This document summarizes research analyzing plant resistance genes in saffron (Crocus sativus) using RNA-Seq data. The researchers collected saffron RNA-Seq data and plant resistance gene data. They mapped the data and annotated over 100,000 contigs assembled from over 26 million reads. BLAST analysis found hits for saffron resistance genes, with the highest numbers in stigma tissue. The genes were classified and RLPs, kinases, RLKs were most common. Further work proposed mapping the genes to a saffron genome when sequenced and clustering/classifying for polyploidy analysis.
Receptor-like proteins (RLPs) and kinases are major classes of resistance genes in saffron (crocus sativus)
1. In the name of Allah
Receptor-like proteins (RLPs) and
kinases are major classes of resistance
genes in saffron (crocus sativus)
Ehsan Sepahia*, Ali Mohammad Banaei-Moghaddamb, Kaveh Kavousia
a Department of Bioinformatics, University of Tehran, Tehran, Iran
b Department of Biochemistry, University of Tehran, Tehran, Iran
2. The main question
Is it possible to address ploidy level and polyploidy form
of an organism using RNA-Seq data?
…………………………………….…………………………………..
2
6. Gene pattern of triploids
…CATGATCGATGTCGTAGCTACGAGTCACGTCTATATGCATCGAT…
…CATGATCCCTGTCGGAGCTACGAGTCCTGTCTATGATCATCGAT…
…CATGTTCGATGTCGGAGCTACGAGTCCTGTCTATATGCATCGAT…
…………………………………….…………………………………..
6
You must see this pattern in multiple genes
21. STEP 1
Data collection
STEP 2
Data mapping
STEP 3
Annotation
STEP 4
Further Works
The main questionIs it possible to address ploidy level and polyploidy form of an organism using
RNA-Seq data?
…………………………………….…………………………………..
21