Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

Microsatellite

24,258 views

Published on

Published in: Technology
  • only 2 cups a day for 1 week for a flat stomach ■■■ https://tinyurl.com/bkfitness4u
       Reply 
    Are you sure you want to  Yes  No
    Your message goes here

Microsatellite

  1. 1. Microsatellite Dr Karan Veer Singh NBFGR
  2. 2. What is a microsatellite?Tandemly repeated DNA (may see in theliterature as STRs - Short tandem repeats)– Poly A/T most common– 1-10 bp tandemly repeated = ‘micro’ satellite– >10 = ‘mini’ satelliteTypes of microsats– Di, tetra and tri nucleotide (used in that order)– Perfect– Imperfect/interrupted– Compound Varying levels of variation associated with each type Difficulty in scoring
  3. 3. Short Tandem Repeats (STRs) AATG 7 repeats 8 repeats the repeat region is variable between samples while the flanking regions where PCR primers bind are constantHomozygote = both alleles are the same lengthHeterozygote = alleles differ and can be resolved from one another
  4. 4.  Also called as STR, SSR, VNTR Tandemly repeated DNA sequences with the repeat/size of 1 – 6 bases repeated several times Highly polymorphic; can be analysed with the help of PCR Individual alleles at a locus differ in number of tandem repeats of unit sequence owing to gain of loss of one or more repeats and they can be differentiated by electrophoresis according to their size Powerful DNA markers for quantifying genetic variations within & between populations of a species
  5. 5. Microsatellites – TypesBased on repeat pattern• Perfect – CACACACACACACACACACACA• Imperfect – CACACACACA CACACACA CACACACA6. Compound – CACACACACACACA CATACATACATA CATACATACATA• Complex – CACACACACACACACA AATAATAATAATAATAATAAT
  6. 6. Based on number of base pairs2) Mono (e.g. CCCCCCCC or AAAAAA)3) Di (e.g. CACACACACA)4) Tri (e.g. CCA CCA CCA CCA)5) Tetra (e.g. GATA GATA GATA GATA GATA GATA GATA)Minisatellites: - (9 – 65 base pairs repeated from 2 to several hundred times) CGCCATTGTAGCCAATCCGGGTGCGATTGCAT CGCCATTGTAGCCAATCCGGGTGCGATTGCAT CGCCATTGTAGCCAATCCGGGTGCGATTGCAT CGCCATTGTAGCCAATCCGGGTGCGATTGCATCGCCATTGTAGCCAATCCGGGTGCGATTGCAT
  7. 7. Microsatellites – Properties Co-dominant Inherit in Mendelian Fashion Polymorphic loci with allele number as high as 14 – 15 per locus Mostly reported from non-coding region, hence can be independent of selection Flanking region is highly conserved in related species Can be obtained from small amounts of tissues [STR analysis can be done on less than one billionth of a gram (a nanogram) of DNA (as in a single flake of dandruff)] PAGE separation; silver staining/automated genotyping Abundant in the eukaryote genome (~103 to 105 loci dispersed at 7 to 10100 kilobase pair (kb) intervals)
  8. 8. Microsatellites and Human DiseasesAllele size variations in microsatellite loci in closeproximity (showing linkage disequilibrium) to the followinggenes within the Human Major Histocompatibility Complex(MHC) region • IDDM (Insulin Dependent Diabetes Mellitus) • Multiple Sclerosis (MS) • Narcolepsy • Uveitishave been reported to cause genetic disorders; hence thesegenetic disorders can be detected by screening the allelesizes of the microsatellite loci (Type I markers) that are inclose proximity to these genes (Goldstein & Schlotterer,2001)
  9. 9. The microsatellite, or short sequence repeat (SSR), is apowerful genetic marker, useful in many areas of fishgenetics and breeding.Polymorphic microsatellite loci have been frequently appliedto the analysis of genetic diversity, population genetic structure, and genomic mapping.These co-dominant markers have also been applied to theclassification and systematics, parentage identification, germplasm conservation, and breeding programme of food fish.
  10. 10. The zebrafish is the first vertebrate organism used for large-scale genetic screens seeking genes critical to development.1800 recessive mutations discovered to morphogenesis of thevertebrate embryo. The cloning of the mutant genes depends on adense genetic map.The 2000 markers, using microsatellite (CA) repeats,provides 1.2-cM average resolution.One centimorgan in zebrafish is about 0.74 megabase, so, for manymutations, these markers are close enough to begin positional cloningby YAC walks.
  11. 11. A Microsatellite Genetic Map of the Turbot (Scophthalmus maximus) Genetics. 2007 December; 177(4): 2457–2467.A consensus microsatellite-based linkage map was constructed from twounrelated families. The mapping panel was derived from a gynogenetic familyof 96 haploid embryos and a biparental diploid family of 85 full-sib progenywith known linkage phase.A total of 242 microsatellites were mapped in 26 linkage groups.The consensus map length was 1343.2 cM, with an average distance betweenmarkers of 6.5 ± 0.5 cM.The comparison of turbot microsatellite flanking sequences againstthe Tetraodon nigroviridis genome revealed 55 significant matches, with amean length of 102 bp and high sequence similarity (81–100%).This map will be suitable for QTL identification of productive traits in thisspecies and for further evolutionary studies in fish and vertebrate species.
  12. 12. Cloning and isolating genes: Locating a gene is easy if the gene product (protein) is identified. • Create a cDNA library using an expression vector. • Probe with antibodies that bind the gene product. • Isolate and sequence positive clones. If the gene product is unknown, locating a gene is more difficult. • Identify a marker (microsatellite, RFLP, SNPs) that is physically linked to the gene on the same chromosome, and segregates in test crosses with the disease phenotype (i.e., shows a strong statistical association). • Use a technique called positional cloning to home in on gene. e.g., cloning and discovery of the cystic fibrosis (CF) gene.
  13. 13. 2. To refine search, specify a marker type and/or a taxonomy Markers Search (species). For taxonomy use common or scientific name. 1. Type marker name. Use * for 3. Click “search wildcards. icon.” Or Click to run sample searches.Clicking on “Search”lets you search formarkers of that type. These tables show a Clicking on a marker type lets breakdown of markers you view a definition of that in the database by marker type. marker type.
  14. 14. Genetic Diversity Studies of seahorse: Microsatellite 2.Molecular Data Analysis using Genetic software•Sequence editing /Processing/ Submission•Molecular data analysis (EditSeq, MegaBACE, CLUSTALW,BIOEDIT, MEGA 4, Arlequin)•Phylogenetic analysis (PAUP,MOLPHY,MEGA,AMOVA)
  15. 15. Sites of occurrences
  16. 16. Total 23 alleles No Gene Flow Genetic TagsStock specific MarkersPartitioning of Breeding PopulationLimitation in Migration
  17. 17. Total 11 Private Alleles No Mixing of Gene Pool* Stock- Specific markers* Genetic TAGs for selection programs
  18. 18. Microsatellites PCR reaction Mixture & Volume perConcentration reactionDouble distilled water 18.0µLAssay buffer (10X; Genei, Bangalore, India) 2.5µL(100mM Tris, 500mM KCl, 0.1% gelatin, pH9) (finalconc. 1X)dNTPs (Genei, Bangalore, India) (200 mM) 2.0µLPrimer (forward & reverse working solution) (total 0.5µLconc. ~ 10.0 pmoles in 25µl of master mix)MgCl2 (1.5mM ) 0.5 µlTaq polymerase (Genei, Bangalore, India) (3Units/ 0.5µLµl)Template DNA (25ng) 1.0µLTotal volume 25.0µL
  19. 19. Microsatellite PCR
  20. 20. 10% non- denaturing Polyacrylamide gelelectrophoresis (PAGE) to separate the PCRproductsAcrylamide (19:1 acrylamide : 5mLand bisacrylamide)Double distilled water : 2mL5 x TBE : 2mL10% Ammonium persulphate : 70µLTEMED : 3.5µL
  21. 21. M 1 2 3 4 5 6 7 8 9 10 11 –ve M Single Locus Microsatellites (PAGE & Silver staining; There are five alleles at this locus)M: Standard molecular weight marker (pBR322 DNA/MspI digest). 1 -11: Different individuals -ve : Negative control
  22. 22. Microsatellites- multiplexing & Use of Fluorescent dyes
  23. 23. Automated GenotypingA sample print-out for one person, showing all 16 loci tested. Different colours help with interpretation
  24. 24. ThanksThe Improbable seahorses,National Geography 1994

×