Genes in complex neurological disorders
•
3 likes•1,687 views
Gene identification in complex neurological disorders
Recommended
More Related Content
What's hot
What's hot (20)
Viewers also liked
Similar to Genes in complex neurological disorders
Similar to Genes in complex neurological disorders (20)
Recently uploaded
Recently uploaded (20)
Genes in complex neurological disorders
- 1. Gene iden'fica'on in complex neurological disorders Denise Sheer
- 2. Overview • Types of gene0c aberra0ons that can cause neurological disorders • Approaches for iden0fying genes associated with neurological disorders: 1. Linkage studies 2. Homozygosity mapping 3. Exome & whole genome sequencing 4. Genome-‐wide associa0on studies 5. Detec0on of structural varia0on 6. Transcriptomics
- 3. 46 chromosomes 2m DNA 3 x 109 base pairs ~ 22,000 genes The human genome
- 4. Muta'ons of various types cause neurological disease Muta'on type Muta'on subtype Example(s) SINGLE NUCLEOTIDE Point muta0ons, inser0ons, dele0ons Missense, nonsense, frameshiU, splice site, addi0on or dele0on of amino acid(s) Many neurological disorders with a gene0c basis MICROSATELLITE EXPANSION Triplet repeat (polyglutamine) Hun0ngton disease (HTT) Triplet repeat (polyanaline) Congenital central hypoven0la0on syndrome (PHOXB2) Triplet repeat (other) Fragile X mental retarda0on syndrome (CGG repeat expansion in FMR 5’UTR) Myotonic dystrophy 1 (CTG repeat expansion in DMPK 3’UTR) Adapted from P.M.Boone et al, Hum Genet 2011
- 5. Muta'ons of various types cause neurological disease Muta'on type Muta'on subtype Example(s) STRUCTURAL VARIATION Karyotypic Aneuploidy Down syndrome Transloca0on X-‐linked mental retarda0on 58 Copy number Genomic dele0on Hereditary neuropathy with liability to pressure palsies Genomic duplica0on Charcot-‐Marie-‐Tooth disease, type 1A Whole gene dele0on Autosomal recessive early onset Parkinson disease 6 (PINK1) Whole gene duplica0on Early onset Alzheimer disease with cerebral amyloid angiopathy (APP) Intragenic dele0on Duchenne muscular dystrophy (DMD) Intragenic duplica0on Autosomal dominant dopa-‐responsive dystonia (GCH1) Non-‐coding X-‐linked spas0c paraplegia type 2 (near PLP1) Inversion -‐ Duchenne muscular dystrophy and other features inv(X)(p21.2q22.2) Adapted from P.M.Boone et al, Hum Genet 2011
- 6. Disease gene iden'fica'on 1. Linkage studies 2. Homozygosity mapping 3. Exome & whole genome sequencing 4. Genome-‐wide associa0on studies 5. Detec0on of structural varia0on 6. Transcriptomics
- 7. Applica'on of current methods for disease gene iden'fica'on A.B. Singleton, Trends in Genetics 2010 (based on T.A. Manolio, Nature 2009) High risk, rare alleles APP, PS mut in AD LRKK2 mut in PD Moderate risk, low frequency alleles GBA mut in PD Low risk, common alleles CLU, PICALM, CR1 mut in AD SNCA, MAPT mut in PD
- 8. T.A. Manolio, Nature 2009 Feasibility of iden'fying gene'c variants by strength of gene'c effect (odds ra'o) and risk allele frequency
- 9. Phenotypic variation Wilt Chamberlain, NBA basketball player 7 feet, 1 inch; 275 pounds Willie Shoemaker, horse racing jockey 4 feet, 11 inches; barely 100 pounds 1. Linkage studies
- 10. In human beings, 99.9% of the DNA sequence is the same Remaining 0.1% makes a person unique - Different attributes/characteristics traits - Diseases he/she develops These variations can be: - Harmless (change in phenotype) - Harmful (diabetes, cancer, heart disease, Huntington's disease, and hemophilia ) - Latent (variations in coding and regulatory regions, are not harmful on their own, and the change in each gene only becomes apparent under certain conditions) Genetic variation underlies phenotypic differences
- 11. Single Nucleotide Polymorphism - SNP - Variation in DNA sequence (substitutions, deletions, insertion, etc) that is present at a frequency greater than 1% in a population. Mutation - Variation in DNA sequence (substitutions, deletions, etc) that is present at a frequency lower than 1% in a population. ATTGGCCTTAACCCCCGATTATCAGGAT ATTGGCCTTAACCTCCGATTATCAGGAT Allele A Allele B
- 13. Linkage studies • Loci are linked if they are close to each other • Search for co-‐inheritance of the disease with polymorphic markers • Obtain loca0on of gene • Sequence • Limited applica0on for late-‐onset diseases 12 PARK8/LRRK2 Leucine-‐Rich Repeat Kinase 2 Autosomal Dominant Parkinson’s Disease C. Paysan-Ruiz et al, Neuron 2004
- 14. 2. Homozygosity mapping • Genome-‐wide genotyping using high density SNP microarrays • Autosomal recessive diseases Frontotemporal Demen'a – like disease AA AA AB Adapted from J.Bras et al, Nat Rev Neurosc 2012
- 15. Homozygosity mapping C. Paysan-Ruiz et al, Ann Neurol 2009 p.R747W +/+ Dystonia-‐Parkinsonism • PLA2G6 • Phospholipase A2, group VI 22 PLA2G6 rs7288109 rs16996781
- 16. 3. Exome & whole genome sequencing Exon 1 Exon 2 Exon 3 Intron 1 Intron 2 DNA Transcription start site Protein Pre-mRNA Transcription Splicing Translation mRNA Intergenic regionPromoterEnhancer Gene
- 17. Exome & whole genome sequencing Adapted from J.Bras et al, Nat Rev Neurosc 2012
- 18. Examples of neurological disease genes iden'fied by exome sequencing Disorder Gene Au0s0c spectrum disorder Mul0ple, CHD8, KATNAL2 Au0sm UBE3B, CLTCL1,NCKAP5L, ZNF18, ANK2, SCN2A AD cerebellar ataxia, deafness & narcolepsy DNMT1 AD early onset Alzheimer’s disease SORL1 AD spinocerebellar ataxia PRKCG, TGM6 AR infan0le onset spinocerebellar ataxia CC10orf2 AR pontocerebellar hypoplasia and spinal motor neuron degenera0on EXOSC3 Brown-‐Vialeho-‐Van Laere syndrome (early onset ALS) SLC52A3 Charcot-‐Marie-‐Tooth neuropathy Mul0ple heterozygous variants Essen0al tremor FUS Adapted from Handel et al, Exp Rev Neuropath 2013AD, AR: Autosomal dominant, recessive
- 19. Clinical Whole-‐Exome Sequencing for the Diagnosis of Mendelian Disorders, Yang et al, NEJM 2013 250 pa0ents: 80% were children with neurologic phenotypes
- 20. Clinical Whole-‐Exome Sequencing for the Diagnosis of Mendelian Disorders, Yang et al, NEJM 2013
- 21. Clinical Whole-‐Exome Sequencing for the Diagnosis of Mendelian Disorders, Yang et al, NEJM 2013
- 22. Clinical Whole-‐Exome Sequencing for the Diagnosis of Mendelian Disorders, Yang et al, NEJM 2013
- 23. Clinical Whole-‐Exome Sequencing for the Diagnosis of Mendelian Disorders, Yang et al, NEJM 2013
- 24. Neurological disease genes iden'fied by whole genome sequencing Disorder Gene Charcot-‐Marie-‐ Tooth neuropathy SH3TC2 Familial Amyotrophic Lateral Sclerosis C9orf72 Infan0le epilep0c encephalopathy and SUDEP SCN8A Complex motor and sensory axonal neuropathy plus microcephaly VRK1 Adapted from: Handel et al, Exp Rev Neuropath 2013 & C. Gonzaga-Jauregui et al, JAMA Neurol 2013
- 25. Whole genome sequencing in a pa'ent with Charcot-‐Marie-‐Tooth neuropathy, Lupski et al, NEJM 2010
- 26. Whole genome sequencing in a pa'ent with Charcot-‐Marie-‐Tooth neuropathy, Lupski et al, NEJM 2010 Professor James R Lupski, Baylor College of Medicine
- 27. Whole genome sequencing in a pa'ent with Charcot-‐Marie-‐Tooth neuropathy, Lupski et al, NEJM 2010 Charcot-‐Marie-‐Tooth neuropathy • Childhood onset neurodenera0ve disease • Characterised by demyelina0on of motor and sensory nerves • Most common inherited disorder of the peripheral nervous system • Two major phenotypic types according to electrophysiological, clinical, and nerve-‐biopsy evalua0ons • glial myelinopathy (CMT type 1) • neuronal axonopathy (CMT type 2) • Each type can be inherited in a dominant, recessive or X-‐linked manner • PMP22 duplica0on accounts for 70% of cases • Many other genes associated with remaining cases • CMT4C is caused by homozygous or compound heterozygous muta0ons in SH3TC2 gene
- 28. Whole genome sequencing in a pa'ent with Charcot-‐Marie-‐Tooth neuropathy, Lupski et al, NEJM 2010 CMT: Charcot-‐Marie-‐Tooth neuropathy MMM: mild mononeuropathy of the median nerve
- 29. Whole genome sequencing in a pa'ent with Charcot-‐Marie-‐Tooth neuropathy, Lupski et al, NEJM 2010 Muta0ons in the SH3TC2 gene R954X, with or without Y169H muta0on, muta0on was associated with Carpal Tunnel Syndrome
- 30. Whole genome sequencing in a pa'ent with Charcot-‐Marie-‐Tooth neuropathy, Lupski et al, NEJM 2010 SH3TC2 • SH3 domain and tetratricopep0de repeats-‐containing protein 2 • Expressed in Schwann cells • Localises in plasma membrane and to the perinuclear endocy0c recycling compartment • Proposed to be an adaptor or docking molecule • Presumed role in myelina'on • Numerous homozygous and compound heterozygous muta0ons have been iden0fied in CMT4C • Nonsense variant: p.R954X • Missense variant: p.Y169H
- 31. SH3TC2: A role in endocy'c recycling Adapted from R.C.Roberts et al, Hum Mol Genet 2010 Y169H R954X Muta0ons iden0fied in Lupski et al, 2010 Muta0ons in CMT4C found to mistarget SH3TC2 away from the recycling endosome
- 32. Whole genome sequencing in a pa'ent with Charcot-‐Marie-‐Tooth neuropathy, Lupski et al, NEJM 2010 SH3TC2 • Nonsense variant: p.R954X • Missense variant: p.Y169H • High degree of conserva0on of Y169 in vertebrates
- 33. 4. Genome-‐wide associa'on studies -‐ GWAS Direct Associa0on Indirect Associa0on Disease gene SNP • Examine a large number of SNPs in large numbers of affected and control cases • Iden0fy SNPs that associate with the disease Common Disease, Common Variant hypothesis: A common variable (i.e. with a high minor allele frequency that can therefore be seen in most individuals) modulates risk to disease development
- 34. Gibson & Muse: A primer of genome science GWAS workflow
- 35. GWAS analysis of Parkinson’s disease MulZple genes at a single locus GAK: cyclin G associated kinase TMEM175: transmembrane protein 175 DGKQ: diacylglycerol kinase theta 110 kDa M.A.Nalls et al, Lancet 2011; J.Bras et al, Nat Rev Neurosc 2012
- 36. Examples of disease genes iden'fied by GWAS analysis Disease Gene (locus) Parkinson’s disease SYT11, ACMSD, STK39, MCC1/LAMP3; GAK, BST1, SNCA, HLADRB5, LRRK2, CCDC62/ HIP1R, MAPT PARK16, STBD1, GPNMB, FGF20, STX1B SCARB2, SREBF1/RAI1 Alzheimer’s disease ABCA7, MS4A6A/MS4A4E, EPHA1, CD33, CD2AP CLU, CR1, PICALM, BIN1, APOE, TOMM40 Stroke NINJ2-‐WNK1 HDAC9 Bipolar disorder ODZ4, CACNA1C, NCAN Schizophrenia MIR137, VRK2,ZNF804A, PCGEM1, MHC, MMP16, CSMD1, LSM1, CNNM2, NT5C2, AMBRA1, NRGN, CCDC68, TCF4 Adapted from J.Bras et al, Nat Rev Neurosc 2012 & P.F. Sullivan, Nat Rev GeneZcs 2013
- 37. NHGRI GWA Catalog www.genome.gov/GWAStudies www.ebi.ac.uk/fgpt/gwas/ Published Genome-‐Wide Associa'ons through 12/2012 p≤5X10-‐8 for 17 trait categories
- 38. DATABASES NCBI dbSNP http://www.ncbi.nlm.nih.gov/SNP/index.html GWAS Central http://www.gwascentral.org/ 1000 genomes project http://www.1000genomes.org/
- 39. 5. Detec'on of structural varia'on M.E.Hurles et al, TIG 2008
- 40. ALTERED GENE DOSAGE ALTERED STRUCTURE OF REGULATORY ELEMENTS enhancer represser exons Inser'on Dele'on of repressor Exon duplica'on Gene duplica'on Adapted from M.E.Hurles et al, TIG 2008 Impact of structural varia'on on gene func'on
- 41. Structural varia'on Copy number varia0on (CNV) • Array CGH/high density SNP microarrays All structural varia0on • Exome and whole genome sequencing Reference DNA Test DNA
- 42. Examples of CNVs in neurodevelopmental syndromes CGS: con0guous gene dele0on/duplica0on syndrome UPD: uniparental disomy Syndrome Locus Aberra'on Gene(s) Neurodevelopmental Williams-‐Beuren del(7)q11.23; dup(7)q11.23 17q11.23 Dele0on; Duplica0on CGS incl ELN Angelman; Prader-‐Willi 15q11-‐ q12 Mat dele0on, pat UPD15; Pat dele0on, mat UPD15 UBE3A; CGS Smith-‐Magenis; Potocki-‐Lupski 17p11.2 Dele0on; Duplica0on GCS incl RAI1; RAI1 Reh; Reh-‐like Xq28 Dele0on; Duplica0on, triplica0on MECP2; MECP2 Pelizaeus-‐Merzbacher Xq22.2 Duplica0on, dele0on PLP1 Adapted from Stankiewicz & Lupski, Ann Rev Med 2010
- 43. Neurodegenera've Parkinson’s 4q21 Duplica0on, triplica0on SNCA Spinal muscular dystrophy 5q13 Dele0on, gene conversion SMN1, SMN2 CMT1A; HNPP 17p12 Duplica0on; Dele0on PMP22 Alzheimer’s 21q21 Duplica0on APP Examples of CNVs in neurodegenera've syndromes Adapted from Stankiewicz & Lupski, Ann Rev Med 2010
- 44. Peripheral myelin protein-‐22 (PMP22) J.Li et al, Mol Neurobiol 2013 Gene structure • Ex 1a in myelina0ng Schwann cells • Ex 1b in non-‐ neuronal cells Predicted Protein Structure
- 45. J.Li et al, Mol Neurobiol 2013 Hypothe'cal mechanisms involving PMP22 in CMT1a, HNPP & CMT1E
- 46. Complex rearrangements at the PMP22 locus Adapted from Zhang et al, Nat Genet 2009 PMP22: peripheral myelin protein 22 RAI1: re0noic acid induced 1
- 47. 6. Transcriptomics Sequencing genome-‐wide RNA synthesis Adapted from J.Bras et al, Nat Rev Neurosc 2012
- 48. Examples of transcriptomic approaches to complex neurological diseases Disease RNA-‐seq experimental design Gene Alzheimer’s disease Human brain 0ssue APOE Amyotrophic lateral sclerosis Drosophila TBPH Au0sm Human brain 0ssue Adenosine-‐to-‐inosine edi0ng Au0sm Human primary neural stem cells RBFOX1 splicing network Canine neonatal cerebellar cor0cal degenera0on Dogs SPTBN2 Mul0ple sclerosis Primary human CD4+ cells CD6 Schizophrenia, bipolar disorder, au0sm Cultured neurons Noncoding RNA Adapted from Handel et al, Exp Rev Neuropath 2013
- 49. Mosaic copy number varia'on in human neurons, M.J.McConnell et al, Science 2013 Human frontal cortex neurons DNA copy number analysis & single-‐cell sequencing 13-‐41% have at least one de novo CNV Dele0ons twice as common as duplica0ons Subset of neurons has mul0ple genomic altera0ons
- 50. M.J.McConnell et al, Science 2013 Copy number varia'on in postmortem human neurons using single cell sequencing Male Female
- 51. Transmitting genomes Deletions, duplications, and other mutations may arise at different places in a developmental lineage. M.J.McConnell et al, Science 2013 Macosko & McCarroll Science 2013
- 52. Please contact me if you have any quesZons d.sheer@qmul.ac.uk