research is demonstrated; topics and concepts
gained from the assigned
reading and/or from research is evident.
es substantial
critical thinking about topics and
solid interpretation of materials and reflection.
Communication is clear, concise, and
well presented; scholarly writing is demonstrated; grammar,
sentence structure, writing in
third person, and word choice is used correctly.
used are current and relevant
(preferably published within last five (5) years and MUST be
from peer-reviewed journal
article publications. At least four (4) peer-reviewed journal
articles are examined and
analyzed in the paper.
24. headings, in-text citations,
page citations (page number citations required for specific
information such as dates,
years, list of items from article, names, numbers, statistics, and
other specific
information), and references are properly formatted.
responses provided to a minimum
of four (4) other students. Responses must provide substantive
and meaningful discussion
of the content of the other student’s paper and provide
comments on the topic; responses
must be one (1) to two (2) paragraphs long with a minimum of
three sentences per
paragraph.
Please Note: Plagiarism will not be tolerated. The paper must be
written in your own words.
S C M S J o u r n a l o f I n d i a n M a n a g e m e n t ,
January - March 2 0 1 5 5
25. A Quarterly Journal
MNC Subsidiaries vs
Domestic Firms
Pankaj M. Madhani
Key Words : Corporate governance, Disclosure, Clause 49,
MNC subsidiaries, Globalization, Domestic firms
A
b
s
t
r
a
c
t
Dr. Pankaj M. Madhani
Associate Professor
ICFAI Business School (IBS)
IBS House, Near Science City,
Ahmedabad – 380060, Gujarat.
Email: [email protected]
Mobile No: 9662122075
irms having multinational presence such as subsid -
iaries of Multinational Corporations (MNCs) have
their parent firm in other country, have operations in
more than one country and may also be listed in the host
country. Such subsidiaries of MNCs are influenced by the
parent firm in home country to a great extent. As such, host
country has domestic firms originated and listed in the host
country as well as MNC subsidiaries, operated and listed in
26. the same legal institutional environment. As the regulatory
environment in the host country is the same for both groups
i.e. domestic firms and subsidiaries of MNCs, it is possible
that subsidiaries of MNCs internalise some aspects of
disclosure practices of their parent company.
MNCs subsidiaries operate across different countries with
different corporate governance regimes, which will often
deviate from corporate governance practices in the MNC
home country. MNCs have to thus manage multiple
economic, legal, political and cultural environments
externally as well as complex networks of knowledge and
This research examines the impact of foreign-ownership on the
corporate governance and disclosure policies of firms. MNCs
operate across
different countries with different corporate governance regimes,
which will often deviate from corporate governance practices in
the home
country of MNCs. Thus MNCs have to manage multiple
economic, legal, political and cultural environments. This paper
aims to analyze
difference in corporate governance and disclosure practices
among firms owned by foreign owner (MNC subsidiaries) and
local owner
(domestic firms). These research findings suggest that
subsidiaries of MNCs are no better in disclosure practices than
domestic Indian firms.
A
b
s
27. t
r
a
c
t
F
S C M S J o u r n a l o f I n d i a n M a n a g e m e n t ,
January - March 2 0 1 5 6
A Quarterly Journal
resource flows internally (Volkmar, 2003). The question is
whether firms with foreign ownerships have better behavior
in their disclosure policies compared to domestic firms.
Hence, this research intends to investigate empirically
whether MNC subsidiaries have better corporate
governance and disclosure policies compared to domestic
firms listed in India.Using firms across different sectors listed
in Bombay Stock Exchange (BSE), this research study aims
to analyze difference in corporate governance and disclosure
practices among firms owned by foreign owner (MNC
subsidiaries) and local owner (domestic firms). The findings
can shed light on the governance and disclosure practices
of MNC subsidiaries and domestic firms, in legal institutional
environment of India.
Corporate Transparency and Disclosure: Key Drivers
Good practices of corporate governance are now
documented in most country codes. These codes commonly
stress the need for transparency in financial and non-
financial disclosures, due board processes and information
systems, compliance with legal and regulatory requirements,
28. accountability to various stakeholders, among others (Baxi,
2005). Corporate transparency plays crucial role in reducing
the information asymmetry between firms and their
stakeholders (Durnev et al., 2009). It also allows stakeholders
to monitor performance and contractual commitment of firms
(Bushman and Smith, 2001). Hence, market regulators enact
numerous rules and codes to ensure timely and accurate
disclosure of information by listed firms. As such corporate
transparency refers to the disclosure of firm specific
information to outside constituents of the firm and is an
integral part of corporate governance practices.
Disclosure may be considered the foundation of any system
of corporate governance (Cadbury, 1999). Prior research has
shown specific benefits that encourage voluntary disclosure
of information through better corporate governance. These
benefits translate into a reduction of the information
asymmetry problems as a result of the separation of
ownership and control of firms (Lev, 1992). Also, firms that
opt to disclose information beyond the standard
requirements reap benefits such as reductions in capital
and debt costs, greater analysts’ cover or an increase in the
liquidity of company securities (Glosten and Milgrom, 1985).
Disclosure of timely, accurate, and relevant information, thus,
enables shareholder to evaluate the management’s
performance by observing, how efficiently the management
is utilizing the firm’s resources in the interest of the principal.
Corporate governance is not just about the process but it is
also about the way firms are held accountable mainly via
“financial reporting.” Corporate governance have
significantly focused on the relationship between the
management of firm and the Board of Directors particularly
on separating these two functions for effective professional
management and hence may lead to greater transparency.
29. The Board members usually may not get enough time and
the management of the firm has to manage the day-to-day
affairs. So the role of corporate governance becomes even
more pertinent. The Cadbury Report (1992) recommends the
Board of Directors to pay a great attention to the highest
level of disclosure. As shown in model of Figure 1, lack of
accountability of the Board of Directors and inadequate or
minimal information flow to the shareholders result in weak
controls.
Figure 1: Corporate Governance System
(Source: Model developed by author based on Montgomery and
Kaufman, 2003)
On the one hand, financial reporting constitutes an important
element of the corporate governance system. In fact, some
failures of corporate governance may be reduced by an
adequate financial reporting system. On the other hand,
some problems of the financial reporting system find their
origin in deficiencies of the system of corporate governance
(Whittington, 1993).
The effective financial reporting may play a key role
improving the soundness of the corporate governance
system. One of the key functions of the financial reporting
system is to limit top management’s discretion, and hence
constraining top management to act in the shareholders’
S C M S J o u r n a l o f I n d i a n M a n a g e m e n t ,
January - March 2 0 1 5 7
A Quarterly Journal
30. interest (Jensen and Meckling, 1976; Watts and Zimmerman,
1978), or, broadly speaking in a wider perspective, in the
interest of all the strategic corporate stakeholders. However,
it should also be noted that the quality of information
produced by the financial reporting system is fundamental
for a corporate governance system to be effective.
Disclosure is one of the fundamental goals of the financial
reporting system. Transparency is the timely and adequate
disclosure of the performance of the company and its
corporate governance practices related to its ownership,
board, management structure, and processes. A system of
corporate governance needs a good level of disclosure and
an adequate information to eliminate (or at least reduce)
information asymmetries between all parties, making
corporate insiders accountable for their actions.
According to Baek et al. (2009) “all the relevant information
should be made available to the users in a cost-effective
and timely way.” Annual reports are published by firms as a
medium for communicating both quantitative and qualitative
corporate information to shareholders, potential
shareholders (investors) and other users (Whittington,
1993). Although, such publication of an annual report is a
statutory requirement, firms normally voluntarily disclose
information in excess of the mandatory requirements. Hence,
annual reports are important documents for assessing and
analyzing the company performance in regard to corporate
governance and disclosure standard/standards as well as
compliance. Communication of corporate disclosure via
annual reports is a very important aspect of corporate
governance in the sense that meaningful and adequate
disclosure enhances good corporate governance (Bhasin
and Reddy, 2011).
Literature Review
31. Corporate governance is defined as an institutional
arrangement that not only addresses the agency problem
between shareholders and managers of the firm, but also
provides the context for the decisions taken by the top
management of the firm. In this context, the fundamental
objective of a corporate governance framework is to identify
a basis for strategic co-operation between shareholders and
managers of the firm such that the agency problem is reduced
and a basis for decisions that promote the competitiveness
of the firm is provided (Sinha, 2006). As La Porta et al.(1998)
argue, good corporate governance is needed for better
access to external financing at lower cost. Good corporate
governance is a key driver of sustainable corporate growth
and long-term competitive advantage (Madhani, 2007).
Firms, across the globe, recognize that there are economic
benefits to be gained from a well-managed disclosure policy.
This shows that firms in need of a good deal of external
financing, such as rapidly growing firms, have an incentive
to improve their disclosure and corporate governance.
A detailed and structured system of disclosure enables
investors to understand, and obtain accurate and reliable
information of companies in order to make better investment
decisions (Ho et al., 2008). Some research studies have
shown that with increased corporate disclosure, firms
experience a reduction in cost of equity capital (Botosan
and Plumlee, 2002), as well as, the cost of debt (Sengupta,
1998). Similarly, Healy et al. (1999) found a beneficial increase
in the firm’s stock liquidity and performance. Moreover,
information disclosure in itself is a strategic tool, which
enhances a company’s ability to raise capital at the lowest
possible cost (Lev, 1992).
Several studies examine Indian corporate governance
generally. Khanna (2008) reviews the development of
32. corporate governance norms in India beginning from
independence era. World Bank (2005), Sarkar and Sarkar
(2000), and Mohanty (2003) examine how firm-level
governance influences the behaviour of institutional
investors, or vice-versa. Mohanty (2003) finds that
institutional investors own a higher percentage of the shares
of better-governed Indian firms. This is consistent with
research in other countries (Aggarwal et al., 2005; Ferreira
and Matos, 2008). Bhattacharyya and Rao (2004) examine
whether adoption of Clause 49 (an important set of
governance reforms in India) predicts lower volatility and
returns for large Indian firms. Black and Khanna (2007)
conduct an event study of the adoption of Clause 49 and
report positive returns to a treatment group of large firms
(who were required to comply quickly) relative to small firms
(for whom compliance was delayed). Implementation of
Clause 49 in India was done in staggered manner, with large
firms (included in “Group A” on the BSE) required to comply
first, followed by medium-sized firms and then small firms.
Prior to the adoption of Clause 49, India was considered a
laggard in corporate governance practices. From 1947
(independence) through 1991, the Indian government
pursued socialist policies. The government nationalized most
banks, and became the principal provider of both debt and
S C M S J o u r n a l o f I n d i a n M a n a g e m e n t ,
January - March 2 0 1 5 8
A Quarterly Journal
equity capital for private firms. The performance of the
government agencies who provided capital to private firms
was measured, based on the amount of capital disbursed
33. rather than return on capital investment. This policy created
little incentive for managers of private firms to voluntarily
adopt good governance practices. Hence, during this period
(1947-1991), corporate governance practices in India, which
were considered to be comparable to that of British firms at
independence, considerably deteriorated. In the year 1992,
the Securities and Exchange Board of India (SEBI) - India’s
securities market regulator was formed. By the mid-1990s,
the Indian economy was growing steadily, and Indian firms
began to seek capital from variety of sources to finance
expansion into the global market spaces created by
liberalization and the growth of outsourcing (Black and
Khanna, 2007).
The need for capital by Indian firms, amongst other things,
led to corporate governance reforms. The first major step in
this area was setting up of the Confederations of Indian
Industry (CII) Code for Desirable Corporate Governance in
1998 (Sanan, 2011). The code published in April 1998
comprised seventeen recommendations. A year later, in May
1999, SEBI announced the formation of the Kumar Mangalam
Birla committee, which was tasked with proposing corporate
governance reforms. These reforms became ‘Clause 49’ so
named because they were implemented through a new
Clause 49, which was added to stock exchange listing
requirements. Clause 49 has both mandatory as well as
voluntary provisions. Mandatory provisions relate to board
composition, audit committees, board procedures,
management discussion and analysis in the annual reports,
certification of financial statements and internal controls,
and corporate governance reporting. The adoption of Clause
49 was viewed as a turning point in Indian corporate
governance (Black and Khanna, 2007). Dharmapala and
Khanna (2013) report that small Indian firms which are subject
to Clause 49 react positively to plans by SEBI to enforce the
Clause 49, relative to similar firms not subject to Clause 49.
34. There is an expanding literature that examines whether a
country’s legal and judicial institutions affect disclosures
practices across countries (Jaggiand Low, 2000). Bushman
et al.(2004) studied corporate transparency across 45
countries and found substantial differences in corporate
disclosure practices that arose from a country’s legal as
well as judicial regime. Researchers such as Hope (2003b),
and Francis et al.(2005) also found that country-level
institutional factors matter in explaining disclosure l evels.
Khanna et al.(2004) pointed out that customers require
financial information to evaluate a foreign firm’s long-term
viability, and suppliers use financial statements in evaluating
a foreign firm’s creditworthiness. Likewise, employees or
prospective employees can use disclosures in assessing
employment opportunities with a foreign firm. These
arguments are supported by Bowen et al.(1995) who argue
that implicit contracts can affect a firm’s accounting
practices. Given the unfamiliarity of firms when they enter
foreign labour, product or capital markets first time, MNCs
have incentives to provide additional information in order
to establish and maintain a reputation. This can reduce costs
associated with these relational contracts in the long-run.
MNCs are seen as amongst the world’s most powerful types
of organizations as they account for a large share of
intellectual property rights (IPRs), are big employers and
contribute to the economic development of the foreign
countries where they operate (Williams, 2009). Despite some
research interest among scholars in the corporate
governance and disclosure practices of MNCs (Strange and
Jackson, 2008), comparisons between MNCs subsidiaries
and domestic firms on corporate governance and disclosure
practices have received very little attention. A MNC
subsidiary is defined as a local affiliate of a MNC located in
35. a foreign country of which the parent company holds majority
ownership in promoters’ holding. (Bouquet and Birkinshaw,
2008).
MNCs subsidiaries face additional complexities and
challenges in corporate governance and disclosure practices
due to the diversity of corporate governance rules,
regulations and stakeholder expectations in the various host
countries in which they operate (Luo, 2005). Some studies
have examined the differences in corporate disclosure
practices between MNC corporate headquarters and
domestic firms (Krigger, 1988; Lekseland Lindgren, 1982).
However, very few studies have examined the differences
between MNC subsidiaries and domestic firms in their
corporate governance and disclosure practices in a host
country (Cahan et al.,2005; Duru and Reeb, 2002).
Pattnaik and Gray (2012) found that subsidiaries of MNCs
were more transparent and disclose more than domestic listed
Indian firms. Their time frame of the study was before
implementation of Clause 49. However, no study was
conducted in India regarding corporate governance and
disclosure practices of MNC subsidiaries and domestic firms
listed in India after implementation of Clause 49. Hence, this
S C M S J o u r n a l o f I n d i a n M a n a g e m e n t ,
January - March 2 0 1 5 9
A Quarterly Journal
research fills this gap and compares corporate governance
and disclosure practices of MNC subsidiaries and domestic
firms listed in BSE for the sample firms across various sectors
in year 2011-2012.
36. Development of Hypothesis
MNCs Subsidiaries and Domestic Firms
Subsidiaries of MNCs operating in developing countries
are expected to have higher standard of corporate
governance and disclose more information and observe
better reporting practices for the various reasons explained
below:
1) As they have to comply with the regulations of
not only their host country but also those of the
parent country or home country, where accounting
practices and standards of reporting are
substantially higher.
2) Usually, these firms are equipped with more
advanced accounting software tools and packages,
efficient audit staff, competent and efficient
accounting and support staff, and better
management practices. The variety of information
collected by the parent firms i.e. MNCs, along with
their better reporting systems can result in the
increase of voluntary disclosures. Hence, they have
the potential to disclose more information without
any incremental processing costs on disclosures
(Choi and Mueller, 1996).
3) These firms are under closer scrutiny of various
political and pressure groups within the host
country, as they view them as sources of economic
exploitation and agents of imperialist power
(Kamran and Nicholls, 1994). Hence, such firms
have an incentive to disclose more information in
order to avert any pressure for excessive control
37. for exploitation (Srinivasan, 2008).
4) International agencies like the Organization for
Economic Cooperation and Development (OECD)
and others frequently monitor and evaluate the
MNCs because of their importance in the global
trade. Subsidiaries of MNCs have been frequently
accused of tax evasion and other practices like
transfer pricing which may end up paying high
political costs.
5) MNCs have two related levels of corporate
governance structures – one at headquarters and
other at subsidiary levels. In the case of MNCs
with subsidiaries listed on local stock exchanges
in different host countries, those subsidiaries need
to simultaneously conform to the host country’s
legal requirements as well governance practices of
the MNC in home country (Kiel et al., 2006).
Therefore, MNC subsidiaries face dual pressures,
from the demand of the host country environment
where they are operated and also from corporate
headquarters of parent MNC in home country
(Rosenzweig and Singh, 1991).
In recent years, there has been a greater interest in applying
institutional theory to the study of MNCs (Westney, 2005),
especially to identify and study factors influencing MNC
subsidiary practices in different host country institutional
environments (Kostova and Roth, 2002; Tempel et al., 2006).
Prior empirical research has found that institutional pressures
created by legal environment develop an institutional
context within which firms make decisions regarding what
to disclose and how (Crawford and Williams, 2010).
Institutional theory can also be linked to legitimacy theory,
38. as their combined view could provide a better explanation
of disclosure practices of MNC subsidiaries. The application
of legitimacy theory to MNCs has been studied in detail by
many researchers (Dacin et al., 2008; Kostova and Zaheer,
1999). They assert that a MNC subsidiary has to gain dual
legitimacy and as such is in a state of institutional duality.
MNCs as a parent firm pressurize their subsidiaries internally
to adopt their organizational practices which are transferred
to it from their parent firm in home country. Externally the
host country institutional environment pressurizes MNC
subsidiaries to adopt local organizational practices. Hence,
MNCs subsidiary has to decide which institutional
pressures are more important; internal pressures that would
enable it to become legitimate within the working
environment of MNCs or the external pressures that would
enable it to gain external legitimacy within the legal
environment of the host country. In contrast, domestic firms
need to confirm only to the demands of their domestic rules,
regulations and stakeholder expectations (Alpay et al., 2005).
To study the extent of disclosure by MNC subsidiaries in
comparison to their parent firms would require a separate
study. Major emphasis of such study will be to analyse
S C M S J o u r n a l o f I n d i a n M a n a g e m e n t ,
January - March 2 0 1 5 10
A Quarterly Journal
levels of disclosure by MNC subsidiaries in the host country
and compare it with disclosure practices of their parent firm
or MNCs in their home country. However, such investigation
is beyond the scope of this research. Hence, this study
39. focuses on corporate governance and disclosure practices
of MNC subsidiaries and domestic firms listed only in India
to understand such difference in their practices.
Testable Hypothesis
This research study seeks to examine how MNC subsidiaries
and domestic firms differ in corporate governance and
disclosure practices. As MNCs conduct their global business
in multiple institutional environments that require different
disclosure rules, they may maintain higher disclosure
standards and disclose more information than domestic
firms. Thus, based on this argument, following null
hypothesis is proposed:
H01: There are no differences in corporate governance
and disclosure practices of MNC subsidiaries
and domestic firms listed only in India.
Corporate Transparency and Disclosure by Firms:An
Indirect Measurement Approach
Equity analysts play role of intermediaries between firms
and the financial market and serve as transparency enhancing
mechanism in market. Analyst forecasts are more accurate
and less dispersed for firms with more open disclosure
policies (Lang and Lundholm, 1996). Equity analysts collect
information about a firm, evaluate its current performance
and make future forecasts about the firm. Forecast error
captures analysts’ forecast accuracy and is calculated as
the absolute value of the difference between actual earnings
per share (EPS) and the median analyst forecast of EPS.
Forecast dispersion among group of analysts can be
calculated as the standard deviation of analysts’ forecast of
EPS.
40. The accuracy and dispersion of analysts’ forecast depend
on, and reflect the extent to which firms disclose information
in the markets (Healy and Palepu, 2001). Prior research have
demonstrated that corporate disclosure is positively linked
to analysts’ forecast accuracy and negatively to the
dispersion among analysts covering a given firm in their
forecasts (Bhat et al.,2006). Ashbaugh and Pincus (2001)
find that analysts’ forecast accuracy is higher after firms
adopt International Accounting Standards (IAS), and Hope
(2003a) finds that analysts’ forecast accuracy improves when
firm-level disclosure increases. Leuz and Verrecchia (2000)
find that German firms switching to US Generally Accepted
Accounting Principles (US GAAP) reporting have lower
information asymmetry than firms that continue to report
under German GAAP, which is a lower disclosure-reporting
regime.
Pattnaik and Gray (2012) used the measure of corporate
transparency based on the characteristics of equity analysts’
forecast behaviour and conclude that voluntary disclosure
is negatively related to analyst forecast errors. Analyst
forecast error and forecast dispersion were used by
researchers as proxies for corporate disclosure and
transparency. However, it is subjective measure of corporate
disclosure practices as analysts’ subjective opinions could
be influenced by firm performance. Hence, this research
study uses an alternate approach of direct method of
calculating corporate governance and disclosure practices
of firms as described below in research design and
methodology section.
Research Design and Methodology
Objective of the Study
1. To measure overall corporate governance and
41. disclosure practices of MNC subsidiaries and
domestic firms with the help of an appropriate
instrument as an evaluation tool.
2. To know that to what extent subsidiaries of MNCs
and domestic firms disclosed through their annual
reports by measuring Corporate Governance and
Disclosure (CGD) scores of sample firms.
Scope of the Study
This study will help us to understand that whether MNC
subsidiaries have better corporate governance and
disclosure practices compared to domestic firms in Indian
context. As it is perceived that MNC subsidiaries have more
incentives to disclose information compared to domestic
firms.
Sources of Data
For the purpose of study, data of the sample firms collected
from the annual reports of the same for the financial year
2011-12 (for the period ending March 2012 or December 2012
based on the firms’ financial year) have been downloaded
from the CMIE PROWESS database (Version 4.14).
S C M S J o u r n a l o f I n d i a n M a n a g e m e n t ,
January - March 2 0 1 5 11
A Quarterly Journal
Sampling Technique Applied
Stratified sampling was used for obtaining data of firms listed
in Bombay Stock Exchange (BSE) and is constituent of S&P
BSE sectoral indices.
42. Sampling and Data Collection
The sample for the study was collected from the firms listed
in BSE in the form of S&P BSE sector indices. Sectoral
indices at BSE aim to represent minimum of 90% of the free-
float market capitalization for sectoral firms from the universe
of S&P BSE 500 index. This sector index consists of the
firms classified in that particular sector of the BSE 500 index.
From these sectors, banking sector (Bankex) was eliminated
as the disclosure requirements for these firms are specialized
and regulated by other regulatory authorities. Likewise,
realty sector was also not considered because of specific
issues of governance. Hence, remaining all nine sectors from
S&P BSE sectoral indices were studied for this research. In
each of these sectors, top six firms as per market capitalization
are selected for sample. Out of sample size of 54 firms, the
sample consists of nine public sector firms (16.67%), 13 MNC
subsidiaries (24%) and others with dominant Indian
ownership (59.25%). Hence, sample represents 41 domestic
firms and 13 MNC subsidiaries.
The sample firms represent different sectors viz.: Auto
(11.1%), Metal (11.1%), Oil & Gas (11.1%), Consumer
Durables (11.1%), Capital Goods (11.1%), FMCG (11.1%),
Health Care (11.1%), IT (11.1%), and Power (11.1%). As
shown below in Table 1, these 54 firms selected from 9
different sectors represent 91% of overall sectoral index
weight. Hence, these samples of 54 firms truly represent
selected 9 sectors.
Sr.
No.
S&P BSE Sectoral Indices
43. No. of
Firms
Studied
Weight in
Index
(Per Cent)
1 S&P BSE Auto 6 89
2 S&P BSE Capital Goods 6 94
3 S&P BSE Consumer Durables 6 90
4 S&P BSE Healthcare 6 88
5 S&P BSE IT 6 95
6 S&P BSE Metal 6 82
7 S&P BSE Oil & Gas 6 94
8 S&P BSE Power 6 97
9 S&P BSE FMCG 6 91
Total Sample Size 54 91
Table 1: Weight of Sample Firms in their respective Sectoral
Indices
(Source: Calculated by Author form BSE Web Site)
The Research Instrument: Direct Measurement of
Corporate Governance Disclosure Score
A review of the existing literature is undertaken to explore
the methodology used for measuring corporate governance
and disclosure practices of firms. Prior research studies on
disclosure have been broadly classified as those on
disclosure indices, event studies and specific disclosure
analysis. Researchers have used various methods of
computing disclosure score for determining the level of
44. disclosures. The disclosure index provides a reasonable
method for measuring the overall disclosure quality of a
firm.
Prior research in this area has made extensive use of such
index methodology as a research tool (Marston and Shrives,
1991). Index method involves the development of an
extensive list of disclosure items, which are expected to be
relevant to the users of information. The methodology
adopted for computing the disclosure score can be of two
types; use of the externally developed disclosure index used
in relevant prior research or to have a self-constructed
disclosure index for the specific research.
Most prior international studies have used the transparency
and disclosure index developed by Standard & Poor (S&P)
or the Center for International Financial Analysis and
S C M S J o u r n a l o f I n d i a n M a n a g e m e n t ,
January - March 2 0 1 5 12
A Quarterly Journal
Research (CIFAR) scores. Many cross-country studies used
externally developed measures of total disclosures, e.g.,
Hope (2003b) used CIFAR ratings and Khanna et al. (2004)
used S&P’s transparency and disclosure scores. Such
externally developed indexes have the advantage of being
objective and comprehensive; however, they also have
disadvantages (Bushee, 2004; Francis et al., 2008). These
externally developed indexes capture total disclosures that
include both mandatory and voluntary disclosures. Further,
externally developed indexes offer lower construct validity
since they were not exclusively developed with a specific
45. research context in mind, and they can restrict the researcher
to non representative samples that may be motivated by
commercial interests of the organization that prepared the
index.
Bushee (2004) notes that the bigger payoffs for future
researchers will probably come to those who construct their
own index and also use hand-collected data. This research
study uses a voluntary disclosure index based on
Subramanian and Reddy (2012) and hand-collect governance
and disclosure data for sample of 54 firms. The instrument
developed by Subramanian and Reddy (2012) is given at
Annexure - I. They developed a new instrument to measure
corporate governance and disclosure practices of firms,
considering only voluntary disclosures in the Indian context.
Although, this instrument is based on S&P methodology, it
overcomes the limitations of the S&P instrument regarding
non segregation of voluntary and mandatory disclosures.
This approach allows us to isolate voluntary disclosures
and provides more powerful tests of firm-specific corporate
governance and disclosure incentives and hence,
complements prior studies that use broad-based, externally
developed disclosure indexes. According to Clause 49 of
listing agreement of Indian stock exchanges, firms have to
mandatory disclose, corporate governance practices as per
the guidelines stipulated in Clause 49. It is now binding for
the Indian listed firms to file with SEBI the corporate
governance compliance report along with the financial
statements. Hence, there was need to develop a methodology
for measuring voluntary corporate governance disclosure
practices as mandatory disclosure is already taken care of
by Clause 49 of listing agreement.
Subramanian and Reddy (2012) focused also on the quality
of practices and not just the disclosure of certain practices
46. by firms. On the basis of the S&P instrument, the instrument
also classifies corporate governance-related disclosures
under two categories: ownership structure and investor
relations (ownership), and board and management structure
and process (board). The final instrument had 67 items: 19
questions in the ownership disclosure category and 48 in
the board disclosure category. In the latter, the questions in
the instrument were not just about the disclosure of board
practices, but also about the quality of board practices. For
example, the S&P instrument just quizzes whether or not the
attendance details of board members are disclosed, whereas
this instrument checks whether an attendance at board
meetings of at least 60% is maintained. Thus, the scores of
board practices (maximum score: 48) from this instrument
indicate not just the disclosure of board practices, but also
the level of adoption of best board practices by firms.
Disclosures to the market participants can be made by firms
through annual reports, quarterly reports and continuous
disclosures to the stock exchanges. In this study, content
analysis was used and only the annual report information is
used for calculating CGD score of firms. The annual reports
of the selected 54 sample firms were carefully examined for
the financial year 2011-12. Hence, to arrive at the overall
disclosure score for each category, i.e. ownership and board,
annual reports of each firm under study was scrutinized for
the presence of specific items under the above mentioned
categories. One point is awarded when information on an
item is disclosed and zero otherwise. All items in the
instrument were given equal weight, and the scores thus
arrived at (for each category), with a higher score indicating
greater disclosure. Final corporate governance and
disclosure score (Maximum: 67) for each firm was calculated
by adding overall score received in ownership (Maximum:
19) as well as board category (Maximum: 48).
47. Data Analysis and Interpretation
For the purpose of this study, the firms have been taken
from nine different sectors for making meaningful
comparison of MNC subsidiaries and domestic firms. The
reason behind this classification is to find out the extent of
disclosure in MNC subsidiaries and domestic firms. The
CGD score of firms was calculated by thoroughly
scrutinizing annual report of sample of firms with the help of
instrument developed by Subramanian and Reddy
(2012).Out of sample of 54 firms, 13 firms are MNC
subsidiaries;while remaining 41 firms are domestic firms. Out
of pool of domestic firms, 15 firms are cross-listed, some on
S C M S J o u r n a l o f I n d i a n M a n a g e m e n t ,
January - March 2 0 1 5 13
A Quarterly Journal
more than one non-Indian exchange.Similarly, out of pool of
MNC subsidiaries, three firms are cross-listed. All these
cross-listed firms are excluded from our sample. Hence, in
Table 3, below shows sector and CGD score for MNC
Subsidiaries.
Table 3 : MNC SubsidiariesListed in India and Overseas: Sector
and Listing Details
the research sample of 36 firms listed only in India finally we
have sample of 10 MNC subsidiaries and 26 domestic
firms(Table 2).
48. Table 2: MNC subsidiaries and Domestic firms Listed only
India according to Sectors
Sr. No. Sector
MNC
Subsidiaries
Domestic Firms
1 Power - 4
2 Oil & Gas 1 4
3 Metal - 3
4 Health Care 1 2
5 FMCG 3 1
6 IT 1 3
7 Consumer Durables - 5
8 Capital Goods 2 2
9 Auto 2 2
Total 10 26
(Source: Calculated by author from Annual Report of Firms)
Sr.
No.
Company Sector
Overseas
Listing
CGD
Score
Mean CGD
Score
49. 1 Oracle Financial Services
Software
IT - 20 20
2 ABB Capital Goods - 22
25
3 Siemens Capital Goods - 28
4 Sterlite Industries (India) Metal US 30 30
5 Maruti Suzuki Auto - 19
16
6 Cummins India Auto - 13
7 Cairn India Oil & Gas - 30 30
8 Hindustan Unilever FMCG - 33
21.339 Colgate-Palmolive (India) FMCG - 15
10 Nestle India FMCG - 16
11 GlaxoSmithKline
Pharmaceuticals
Health Care - 20
18.6712 Ranbaxy Health Care Europe 22
13 Cipla Health Care Europe 14
Overall Sector CGD Score 23
50. (Source: Computed by author from company annual reports by
applying Research Instrument)
S C M S J o u r n a l o f I n d i a n M a n a g e m e n t ,
January - March 2 0 1 5 14
A Quarterly Journal
Table 4, below shows key statisticsof CGD score for MNC
subsidiaries.
Table 4 : MNC Subsidiaries:Key Sector and Statistics
Sr.
No.
Sector
No. of
Firms
CGD Score Mean
CGD
Score
Std.
Deviation
CV*
(%)Min. Max. Range
1 Capital Goods 2 22 28 6 25 4.24 16.97
2 Auto 2 13 19 6 16 4.24 26.52
51. 3 FMCG 3 15 33 18 21.33 10.12 47.42
4 Health Care 3 14 22 8 18.67 4.16 22.30
5 Oil & Gas 1 30 30 0 30 - -
6 Metal 1 30 30 0 30 - -
7 IT 1 20 20 0 20 - -
Overall 13 13 33 20 21.69 6.65 30.66
*CV = Coefficient of Variation
As MNC subsidiaries such as Sterlite, Ranbaxy and Cipla
are cross-listed (Table 3),they are excluded from our study.
Table 5: MNC Subsidiaries Listed only in India: Key Sector and
Statistics
Table 5, below shows key statisticsof CGD score for MNC
subsidiaries listed only in India.
Sr.
No.
Sector
No. of
Firms
CGD Score Mean
CGD
score
Std.
Deviation
52. CV*
(%)
Min. Max. Range
1 IT 1 20 20 0 20 - -
2 Oil & Gas 1 30 30 0 30 - -
3 Auto 2 13 19 6 16 4.24 26.51
4 Capital Goods 2 22 28 6 25 4.24 16.97
5 FMCG 3 15 33 18 21.33 10.11 47.41
6 Health Care 1 20 20 0 20 - -
Overall 10 13 33 20 22.06 6.69 30.96
*CV = Coefficient of Variation
(Source: Calculated by author)
Table 6 below shows sector and CGD score for domestic
firms listed in India and overseas. As 15 domestic firms are
(Source: Calculated by author)
cross-listed they are excluded from our study. Hence, out of
41 domestic firms we have now 26 domestic firms listed only
in India.
S C M S J o u r n a l o f I n d i a n M a n a g e m e n t ,
January - March 2 0 1 5 15
53. A Quarterly Journal
Table 6: Domestic Firms Listed in India and Overseas: Sector
and Listing Details
Sr.
No.
Company Sector Listing
CGD
score
Mean
CGD
Score
1 Infosys IT US 37
42
2 Wipro IT US 47
3 Dr. Reddy Health Care US 40 40
4 Reliance Industries Oil & Gas Europe 34 34
5 ITC FMCG Europe 41
32.5
6 United Spirits FMCG Europe 24
7 Mahindra & Mahindra Auto Europe 30
328 Tata Motors Auto US &
Europe
34
9 Reliance Infrastructure Power Europe 30
29.5
54. 10 Tata Power Power Europe 29
11 L & T Capital Goods Europe 31
27
12 Crompton Greaves Capital Goods Europe 23
13 Hindalco Metal Europe 20
26
14 Tata Steel Metal Europe 32
15 Videocon Consumer
Durables
Europe 18 18
Overall 31.33
Table 7, below shows sector and CGD score for domestic firms
listed only in India.
Table 7: Domestic Firms Listed only in India: Key Sector and
CGD Score
(Source: Computed by author from company annual reports by
applying Research Instrument)
Sr.
No.
Company Sector
CGD
score
Mean
CGD score
55. 1 HCL IT 34
29.332 TCS IT 33
3 Mahindra Satyam IT 21
4 Bajaj Auto Auto 24
23
5 Hero Moto Corp Auto 22
6 Pipavav Defence Capital Goods 21
22.5
7 BHEL Capital Goods 24
8 ONGC Oil & Gas 31
25.75
9 IOC Oil & Gas 28
10 GAIL Oil & Gas 20
11 Bharat Petroleum Oil & Gas 24
12 NTPC Power 28
27.25
13 Reliance Power Power 27
14 NHPC Power 29
15 Power Grid Power 25
16 Lupin Health Care 24
23.5
56. 17 Glenmark Health Care 23
PTO
S C M S J o u r n a l o f I n d i a n M a n a g e m e n t ,
January - March 2 0 1 5 16
A Quarterly Journal
18 Coal India Metal 24
25.3319 Jindal Steel & Power Metal 17
20 JSW Steel Metal 35
21 Godrej FMCG 36 36
22 Titan Consumer Durables 26
20
23 TTK Prestige Consumer Durables 15
24 Gitanjali Gems Consumer Durables 24
25 Rajesh Exports Consumer Durables 15
26 Bluestar Consumer Durables 20
Overall Sector CGD Score 25.85
Table 8, below shows key statistics of CGD score for domestic
firms listed only in India.
57. Table 8: Domestic Firms Listed only in India: Key Statistics
Source: Computed by author from company annual reports by
applying Research Instrument)
Sr.
No.
Sector
No. of
Firms
CGD Score
Mean CGD
score
Std.
Deviation
CV*
(%)Min. Max. Range
1 IT 3 21 34 13 29.33 7.23 24.66
2 Power 4 25 29 4 27.25 1.71 6.27
3 Oil & Gas 4 20 31 11 25.75 4.79 18.59
4 Auto 2 22 24 2 23 1.41 6.15
5 Capital Goods 2 21 24 3 22.50 2.12 9.43
6 Metal 3 17 35 18 25.33 9.07 35.82
7 FMCG 1 36 36 0 36 - -
58. 8 Consumer Durables 5 15 26 11 20 5.05 25.25
9 Health Care 2 23 24 1 23.50 0.71 3.01
Overall 26 15 36 21 25 5.68 22.71
(Source: Calculated by author)*CV = Coefficient of Variation
S C M S J o u r n a l o f I n d i a n M a n a g e m e n t ,
January - March 2 0 1 5 17
A Quarterly Journal
Table 9, below shows key statistics of CGD score for MNC
subsidiaries and domestic
firms according to listing status, i.e. listed only in India or
cross-listed.
Table 9: MNC Subsidiaries and Domestic Firms Listing: Key
Statistics
Sr.
No.
Listing Status
No. of
Firms
CGD Score Mean
CGD
score
Std.
59. Deviation
CV*
(%)Min. Max. Range
1 MNC
Subsidiaries
13 13 33 20 21.69 6.65 30.66
(a) India & Overseas
(Cross-listed)
3 14 16 6 22 8 38.36
(b) India only 10 13 33 20 21.60 6.69 30.96
2 Domestic Firms 41 15 47 32 27.32 7.22 26.44
(a) India & Overseas
(Cross-listed)
15 18 47 29 31.33 8.01 25.58
(b) India only 26 15 36 21 25 5.68 22.71
Overall 54 13 47 34 25.96 7.44 28.64
Research Procedures for Testing Hypothesis
This research conducted an inferential statistical analysis
for testing the hypothesis. In order to test the significant
differences in the CGD scores of MNC subsidiaries and
domestic firms, parametric t-test was used.
Summary of Findings and Empirical Results
60. A detailed analysis of the CGD score for sample firms is
presented in Table 10. Values of minimum, maximum, mean
*CV = Coefficient of Variation (Source: Calculated by
author)
and standard deviation of CGD score for MNC subsidiaries
and domestic firms have also been reflected. Results show
that there is a difference between mean and standard
deviation of CGD score for MNC subsidiaries and domestic
firms. Analysis of the result shown in Table 10 indicates
that mean of CGD score is higher for domestic firms at 25.
Also, the standard deviation of CGD score is higher at 6.68
for MNC subsidiaries when compared to domestic firms in
the sample.
Table 10: Descriptive Statistics of Dependent Variable – CGD
Score
No. of
Firms
Minimum
CGD Score
Maximum
CGD Score
Mean CGD
Score
Std.
Deviation
All Firms
61. Listed only in
India
36 13 36 24.05 6.07
MNC
Subsidiaries
10 13 33 21.6 6.68
Domestic
Firms
26 15 36 25 5.67
Source: Computed by author from company annual reports by
applying Research
Instrument
S C M S J o u r n a l o f I n d i a n M a n a g e m e n t ,
January - March 2 0 1 5 18
A Quarterly Journal
The hypotheses have been tested using the univariate t-test.
Group statistics and independent sample test output is given
in Table 11 and Table 12 respectively.
Table 11: Group Statistics for MNC Subsidiaries and Domestic
Firms Listed Only in India
Group Statistics
Firms Listed
62. in India
No. of
Firms
Mean
Std.
Deviation
Std. Error
Mean
CGD
Score
MNC
Subsidiaries
10 21.6000 6.68664 2.11450
Domestic
Firms
26 25.0000 5.67803 1.11355
Table 12: Independent Samples Test
CGD
Score
Levene's
Test for
Equality of
Variances
63. t-test for Equality of Means
F Sig. t df
Sig.
(2-
tailed)
Mean
Difference
Std.
Error
Difference
95% Confidence Interval
of the Difference
Lower Upper
Equal
variances
assumed
.505 .482 -1.533 34 .135 -3.40000 2.21835 -7.90823 1.10823
Equal
variances
not assumed
-1.423 14.289 .176 -3.40000 2.38979 -8.51590 1.71590
Table 13, shows result of univariate test.
Table 13: Results of Univariate Test
64. Null Hypothesis
t -
Value
Significance
Level
No significant difference between corporate
governance and disclosure scores of MNC subsidiaries
and domestic firms listed only in India
1.533 .135
Results of parametric test, as indicated in Table 13, show
that significance value p is greater than 0.05, therefore at 5%
level of significance; null hypothesis of equality of means
fails to be rejected. Thus, there exists no significant difference
between the CGD scores of MNC subsidiaries and domestic
firms. As such there is no statistical significant difference
between corporate governance and disclosure practices of
MNC subsidiaries and domestic firms listed only in India.
Analysis and Findings
Global presence of MNC and its subsidiaries create a demand
for voluntary disclosure by such firms because MNC
subsidiaries are likely to have greater information asymmetry
as a result of their greater scope and complexity. Such effect
will be larger for firms based in countries with weak legal
environments than for firms based in countries with strong
legal institutional environments. Hence, it is expected that
S C M S J o u r n a l o f I n d i a n M a n a g e m e n t ,
January - March 2 0 1 5 19
65. A Quarterly Journal
the subsidiaries of MNCs will provide more disclosures as a
result of weak legal environment at host country.
Accordingly, MNC subsidiaries are expected to have higher
disclosure level compared to domestic firms in India.
Pattnaik and Gray (2012) found evidence for such hypothesis
and empirically proved that subsidiaries of MNCs were more
transparent and disclosed more information than domestic
listed Indian firms. They used data of Indian firms listed in
BSE from 1995 to 2003 and used indirect method of
disclosure measurement. During period of their research
study (1995-2003), host country legal environment in India
was not strong, as during this period corporate governance
and disclosure rules were weak in comparison to developed
countries. As their study period ends in 2003, after which
the Clause 49 of listing agreement was made mandatory by
SEBI, their study period reflects weak period of corporate
governance in India. After 2003, corporate governance and
disclosure practices of Indian firms improved to great extent
as Clause 49 of listing agreement was announced in October
2004 with its implementation in staggered manner by 2005.
After adoption of Clause 49 and its enforcement by SEBI,
corporate governance and disclosure practices of domestic
firms enhanced considerably. This research found support
for this and empirically proved that there is no statistical
significant difference between corporate governance and
disclosure practices of MNC subsidiaries and domestic firms
listed in India.
In conclusion this study contributes to several areas of
research:
1. This research studies whether the interaction
66. between globalization and the legal environment
of the country affects voluntary disclosure
practices of MNC subsidiaries.
2. This research adds to the emerging literature that
uses country-level institutional features, such as
legal origin to explain cross-country differences in
governance and disclosure practices.
3. This research examines how practices of MNC
subsidiaries’ disclosures are affected by the legal
environment of host country where it’s listed when
compared to domestic firms.
4. This research contributes to the growing literature
on globalization, MNCs as well as India specific
research.
Limitations of Study
The focus of corporate governance and disclosure study in
this research has been on corporate annual reports which
are only a part of the information set. However, as mentioned
earlier the use of annual reports is widely accepted in prior
research. Key consideration of content analysis with hand-
collected disclosure data is that because the process is time
intensive, sample sizes are often small. For example, Botosan
(1997) uses hand-collected data for a sample of 122
manufacturing firms, and Guo et al.(2004) use hand-collected
data for a sample of 49 biotech firms.Although sample size
for this research is not too big, it fairly represents sectoral
indices of BSE. Lastly as this study analyses data of sample
firms for the financial year 2011-12 only, future study may
be conducted with multiple year panel data.
Conclusions
67. In this research study, the corporate governance and
disclosure practices of subsidiaries of MNCs as well as
domestic firms listed in BSE were measured by doing content
analysis of annual report of sample firms. Prior research
suggested that domestic firms were disclosing less
information compared to MNC subsidiaries in India.
However, this research finding suggests that in Indian
context, subsidiaries of MNCs are no more transparent than
domestic firms. This research also indicates that corporate
governance and disclosure practices of subsidiaries of
MNCs and domestic firms have converged as there is no
statistical significant difference in corporate governance and
disclosure practices of MNC subsidiaries and domestic firms
listed in India. It is because of improvement in overall
corporate governance norms and enforcement by regulatory
bodies. SEBI has formulated comprehensive corporate
governance rules and regulations. Clause 49 of listing
agreement announced by SEBI has considerably enhanced
corporate governance and disclosure practices of Indian
firms.This research concludes that institutional, legal and
regulatory environment of a country has a major role in
shaping corporate governance and disclosure practices of
MNC subsidiaries as well as domestic firms.
REFERENCES
1. Aggarwal, R., L.Klapper, and P. D. Wysocki(2005).
“Portfolio preferences of foreign institutional
investors.”Journal of Banking and Finance, 29(12),
2919-2946.
S C M S J o u r n a l o f I n d i a n M a n a g e m e n t ,
January - March 2 0 1 5 20
68. A Quarterly Journal
2. Alpay, G., M.Bodur, H.Ener, and C. Talug (2005).
“Comparing board-level governance at MNEs and local
firms: Lessons from Turkey.”Journal of International
Management, 11(1), 67-86.
3. Ashbaugh, H. and M.Pincus (2001). “Domestic
accounting standards, international accounting
standards, and the predictability of earnings.”Journal
of Accounting Research, 39(3), 417-434.
4. Baek, H.Y., D.R.Johnson, and J.W. Kim (2009).
“Managerial ownership, corporate governance and
voluntary disclosure.”Journal of Business & Economic
Studies, 15(2), 44-61.
5. Baxi, C. V. (2005). “The current context of corporate
governance in India.” Global Business Review, 6(2),
303-314.
6. Bhasin, M. L. and M. Reddy (2011). “Corporate
governance disclosure practices: The portrait of a
developing country.”International Review of Business
Research Papers,7(1), 393-419.
7. Bhat, G., O-E. Hope, and T. Kang (2006). “Does corporate
governance transparency affect theaccuracy of analyst
forecast?”Accounting and Finance, 46(5), 715-732.
8. Bhattacharyya, A. K. and S. V. Rao (2004). “Economic
impact of ‘regulation on corporate governance’:
Evidence from India.” No. 486. Working Paper.
9. Black, B. S. and V. S. Khanna (2007). “Can corporate
69. governance reforms increase firm market values? Event
study evidence from India.”Journal of Empirical Legal
Studies, 4(4), 749-796.
10. Botosan, C. A. and M. A. Plumlee (2002). “Re-
examination of disclosure level and the expected cost
of equity capital.”Journal of Accounting
Research,40(1), 21-40.
11. Botosan, C. A. (1997). “Disclosure level and the cost of
equity capital.” The Accounting Review, 72(3), 323-349.
12. Bouquet, C. and J. Birkinshaw (2008). “Managing
power in multinational corporation: How low power
actors gain influence.” Journal of Management, 34 (3),
477-508.
13. Bowen, R., L.Du Charme, and D. Shores (1995).
“Stakeholders’ implicit claims and accounting method
choice.”Journal of Accounting and Economics, 20(3),
255-295.
14. Bushee, B. J. (2004). “Discussion of disclosure practices
of foreign companies interacting with U.S.
markets.”Journal of Accounting Research, 42(2), 509-
525.
15. Bushman, R.M., J.D.Piotroski, and A.J. Smith (2004).
“What determines corporate transparency?”Journal of
Accounting Research, 42(2), 207-252.
16. Bushman, R.M. and A. J. Smith (2001). “Financial
accounting information and corporate
governance.”Journal of Accounting and Economics,
32(1), 237-333.
70. 17. Cadbury, A. (1992). Report of the committeeon financial
aspects of corporate governance. London: Gee
Publishing.
18. Cadbury, A. (1999). “What are the trends in corporate
governance? How will they impact your company?”
Long Range Planning, 32(1), 12-19.
19. Cahan, S. F., A. Rahman, and H. Perera (2005). “Global
diversification and corporate disclosure.”Journal of
International Accounting Research, 4(1), 73-93.
20. Choi, F. D. S. and G. G. Mueller(1996). International
Accounting. 2nd ed. Englewood Cliffs, N.J.: Prentice-Hall.
21. CII (Confederation of Indian Industry). 1998. CII Code:
Desirable Corporate Governance. New Delhi: CII.
22. Crawford, E. P. and C. C. Williams (2010). “Should
corporate social reporting be voluntary ormandatory?
Evidence from the banking sector in France and the
United States.” Corporate Governance, 10(4), 512-526.
23. Dacin, M. T., T.Kostova, and K. Roth (2008).
“Institutional theory in the study of multinational
corporations: A critique and new directions.”Academy
of Management Review, 33(4), 994-1006.
24. Dharmapala, D. and V. Khanna (2013). “Corporate
governance, enforcement, and firm value: evidence from
India.”Journal of Law, Economics, and Organization,
29(5), 1056-1084.
25. Durnev, A., V.Errunza, and A. Molchanov (2009).
“Property rights protection, corporate transparency,
and growth.”Journal of International Business Studies,
71. 40(9), 1533-1562.
26. Duru, A. and D.M. Reeb (2002). “International
diversification and analysts’ forecast accuracy and
bias.” The accounting Review, 77(2), 415-433.
S C M S J o u r n a l o f I n d i a n M a n a g e m e n t ,
January - March 2 0 1 5 21
A Quarterly Journal
27. Ferreira, M. A.and P. Matos (2008). “The colors of
investors’ money: the role of institutional investors
around the world.”Journal of Financial Economics,
88(3), 499-533.
28. Francis, J., D.Nanda, and P. Olsson (2008). “Voluntary
disclosure, information quality, and cost of
capital.”Journal of Accounting Research, 46(1), 53-99.
29. Francis, J., I. Khurana, and R. Pereira (2005). “Disclosure
incentives and effects of cost of capital around the
world.”The Accounting Review, 80(4), 1125-1162.
30. Glosten, L.R. and P. R. Milgrom (1985). “Bid, ask and
transaction prices in a specialist market with
heterogeneously informed traders.”Journal of
Financial Economics,14(1), 71-100.
31. Guo, R. J., B.Lev, and N. Zhou (2004). “Competitive
costs of disclosures of biotech IPOs.”Journal of
Accounting Research, 42(2), 319-355.
32. Healy, P. M., A.P. Hutton, and K.G. Palepu (1999). “Stock
72. performance and intermediation changes surrounding
sustained increases in disclosure.”Contemporary
Accounting Research, 16(3),485-520.
33. Healy, P. M. and K. G. Palepu (2001). “Information
asymmetry, corporate disclosure and capital markets: A
review of empirical disclosure literature.”Journal of
Accounting and Economics, 31(1),405-440.
34. Ho, P. L., G.Tower, and D. Barako (2008). “Improving
governance leads to improved communi-
cation.”Corporate Ownership and Control,5(4), 26-33.
35. Hope, O. K. (2003a). “Disclosure practices, enforcement
of accounting standards, and analysts’ forecast
accuracy: An international study.”Journal of
Accounting Research, 41(2), 235-272.
36. Hope, O. K. (2003b). “Firm-level disclosures and the
relative roles of culture and legal origin.”Journal of
International Financial Management and
Accounting, 14(3), 218-248.
37. Jaggi, B. and P. Y. Low (2000). “Impact of culture, market
forces, and legal system on financial disclosures.”The
International Journal of Accounting, 35(4), 495-519.
38. Jensen, M. C. and W. H. Meckling (1976). “Theory of
the Firm: Managerial behaviour, agency cost and
ownership structure.” Journal of Financial
Economics,3(4), 305-360.
39. Kamran, A. and D. Nicholls(1994). “The impact of non-
financial company characteristics on mandatory
disclosure in developing countries: The case of
Bangladesh.”International Journal of Accounting
73. Education and Research, 29(1), 62-77.
40. Khanna, T., K. G. Palepu, and S. Srinivasan (2004).
“Disclosure practices of foreign companies interacting
with U.S. markets.”Journal of Accounting Research,
42(2), 475-508.
41. Khanna, V.S. (2008). “The anatomy of corporate
governance reform in an emerging market: The case of
India.”Working Paper.
42. Kiel, G. C., K.Hendry, and G.V. Nicholson (2006).
“Corporate governance options for the local
subsidiaries of multinational enterprises.”Corporate
Governance: An International Review, 14(6), 568-576.
43. Kostova, T. and Roth, K. (2002). “Adoption of an
organizational practice by subsidiaries ofmultinational
corporations: Institutional and relational
effects.”Academy ofManagement Journal, 45(1), 215-
233.
44. Kostova, T. and S. Zaheer (1999). “Organizational
legitimacy under conditions of complexity:The case of
multinational enterprise.”Academy of Management
Review, 24(1), 64-81.
45. Krigger, M.P. (1988). “The increasing role of subsidiary
boards in MNCs: An empirical study.”Strategic
Management Journal, 9(4), 347-360.
46. La Porta, R., F.Lopez-de-Silanes, A.Shleifer, and R. W.
Vishny (1998). “Law and finance.”Journal of Political
Economy, 106(6), 1113-1155.
47. Lang, M. H. and R. J. Lundholm(1996).”Corporate
74. disclosure policy and analyst behaviour.”The
Accounting Review, 71(4), 467-492.
48. Leksell, L. and U. Lindgren (1982). “The board of
directors in foreign subsidiaries.” Journal of
International Business Studies, 13(1), 27-38.
49. Leuz, C. and R. E.Verrecchia(2000). “The economic
consequences of increased disclosure.”Journal of
Accounting Research, 38, 91-136.
50. Lev, B. (1992). “Information disclosure
strategy.”California Management Review, 34(4), 9-32.
S C M S J o u r n a l o f I n d i a n M a n a g e m e n t ,
January - March 2 0 1 5 22
A Quarterly Journal
51 Luo, Y. (2005). “Corporate governance and
accountability in multinational enterprises: Concepts
and agenda.”Journal of International Management,
11(1), 1-18.
52. Madhani, P. M. (2007). “Corporate governance from
compliance to competitive advantage.” The Accounting
World, 7(8), 26-31.
53. Marston, C. L. and P. J. Shrives (1991). “The use of
disclosure indices in accounting research: A review
article.”The British Accounting Review, 23(3),195-210.
54. Mohanty, P. (2003). “Institutional investors and
corporate governance in India.” National Stock
75. Exchange of India Research Initiative Paper No. 15. http:/
/ssrn.com/abstract=353820.
55. Montgomery, C. A. and R. Kaufman (2003). “The board’s
missing link.”Harvard Business Review, 81(3), 86-93.
56 Pattnaik, C. and S. Gray (2012). “Differences in corporate
transparency between MNC subsidiaries and domestic
corporations: Empirical evidence from India.”
Transparency and Governance in a Global World, 13,
173-196.
57. Report of the Kumar Mangalam Birla Committee on
Corporate Governance (1999). 1- 42.
58. Rosenzweig, P. M. and J. V. Singh, (1991).
“Organizational environments and the
multinationalenterprise.”Academy of Management
Review, 16(2), 340-361.
59. Sanan, N. (2011). “Corporate governance in public and
private sector enterprises: evidencefrom India.”The IUP
Journal of Corporate Governance,10(4), 37-59.
60. Sarkar, S. and J. Sarkar (2000). “Large shareholder
activism in corporate governance in developing
countries: evidence from India.”International Review
of Finance, 1(3), 161-194.
61. Sengupta, P. (1998). “Corporate disclosure quality and
the cost of debt.”The Accounting Review,73(4),459-474.
62. Sinha, R. (2006). “Corporate governance and
shareholder value analysis.” Global Business
Review, 7(1), 1-16.
76. 63. Srinivasan, P. (2008). “Analysis of factors influencing
corporate voluntary disclosure practices.”In P. M.
Madhani (Ed). Corporate Disclosure: Concepts and
Practices, Hyderabad: ICFAI University Press.
64. Strange, R. and G. Jackson (2008). Corporate
Governance and International Business.Basingstoke:
Palgrave
65. Subramanian, S. and V. Nagi Reddy (2012). “Corporate
governance disclosures and international
competitiveness: A study of Indian firms.”Asian
Business & Management,11(2), 195-218.
66. Tempel, A., T. Edwards, A.Ferner, M. Muller-Camen,
and H.Wachter (2006). “Subsidiary responses to
institutional duality: Collective representation practices
of US multinationals in Britain and Germany.”Human
Relations, 59(11), 1543-1570.
67. Volkmar, J. A. (2003). “Context and control in foreign
subsidiaries: making a case for the host country national
manager.”Journal of Leadership & Organizational
Studies, 10(1), 93-105.
68. Watts, R. L. and J. L. Zimmerman (1978). “Toward a
positive theory of the determination of accounting
standards. “The Accounting Review, 53(1),112-134.
69. Westney, D. E. (2005). “Institutional theory and the
multinational corporation.” In S. Ghoshal,& D. E.
Westney (Eds.), Organization theory and the
multinational corporation. NewYork: Palgrave
Macmillan.
70. Whittington, G. (1993). “Corporate governance and the
77. regulation of financial reporting.”Accounting and
Business Research,23(Sup1),311-319.
71. Williams, C. (2009). “Subsidiary-level determinants of
global initiatives in multinational corporations.”Journal
of International Management, 15(1), 92-104.
72. World Bank Report (2005). India: Role of Institutional
Investors in the Corporate Governance of their
Portfolio Companies.
******
S C M S J o u r n a l o f I n d i a n M a n a g e m e n t ,
January - March 2 0 1 5 23
A Quarterly Journal
ANNEXURE – I
Instrument for Measuring GCD Score of Sample Firms
Component 1:
Board and Management Structure and Process
Sr.
No.
Disclosure of:
1
2
3
4
79. executive?
Detail about the chairman (other than name and executive
status)?
Details about the role of the board of directors in the
company?
Are the dates of board meetings disclosed?
Is the aggregate board attendance disclosed for each meeting?
Are directors attending over 60 per cent of the board
meetings?
Are attendance details of individual directors at board
meetings disclosed?
Do independent directors constitute at least 1/3 of the board?
Do independent directors constitute more than 1/2 of the
board?
Do independent directors constitute more than 2/3 of the
board?
A list of matters reserved for the board?
Is the list of audit committee (AC) members disclosed?
Is the majority of AC independent?
Is the chairman of the AC independent?
Is disclosure made of the basis of selection of AC members?
Is the aggregate attendance of AC meetings disclosed?
Is the attendance of individual directors at AC meeting
disclosed?
Does the company have a remuneration committee?
Is the list of remuneration committee members?
Is the majority of RC independent?
Is the remuneration committee chaired by an independent
director?
Is the frequency of RC meetings disclosed?
Component 2: Board and Management Structure and Process
Sr.
No.
Disclosure of:
80. 26
27
28
29
30
31
32
Is the aggregate RC meeting attendance disclosed?
Is disclosure made of individual members’ attendance in RC
meetings?
Does the company have a nominating committee?
Is the list of members of the nominati ng committee disclosed?
Is the majority of nominating committee independent?
Is the frequency of NC meetings disclosed?
The existence of a strategy/investment/finance committee?
S C M S J o u r n a l o f I n d i a n M a n a g e m e n t ,
January - March 2 0 1 5 24
A Quarterly Journal
30
31
32
33
34
35
36
37
38
81. 39
40
41
42
43
44
45
46
47
48
g
Is the majority of nominating committee independent?
Is the frequency of NC meetings disclosed?
The existence of a strategy/investment/finance committee?
The number of shares in the company held by directors?
A review of the last board meeting disclosed (for example,
minutes)?
Whether they provide director training?
The decision-making process of directors’ pay?
The specifics on performance-related pay for directors?
Is individual performance of board members evaluated?
Is appraisal of board performance conducted?
The decision making of managers’ (not Board) pay?
The specifics of managers’ (not on Board) pay (for example,
salary levels and so on)?
The forms of managers’ (not on Board) pay?
The specifics on performance-related pay for managers?
The list of the senior managers (not on the Board of
Directors)?
The backgrounds of senior managers disclosed?
The details of the CEO’s contract disclosed?
The number of shares held by the senior managers disclosed?
82. The number of shares held in other affiliated companies by
managers?
Component 3: Ownership Structure and Investor Relations
Sr.
No.
Does the annual report contain?
1
2
3
4
5
6
7
8
9
Top 1 shareholder?
Top 3 shareholders?
Top 5 shareholders?
Top 10 shareholders?
Description of share classes provided?
Review of shareholders by type?
Number and identity of shareholders holding more than 3 per
cent?
Number and identity of shareholders holding more than 5 per
cent?
Number and identity of shareholders holding more than 10 per
cent?
Component 3: Ownership Structure and Investor Relations
Sr.
83. No.
Does the annual report contain?
10
11
12
13
14
15
16
17
18
19
Percentage of cross-ownership?
Existence of a Corporate Governance Charter or Code of Best
Practice?
Corporate Governance Charter/Code of Best Practice itself?
Details about its Articles of Association (for example,
changes)?
Voting rights for each voting or non -voting share?
Way the shareholders nominate directors to board?
Way shareholders convene an Extraordinary General Meeting
(EGM)?
Procedure for putting enquiry rights to the board?
Procedure for putting proposals at shareholders meetings?
Review of last shareholders meeting (for example, minutes)?
(Source: Subramanian and Reddy, 2012)
84. Reproduced with permission of the copyright owner. Further
reproduction prohibited without
permission.
ATH 101 Final Project Part B Guidelines and Rubric
Overview
The final project for this course is divided into two parts. Part
A is the creation of an interview preparation document. Part B
involves the creation of an interview
transcript or recording. This document provides instruction for
Part B.
Researchers have developed a multitude of tools over the last
century that highlight our personal and cultural identities in a
85. broad-reaching field called
anthropology. The field of anthropology investigates everything
human in order to capture the diverse beliefs, practices,
experiences, and subtle nuances that
make humans truly human. From the social sciences to the
biological and physical sciences, anthropology implements a
wide array of lenses to evaluate why and
how we are as similar as we are different to one another.
Whether we are interviewing for a new position or meeting the
in-laws at a family get-together, gaining
a preliminary introduction to anthropology allows insight into
how people structure their basic beliefs and practices.
In this assessment, you will encounter a simulated crisis
situation that requires an anthropological response. You will
play the part of an anthropologist who has
firsthand knowledge and experience working in a biological,
environmental, and cultural disaster situation. Also, you have
real-world field experience personally
working with this affected group and are well versed in their
history and complex system of beliefs and practices. As such,
you have been asked to respond to the
crisis situation in an interview. The assessment will be divided
into two parts. In Part A, you will prepare for the interview,
defining anthropology and reflecting on
its importance to the world. In Part B, you will participate in
the interview, answering the reporter’s questions. Not only will
the reporter’s questions appear, but
you will also receive guidance in the form of an example
document (Final Project Part B Sample) so you know exactly
what is needed to fully answer the question.
Crisis situations that you may choose from are listed below.
1. Plastic Wars
2. Battle for Hong Kong
86. 3. COVID’s Hidden Toll
4. Blackout in Puerto Rico
5. Ebola in Congo
6. Right to Fail
7. Coal’s Deadly Dust
8. Flint’s Deadly Water
Part A consists of one milestone, which is submitted in Module
Two, and one final submission, which occurs in Module Four.
1
https://learn.snhu.edu/d2l/lor/viewer/view.d2l?ou=6606&loIdent
Id=8100
https://www.pbs.org/video/plastic-wars-8wxame/
https://www.pbs.org/video/battle-for-hong-kong-cekmp7/
https://www.pbs.org/video/covids-hidden-toll-3-d5hvx2/
https://www.pbs.org/video/blackout-in-puerto-rico-340ybo/
https://www.pbs.org/video/ebola-in-congo-np0khj/
https://www.pbs.org/video/right-to-fail-fz7iaq/
https://www.pbs.org/video/coals-deadly-dust-kje7ok/
https://www.pbs.org/video/flints-deadly-water-pwsj3m/
87. Part B consists of two milestones and one final submission. The
milestones for Part B occur in Modules Three and Five. The
final submission for Part B occurs in
Module Seven.
In the final project as a whole (Parts A and B), you will
demonstrate your mastery of the following course outcomes:
contemporary anthropology and human cultures
methods for making connections
that explain the human condition
systems of belief, and identity using various perspectives in the
fiel d
ical
research when dealing with the cultural identities of diverse
past and contemporary peoples
perspective for problem solving in real-world situations
Prompt
You have already defined and discussed the significance of
anthropology, so now you are prepared to jump into the
interview and really get at the heart of the
crisis situation you have chosen. In this scenario, imagine that a
88. reporter is asking you the questions listed below. In crafting
your response, you must address all
the aspects of the question represented as “Your Response.”
You will answer each piece titled “Your Response” to ensure
you are appropriately and accurately
answering the question the reporter has posed. You may either
submit your responses in the form of a transcript, or you may
create an audio recording of your
answers.
Specifically, the following critical elements must be addressed:
I. Cultural Diversity: In this section, you will explain the
importance of understanding and being sensitive to cultural
diversity.
a) Reporter: What is so important that we understand cultural
diversity in a time like this? Who cares if we’re all different?
What does it matter
anyway?
1. Your Response: Provide an example of human sociocultural
identity related to gender. For example, when many people
think of
farmers, they think of males.
2. Your Response: Provide an example of human sociocultural
identity related to human behavior. For example, when many
people
think of children, they think of specific behaviors that they
exhibit, such as crying, playing, or loving.
3. Your Response: Provide an example of human sociocultural
identity related to animals. For example, when people think of
geese,
they think of a flock.
89. b) Reporter: Human culture might seem more complex than I
initially imagined, so how does it relate to the crisis we’ve
witnessed here?
1. Your Response: Describe what some anthropologists can do
to help when crises such as these occur. How are they able to
navigate
crises, such as containing them and informing human cultures,
while balancing sensitivity to cultural beliefs and practices?
What is
the importance of doing so?
2
II. Anthropological Methods: In this section, you will speak as
though you are an anthropologist investigating the crisis. You
90. will describe the
anthropological methods you would need to use to investigate
the crisis, and explain how you believe people would react to yo
u investigating the
crisis.
a) Reporter: Alright, can you explain to the audience how you
came to this conclusion?
1. Your Response: Of the multiple research methods discussed
throughout the course, such as excavation, ethnology, and
ethnography,
select an appropriate method for investigati ng this crisis, and
explain why this method is appropriate.
b) Reporter: How did these people let you study them? Why did
they let you? You most likely upset them, right?
1. Your Response: What types of reactions might you receive
from studying this group of people and gathering data by the
ways you
described? Provide specific examples of both positive and
negative reactions.
2. Your Response: Explain why an objective lens is important
when studying a group of people. How might this lens help calm
the fears
of the group of people you are studying?
III. Cultural Connections: In this section, you will make
connections between cultural factors and the likelihood of the
crisis occurring in your own
culture. If the crisis has already occurred in your ow n culture,
explain how the specific cultural, biological, or environmental
factors allowed this to
occur.
91. a) Reporter: Do you think this crisis could happen here, to us?
1. Your Response: Explain how specific cultural factors in your
culture could or could not allow this crisis to occur, identifying
specific
factors.
2. Your Response: Explain the how specific biological factors
in your family could or could not allow this crisis to occur,
identifying
specific factors.
3. Your Response: Explain how specific environmental factors
in your environment could or could not allow this crisis to
occur,
identifying specific factors.
IV. Predictions: In this section, you will explain how an
anthropological perspective can assist in future crises.
a) Reporter: Do you think there is anything that could have
informed these people of the crisis? I would hate to think that
this could hav e been
recognized and prevented earlier.
1. Your Response: How can an anthropologist use people’s
history to help change the future? Think specifically about the
power and
importance of historical events, beliefs, and practices in relation
to the present, providing real-world examples of the connection
between the past and present.
b) Reporter: Now, I can bet there are people at home that are
scared. So, how can you, as an anthropologist, help in
preventing this crisis from
happening to us?
92. Your Response: Explain the value of an anthological lens
when creating preventive a ction plans. Specifically, why
are an objective
lens and cultural sensitivity important when creating
preventive action plans?
3
c) Reporter: Finally, do you still enjoy being an anthropologist
throughout this apparent chaos? I mean, how has being an
anthropologist
helped you out personally?
1. Your Response: How has anthropology helped you better
understand the human condition, and how might this help you in
your
personal and professional life?
93. Milestones
Final Project Part B Milestone One: Choose a Crisis
Situation
In Module Three, you will select the crisis situation that you
will use for your final submission of Final Project Part B. You
will need to explain what crisis situation
you chose and why. This milestone will be graded with the Final
Project Part B Milestone One Rubric.
Final Project Part B Milestone Two: Interview Transcript
Outline
In Module Five, you will submit an outline of Final Project Part
B (Interview Transcript or Recording). In this part of the final
project, you will address the
categories of cultural diversity, anthropological methods,
cultural connections, and predictions of how anthropology can
be useful in a future crisis. Whether you
choose to answer the final project interview questions in written
or audio format, preparing a written draft will help you
formulate and strengthen your answers.
This will also give you practice in learning to see the crisis
situation that you chose from an anthropological viewpoint and
allow your instructor to give any
feedback or suggestions to fortify your interview before your
final project is due. Use the critical elements listed above to
guide your response. This milestone
will be graded with the Final Project Part B Milestone Two
Rubric.
Final Project Part B Submission: Interview Transcript or
Recording
In Module Seven, you will submit Final Project Part B
(Interview Transcript or Recording). It should be a complete,
polished artifact containing all of the critical
elements of the final product. It should reflect the incorporation
94. of feedback gained throughout the course. This submission will
be graded with the Final Project
Part B Rubric.
4
Final Project Part B Rubric
Guidelines for Submission: You have the option of submitting
an interview transcript or interview recording. The interview
transcript should be 4–6 pages in
length and should use double spacing, 12-point Times New
95. Roman font, and one-inch margins. If you choose to submit an
interview recording in place of the
interview transcript, it must be 10 to 15 minutes in length and
should be submitted using the Audio Feature in Brightspace.
Critical Elements Exemplary (100%) Proficient (85%) Needs
Improvement (55%) Not Evident (0%) Value
Cultural Diversity:
Gender
Meets “Proficient” criteria, and
example demonstrates a
nuanced understanding of
sociocultural identity
Provides an example of human
sociocultural identity using
examples related to gender
Provides an example of human
sociocultural identity, but
example is not related to
gender, or with gaps in detail or
accuracy
Does not provide an example of
human sociocultural identity
using examples related to
gender
6
Cultural Diversity:
Human Behavior
Meets “Proficient” criteria, and
96. example demonstrates a
nuanced understanding of
sociocultural identity
Provides an example of human
sociocultural identity using
examples related to human
behavior
Provides an example of human
sociocultural identity, but
example is not related to
human behavior, or with gaps in
detail or accuracy
Does not provide an example of
human sociocultural identity
using examples related to
human behavior
6
Cultural Diversity:
Animals
Meets “Proficient” criteria, and
example demonstrates a
nuanced understanding of
sociocultural identity
Provides an example of human
sociocultural identity using
examples related to animals
Provides an example of human
sociocultural identity, but
97. example is not related to
animals, or with gaps in detail
or accuracy
Does not provide an example of
human sociocultural identity
using examples related to
animals
6
Cultural Diversity:
Crises
Meets “Proficient” criteria, and
description demonstrates keen
insight into the value of an
anthropological perspective
during crises
Describes how anthropologists
can navigate crises while
balancing sensitivity to cultural
beliefs and practices, as well as
the importance of doing so
Describes how anthropologists
can navigate crises while
balancing sensitivity to cultural
beliefs and practices but does
not describe the importance, or
description has gaps in detail or
accuracy
Does not describe how
anthropologists can navigate
98. crises while balancing sensitivity
to cultural beliefs and practices
3.6
Anthropological
Methods: Appropriate
Method
Meets “Proficient” criteria, and
selected method is especially
well aligned with the crisis
Selects an appropriate method
for investigating the crisis,
explaining why this method is
appropriate
Selects an appropriate method
for investigating the crisis but
does not explain why the
method is appropriate,
explanation has gaps in detail or
accuracy, or selection is
inappropriate
Does not select an appropriate
method for investigating the
crisis
3.6
5
99.
100. Critical Elements Exemplary (100%) Proficient (85%) Needs
Improvement (55%) Not Evident (0%) Value
Anthropological
Methods: Reactions
Meets “Proficient” criteria and
demonstrates keen insight into
the complexity of studying
101. people
Describes the types of reactions
that may be received when
studying the group of people
Describes the types of reactions
that may be received when
studying the group of people,
with gaps in detail or accuracy
Does not describe the types of
reactions that may be received
when studying the group of
people
6
Anthropological
Methods: Objective
Lens
Meets “Proficient” criteria, and
explanation demonstrates keen
insight into the importance of
an objective lens
Explains why an objective lens is
important when studying a
group of people and how it may
help calm fears of the people
studied
Explains why an objective lens is
important when studying a