65 biotechnology2008 1

760 views

Published on

0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
760
On SlideShare
0
From Embeds
0
Number of Embeds
217
Actions
Shares
0
Downloads
16
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide
  • Genome = all the DNA of an organism Eukaryotes • 1000 times more DNA • only 10 times more genes - introns, spacers, inefficiency
  • While E. coli lacks this specialized mechanism, it can be induced to take up small pieces of DNA if cultured in a medium with a relatively high concentration of calcium ions. In biotechnology, this technique has been used to introduce foreign DNA into E. coli .
  • Mini-chromosomes
  • Werner Arber discovered restriction enzymes. He postulated that these enzymes bind to DNA at specific sites containing recurring structural elements made up of specific basepair sequences. Hamilton Smith verified Arber's hypothesis with a purified bacterial restriction enzyme and showed that this enzyme cuts DNA in the middle of a specific symmetrical sequence. Other restriction enzymes have similar properties, but different enzymes recognize different sequences. Ham Smith now works at Celera Genomics, the company who sequenced the human genome. Dan Nathans pioneered the application of restriction enzymes to genetics. He demonstrated their use for the construction of genetic maps and developed and applied new methodology involving restriction enzymes to solve various problems in genetics.
  • Strong evidence for a single origin in evolutionary theory.
  • For example, a transgenic rice plant has been developed that produces yellow grains containing beta-carotene. Humans use beta-carotene to make vitamin A. Currently, 70% of children under the age of 5 in Southeast Asia are deficient in vitamin A, leading to vision impairment and increased disease rates.
  • 65 biotechnology2008 1

    1. 1. BiotechnologyAP Biology 2007-2008
    2. 2. A Brave New WorldAP Biology
    3. 3. TACGCACATTTACGTACGCGGATGCCGCGACTATGATCACATAGACATGCTGTCAGCTCTAGTAGACTAGCTGACT human genomeCGACTAGCATGATCGATCAGCTACATGCTAGCACACYC 3.2 billion basesGTACATCGATCCTGACATCGACCTGCTCGTACATGCTACTAGCTACTGACTCATGATCCAGATCACTGAAACCCTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTAP Biology
    4. 4. Biotechnology today  Genetic Engineering  manipulation of DNA  if you are going to engineer DNA & genes & organisms, then you need a set of tools to work with  this unit is a survey of those tools…AP Biology Our tool kit…
    5. 5. Bacteria  Bacteria review  one-celled prokaryotes  reproduce by mitosis  binary fission  rapid growth  generation every ~20 minutes  108 (100 million) colony overnight!  dominant form of life on Earth  incredibly diverseAP Biology
    6. 6. Bacterial genome  Single circular chromosome  haploid  naked DNA  no histone proteins  ~4 million base pairs  ~4300 genes  1/1000 DNA in eukaryote How have these little guys gotten to be so diverse??AP Biology
    7. 7. Transformation promiscuous!?  Bacteria are opportunists  pick up naked foreign DNA mix heat-killed wherever it may be hanging out pathogenic &  have surface transport proteins that are non-pathogenic bacteria specialized for the uptake of naked DNA  import bits of chromosomes from other bacteria  incorporate the DNA bits into their own chromosome  express new genes  transformation mice die  form of recombinationAP Biology
    8. 8. Plasmids  Small supplemental circles of DNA  5000 - 20,000 base pairs  self-replicating  carry extra genes  2-30 genes  genes for antibiotic resistance  can be exchanged between bacteria  bacterial sex!!  rapid evolution  can be imported from environmentAP Biology
    9. 9. How can plasmids help us?  A way to get genes into bacteria easily  insert new gene into plasmid  insert plasmid into bacteria = vector  bacteria now expresses new gene  bacteria make new protein transformed gene from bacteria recombinant other organism plasmid cut DNA + vector glue DNA plasmidAP Biology
    10. 10. Biotechnology  Plasmids used to insert new genes into bacteria cut DNAgene we want like what? …insulin cut plasmid DNA …HGH …lactase Cut DNA? DNA scissors? ligase insert “gene we want”recombinant into plasmid... AP Biology plasmid “glue” together
    11. 11. How do we cut DNA?  Restriction enzymes  restriction endonucleases  discovered in 1960s  evolved in bacteria to cut up foreign DNA  “restrict” the action of the attacking organism  protection against viruses & other bacteria  bacteria protect their own DNA by methylation & by not using the base sequences recognized by the enzymes in their own DNAAP Biology
    12. 12. What do you notice about these phrases? radar palindromes racecar Madam I’m Adam Able was I ere I saw Elba a man, a plan, a canal, Panama Was it a bar or a bat I saw? go hang a salami I’m a lasagna hogAP Biology
    13. 13. Madam I’m Adam Restriction enzymes  Action of enzyme   cut DNA at specific sequences CTGAATTCCG  restriction site GACTTAAGGC   symmetrical “palindrome”  produces protruding ends CTG|AATTCCG  sticky ends GACTTAA|GGC  will bind to any complementary DNA  Many different enzymes  named after organism they are found in  EcoRI, HindIII, BamHI, SmaIAP Biology
    14. 14. 1960s | 1978 Discovery of restriction enzymes Werner Arber Daniel Nathans Hamilton O. SmithRestriction enzymes arenamed for the organismthey come from:EcoRI = 1st restrictionenzyme found in E. coliAP Biology
    15. 15. Restriction enzymes  Cut DNA at specific sites  leave “sticky ends” restriction enzyme cut site GTAACGAATTCACGCTT CATTGCTTAAGTGCGAA restriction enzyme cut site GTAACG AATTCACGCTT CATTGCTTAA GTGCGAAAP Biology
    16. 16. Sticky ends  Cut other DNA with same enzymes  leave “sticky ends” on both  can glue DNA together at “sticky ends” GTAACG AATTCACGCTT gene you want CATTGCTTAA GTGCGAA GGACCTG AATTCCGGATA chromosome want to add CCTGGACTTAA GGCCTAT gene to GGACCTG AATTCACGCTT combined DNAAP Biology CCTGGACTTAA GTGCGAA
    17. 17. Sticky ends help glue genes together cut sites gene you want cut sites TTGTAACGAATTCTACGAATGGTTACATCGCCGAATTCACGCTT AACATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGTGCGAA AATTCTACGAATGGTTACATCGCCG GATGCTTACCAATGTAGCGGCTTAA isolated gene sticky ends cut sites chromosome want to add gene to AATGGTTACTTGTAACG AATTCTACGATCGCCGATTCAACGCTT TTACCAATGAACATTGCTTAA GATGCTAGCGGCTAAGTTGCGAADNA ligase joins the strands Recombinant DNA molecule sticky ends stick together chromosome with new gene added TAACGAATTCTACGAATGGTTACATCGCCGAATTCTACGATC AP Biology CATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATGCTAGC
    18. 18. How can bacteria read Why mix genes together? human DNA?  Gene produces protein in different organism or different individual human insulin gene in bacteria TAACGAATTCTACGAATGGTTACATCGCCGAATTCTACGATC CATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATGCTAGC “new” protein from organism ex: human insulin from bacteria aa aa aa aa aa aa aa aa aa aa bacteria human insulinAP Biology
    19. 19. The code is universal  Since all living organisms…  use the same DNA  use the same code book  read their genes the same wayAP Biology
    20. 20. Copy (& Read) DNA  Transformation  insert recombinant plasmid into bacteria  grow recombinant bacteria in agar cultures  bacteria make lots of copies of plasmid  “cloning” the plasmid  production of many copies of inserted gene  production of “new” protein  transformed phenotype DNA → RNA → protein → traitAP Biology
    21. 21. Grow bacteria…make more transformed gene from bacteria recombinant other organism plasmid + vector plasmid grow bacteria harvest (purify) proteinAP Biology
    22. 22. Uses of genetic engineering  Genetically modified organisms (GMO)  enabling plants to produce new proteins  Protect crops from insects: BT corn  corn produces a bacterial toxin that kills corn borer (caterpillar pest of corn)  Extend growing season: fishberries  strawberries with an anti-freezing gene from flounder  Improve quality of food: golden rice  rice producing vitamin A improves nutritional valueAP Biology
    23. 23. Green with envy?? Jelly fish “GFP”AP Biology Transformed vertebrates
    24. 24. Cut, Paste, Copy, Find…  Word processing metaphor…  cut  restriction enzymes  paste  ligase  copy  plasmids  bacterial transformation  is there an easier way??  find  ????AP Biology
    25. 25. I’m a very special pig! Got any Questions?AP Biology 2007-2008

    ×