Microsatellites are tandemly repeated DNA sequences with repeat units of 1-6 base pairs. They are highly polymorphic due to variations in the number of repeats between individuals. Microsatellites can be analyzed using PCR and electrophoresis to differentiate alleles and study genetic diversity, population structure, and parentage. A genetic map of microsatellites was constructed for turbot fish to enable future quantitative trait locus identification and evolutionary studies. Microsatellites are a powerful tool for various areas of genetics research.

1. Microsatellite
Dr Karan Veer Singh
NBFGR

2. What is a microsatellite?
Tandemly repeated DNA (may see in the
literature as STRs - Short tandem repeats)
– Poly A/T most common
– 1-10 bp tandemly repeated = ‘micro’ satellite
– >10 = ‘mini’ satellite
Types of microsats
– Di, tetra and tri nucleotide (used in that order)
– Perfect
– Imperfect/interrupted
– Compound
Varying levels of variation associated with each type
Difficulty in scoring

3. Short Tandem Repeats (STRs)
AATG
7 repeats
8 repeats
the repeat region is variable between samples while the
flanking regions where PCR primers bind are constant
Homozygote = both alleles are the same length
Heterozygote = alleles differ and can be resolved
from one another

4.  Also called as STR, SSR, VNTR
 Tandemly repeated DNA sequences with the
repeat/size of 1 – 6 bases repeated several
times
 Highly polymorphic; can be analysed with the
help of PCR
 Individual alleles at a locus differ in number
of tandem repeats of unit sequence owing to
gain of loss of one or more repeats and they
can be differentiated by electrophoresis
according to their size
 Powerful DNA markers for quantifying genetic
variations within & between populations of a
species

5. Microsatellites – Types
Based on repeat pattern
• Perfect – CACACACACACACACACACACA
• Imperfect – CACACACACA CACACACA
CACACACA
6. Compound –
CACACACACACACA CATACATACATA CATACATACATA
• Complex – CACACACACACACACA
AATAATAATAATAATAATAAT

6. Based on number of base pairs
2) Mono (e.g. CCCCCCCC or AAAAAA)
3) Di (e.g. CACACACACA)
4) Tri (e.g. CCA CCA CCA CCA)
5) Tetra (e.g. GATA GATA GATA GATA GATA GATA GATA)
Minisatellites: - (9 – 65 base pairs repeated from 2
to several hundred times)
CGCCATTGTAGCCAATCCGGGTGCGATTGCAT CGCCATTGT
AGCCAATCCGGGTGCGATTGCAT CGCCATTGTAGCCAATCCGGG
TGCGATTGCAT CGCCATTGTAGCCAATCCGGGTGCGATTGCAT
CGCCATTGTAGCCAATCCGGGTGCGATTGCAT

7. Microsatellites – Properties
 Co-dominant
 Inherit in Mendelian Fashion
 Polymorphic loci with allele number as high as 14 – 15
per locus
 Mostly reported from non-coding region, hence can be
independent of selection
 Flanking region is highly conserved in related species
 Can be obtained from small amounts of tissues [STR
analysis can be done on less than one billionth of a
gram (a nanogram) of DNA (as in a single flake of
dandruff)]
 PAGE separation; silver staining/automated genotyping
 Abundant in the eukaryote genome (~103 to 105 loci
dispersed at 7 to 10100 kilobase pair (kb) intervals)

10. Microsatellites and Human Diseases
Allele size variations in microsatellite loci in close
proximity (showing linkage disequilibrium) to the following
genes within the Human Major Histocompatibility Complex
(MHC) region
• IDDM (Insulin Dependent Diabetes Mellitus)
• Multiple Sclerosis (MS)
• Narcolepsy
• Uveitis
have been reported to cause genetic disorders; hence these
genetic disorders can be detected by screening the allele
sizes of the microsatellite loci (Type I markers) that are in
close proximity to these genes (Goldstein & Schlotterer,
2001)

11. The microsatellite, or short sequence repeat (SSR), is a
powerful genetic marker, useful in many areas of fish
genetics and breeding.
Polymorphic microsatellite loci have been frequently applied
to the analysis of genetic diversity,
population genetic structure, and
genomic mapping.
These co-dominant markers have also been applied to the
classification and systematics,
parentage identification,
germplasm conservation, and
breeding programme of food fish.

12. The zebrafish is the first vertebrate organism used for large-
scale genetic screens seeking genes critical to development.
1800 recessive mutations discovered to morphogenesis of the
vertebrate embryo. The cloning of the mutant genes depends on a
dense genetic map.
The 2000 markers, using microsatellite (CA) repeats,
provides 1.2-cM average resolution.
One centimorgan in zebrafish is about 0.74 megabase, so, for many
mutations, these markers are close enough to begin positional cloning
by YAC walks.

13. A Microsatellite Genetic Map of the Turbot (Scophthalmus maximus)
Genetics. 2007 December; 177(4): 2457–2467.
A consensus microsatellite-based linkage map was constructed from two
unrelated families. The mapping panel was derived from a gynogenetic family
of 96 haploid embryos and a biparental diploid family of 85 full-sib progeny
with known linkage phase.
A total of 242 microsatellites were mapped in 26 linkage groups.
The consensus map length was 1343.2 cM, with an average distance between
markers of 6.5 ± 0.5 cM.
The comparison of turbot microsatellite flanking sequences against
the Tetraodon nigroviridis genome revealed 55 significant matches, with a
mean length of 102 bp and high sequence similarity (81–100%).
This map will be suitable for QTL identification of productive traits in this
species and for further evolutionary studies in fish and vertebrate species.

14. Cloning and isolating genes:
 Locating a gene is easy if the gene product (protein) is identified.
• Create a cDNA library using an expression vector.
• Probe with antibodies that bind the gene product.
• Isolate and sequence positive clones.
 If the gene product is unknown, locating a gene is more difficult.
• Identify a marker (microsatellite, RFLP, SNPs) that is physically linked to
the gene on the same chromosome, and segregates in test crosses with the
disease phenotype (i.e., shows a strong statistical association).
• Use a technique called positional cloning to home in on gene.
e.g., cloning and discovery of the cystic fibrosis (CF) gene.

19. 2. To refine search, specify a
marker type and/or a taxonomy
Markers Search (species). For taxonomy use
common or scientific name.
1. Type marker
name. Use * for
3. Click “search
wildcards.
icon.”
Or Click to run
sample searches.
Clicking on “Search”
lets you search for
markers of that type.
These tables show a
Clicking on a marker type lets breakdown of markers
you view a definition of that in the database by
marker type. marker type.

20. Genetic Diversity Studies of seahorse: Microsatellite
2.Molecular Data Analysis using Genetic software
•Sequence editing /Processing/ Submission
•Molecular data analysis (EditSeq, MegaBACE, CLUSTALW,BIOEDIT, MEGA 4, Arlequin)
•Phylogenetic analysis (PAUP,MOLPHY,MEGA,AMOVA)

21. Sites of occurrences

22. Total 23 alleles
No Gene Flow
Genetic Tags
Stock specific Markers
Partitioning of Breeding Population
Limitation in Migration

23. Total 11 Private Alleles
No Mixing of Gene Pool
* Stock- Specific markers
* Genetic TAGs for selection programs

24. Microsatellites PCR reaction Mixture & Volume per
Concentration reaction
Double distilled water 18.0µL
Assay buffer (10X; Genei, Bangalore, India) 2.5µL
(100mM Tris, 500mM KCl, 0.1% gelatin, pH9) (final
conc. 1X)
dNTPs (Genei, Bangalore, India) (200 mM) 2.0µL
Primer (forward & reverse working solution) (total 0.5µL
conc. ~ 10.0 pmoles in 25µl of master mix)
MgCl2 (1.5mM ) 0.5 µl
Taq polymerase (Genei, Bangalore, India) (3Units/ 0.5µL
µl)
Template DNA (25ng) 1.0µL
Total volume 25.0µL

26. Microsatellite PCR

27. 10% non- denaturing Polyacrylamide gel
electrophoresis (PAGE) to separate the PCR
products
Acrylamide (19:1 acrylamide : 5mL
and bisacrylamide)
Double distilled water : 2mL
5 x TBE : 2mL
10% Ammonium persulphate : 70µL
TEMED : 3.5µL

28. M 1 2 3 4 5 6 7 8 9 10 11 –ve M
Single Locus Microsatellites
(PAGE & Silver staining;
There are five alleles at this locus)
M: Standard molecular weight marker (pBR322 DNA/MspI digest).
1 -11: Different individuals -ve : Negative control

29. Microsatellites- multiplexing &
Use of Fluorescent dyes

30. Automated Genotyping
A sample print-out for one person, showing all 16 loci
tested. Different colours help with interpretation

31. Thanks
The Improbable seahorses,National Geography 1994