1. Starting in the name of ALLAH who is most merciful and
beneficent
Databases used in forensic sciences and current status
of this science in Pakistan in comparison to world
Submitted by:
Muhammad Aurangzeb Khan
Submitted to:
Dr. Rehan Sadiq Shaikh
Institute of Biotechnology
Bahauddin Zakariya University
Multan

2. “Forensic science is the appliance of sciences to response questions of interest to a legal
system”
History of Forensic Science
Here is some brief history of forensic science:
In late 1700’s, Mathieu Orfila explained a case (Arsenic poisoning case) in France,
Due to this achievement Orfila is known to as the “father of forensic toxicology”. In
1893, Hans Gross done a great job for magistrates, Gross was famous for his book
publication, which was helpful for magistrates in criminal investigations. In 1890’s,
Alphonse Bertillon famous for his contribution in criminalistics, and introduced an
anthropometric system for human identification. In 1983, Sir Alec Jeffreys was a great
scientist contributes very much, because he introduced a method of identifying persons
from DNA, the method known as Restriction Fragment Length Polymorphism (RFLP)
and generally known as 'DNA Fingerprinting'. 1985, Police of United Kingdom 1st time
apply forensic DNA profiling in criminal study or case solving (http://www.cstl.nist.gov).
History of Forensic Science Laboratories
There are some laboratories at national and international level that are working day n
night to solve cases regarding forensics.
International level
In 1909, in Switzerland Professor R. A. Riess built up a forensic photography
laboratory and in 1910, Edmond Locard built up world’s first police crime laboratory in
France, in 1023, August Vollmer built up a forensic laboratory at Los Angeles Police
department, in 1929, Colonel Calvin Goddard built up Crime detection laboratory at
Chicago’s Northwestern University, that work mainly on bullet and cartridge
examinations, in 1932, J. Edgar Hoover developed the Federal Bureau of Investigation
(FBI) forensic laboratory, in 1934, New York City established NYC Police department
crime laboratory (www5.semo.edu).

3. National level
Main contribution in solving different forensic cases in Pakistan is from CEMB that
was developed in 1995. National Forensic Science Agency was developed in Islamabad
in 2005 that is also working in different aspects. Punjab Forensic Science Agency was
developed in 2007, and Agha khan University is also doing some work in forensics.
Methods of identification
Here is a brief history of methods used in past time for identification of peoples, but
among these the best and accurate identification method is by DNA fingerprinting that is
of mainly related to us.
Used Since? Identification Method Accuracy?
1800 Measurement of height 1 in 4
(Quételet’s method)
Pubic hair Comparison 1 in 800
From the end of 1800’s & startScalp hair Comparison 1 in 4500
of 1900’s
From the end of 1800’s & startAnthropometry 1 in 268 million
of 1900’s (Bertillon’s method)
Forensic odontology 1 in 2.5 billion
Teeth bite marks
Evidence in Early Egypt –Dactylography Not sure
documented forensic use(Fingerprints)
1800’s -1900’s
Late 1900’s DNA Fingerprinting 1 in 2 x 1022
Late 1900’s early 2000’s Facial recognition Not sure
(http://lifeloom.com/I2Aggrawal.htm)
(http://www.crimezzz.net/forensic_history/index.htm)
.

5. Techniques used in Forensic science
Main techniques used in forensic science in solving a case are given below
• Latent Print analysis, in this technique fingerprints, footprints and lip prints are
compared for identifying the connection of criminal to a crime.
• Toxicology, in this technique the dead body is examined to identify or find the toxic
chemicals or drugs that can cause the death of a person.
• Crime Scene Photography, in this technique the photography is done at crime scene
using different standard techniques, to capture/save the situation of a crime scene.
• Document analysis, in this technique the documents, papers or inks are examined
using different instrument if these are evidence for a crime.
• Blood Spatter analysis, in this technique we find the origin of blood source and/or
cause of bleeding. This is done by using physics of flight and trigonometry.
• Ballistics, is the study/comparison of firearms or guns, bullets and cartridges used in
crime and then to find out the source of bullet or type of gun used.
• Fiber analysis, is the study of fibers used in a crime, because every fiber has its
distinct color type etc. comparison analysis is done.
• Arson, the study of causes of chemicals or to find out the cause of a disaster e.g.
burning effect of fire.
• Explosives, is the study of bomb material or to find out the type of bomb materials,
and also to take the fingerprints of different parties that purchased such things.
• DNA, is the study of DNA, because every one has unique DNA that is different from
one another in different aspects.
• Computer, these all investigation is done by different experts and data is uploaded to
high speed computers that do the analysis and interpret the results.
• Some other techniques are also done like serology, anthrology, drug analysis etc.
From all these techniques the most important and related field to us is the DNA Analysis,
and will be discussed here.

6. First of all there is a schematic diagram that shows steps in DNA analysis or DNA
processing. There are three main studies that are Biology, technology and genetics.
B
I Collection of
O DNA Quantification
biological sample STR multiplex PCR
L isolation of DNA
source
O
G
Y
T
Analysis of STR results
E
(STR Alleles)
C
H
N
O
L
O Sample Genotyping
G
Y
G
E
N
E
T
I Comparison of sample If match occurs, comparison of Generation of Case
C results to other results DNA profile to population Report with Probability of
S databases Random Match
DNA processing techniques used in Forensics
The main techniques usually used in DNA analysis regarding forensic science are as
follow:
 RFLP (Restriction Fragment Length Polymorphism)
 Analysis by PCR
 Analysis through STR
 Analysis through Mitochondrial DNA
 Analysis through Y-Chromosome (http://www.promega.com)
Restriction Fragment Length Polymorphism (RFLP)
Principle of RFLP is to study/analyze variable length of DNA fragments generated by
specific restriction enzymes, every enzyme has its unique recognition site so occurrence

7. or lack of specific site generates variable length and number of DNA fragments, then that
will be separated by gel electrophoresis and hybridized to a DNA probe and then
analyzed on autoradiograph.
RFLP Analysis
Parentage Testing by RFLP
By comparing the RFLP results of child mother and expected fathers are analyzed
and find which alleged father’s genotype has the paternal alleles?
AF2
Locus Locu
Mother
1 2 Locus
1 s
1
2 2
Child
1
2

8. STR Polymorphisms (Short Tandem Repeat)
STRs are repeating series of nucleotides i.e. may be mononucleotide dinucleotide
trinuleotide tetra or pentanucleotide depend on the no. of nucleotide set which is
repeating. Usually in STR analysis trinucleotide repeating sequences are analyzed, also
one or two pentanucleotide for more specificity. The difference in alleles is due to
different no. of these repeats. For example trinucleotide, STR repeat as ---ATC--- causing
difference in alleles due to different number of STR.
---ATCCATCGATCTATC--- four repeat allele
--- ATCGATCCATCGATCTATC--- five repeat allele
The principle of STR PCR is that if we want to amplify this locus containing the
STRs, we have to construct the primer complimentary to flanking regions that may be
ATGCTAGTA or AAAAAAAATTTTTT to amplify the given allele.
ATGCTAGTATTTGGATAGATAGATAGATAGATAGATAGATAAAAAAATT
TTTTTT--
Discrimination power through multiplexing
Allele
possibilities
Hypothetical
likelihood of
occurrence
1 locus: 1 in 18 1 1 1 1
2 loci: 1 in 360 in X in X in in
3 loci: 1 in 18000 X
4 loci: 1 in 792000 18 20 50 44
9 loci: ~1 in 1010
Sample
16 loci: ~1 in 1017
Genotype
Current World Pop:
~6.3 billion

9. For example the paternity testing can be carried out on the bases of STR PCR, the
results of father, mother and all children.
Mitochondrial DNA Polymorphisms
mtDNA analysis is very useful in many problems (e.g. maternal identification, mass
disaster identifications, also useful when amount of Biological sample is very low or
sample collected from DNA degrading conditions) due to properties like high copy
number per cell, high constancy against degradation and maternal mode of inheritance, so
mitochondrial genome is suitable for medical as well as genetic investigation. The
polymorphism is based upon Sequence variations in the hypervariable regions (HV) of
the mitochondrial genome, the technique is that, amplify the hypervariable region of
every sample and then sequence it submit to the database and compared the results,
(http://empop.org).
HV 1
HV 2
(342 bp) (268 bp)
PH1
PH2
PL
Mitochondrial genome
16, 600 bp

10. Y chromosome STR testing
Y chromosome inherited from father to son (male to male) thus helpful in giving the
information of male relationships and also the information of male suspects in a crime
when all other tests failed. Y chromosome analysis is done by targeting the STRs of Y
chromosomes and then comparing the profiles.
Applications of Human identity testing
The main applications of human being distinctiveness testing are:
 Forensic investigations
 fatherhood confirming: recognize father
 Criminal’s DNA databases
 misplaced people inquiry
 crowd tragedy i.e. to find exact pieces of one person
 Historical search
General Types of databases used in forensic science
DNA Database
In forensics, DNA database is the most popular one, because of shows like CID CSI.
Profiles of expect one’s, pending trials, convicted offenders, unidentified remains,
arrested community and also the member of law enforcement are part of DNA database
profiles. DNA databases may include profiles of suspects awaiting trial, people arrested,
convicted offenders, unknown remains and even members of law enforcement. Through
this database identification process becomes very easier. For example, suspect's DNA
sample can be taken from captured one’s by the police. Or can be obtained from clothing
upon arrest. DNA can be obtained from any biological source then extracted,
characterized and kept in a database. In the upcoming days in case of any crime, the
crime scene sample is run and in this way comparison of the sample is carried out with
DNA database (http://www.ehow.com).

11. Bullet Database
This database mainly deals with bullets, covering or firearms used/found from the
crime scene. In this the comparison of bullets and firearm found from the suspect is
carried out and types of bullets or guns are recorded in the database and can give the
good results if firearms/gun of the suspect is found (http://www.ehow.com).
Paint Sample Database
This database deals with the paint samples. It records the new and old manufacturers
and also the sample found from the crime scene as proof. Analysis of paint samples gives
composition of sample and also the chemical composition and then data recorded in the
database and compared with the query. The results show the vehicle or anything used in a
crime scene and also the manufacturer of this paint that will narrow the search for
suspects (http://www.ehow.com).
Shoeprint Database
This database deals with the prints of soles of the shoes (shoeprints) manufacturing in
the bazaar. Data is recorded and then analyzed, database take out the shoeprints of the
victim and law enforcements and only identify the suspect shoeprint (by comparing class
of shoes, variety of shoes, size of the shoes and the shops that sale this brand of shoes)
and also estimate the height and weight of the suspect (http://www.ehow.com).
Tread Database
This database deals with the information about the tread pattern of the vehicles and
then identifying the vehicle that is used by the suspect by comparing the vehicle forms.
The study is useful in cases like hit by vehicle and ran away also in road accidents and
shooting during driving (http://www.ehow.com).

12. Forensic Authorities in the World that have developed Systems on above
mentioned databases
 IAFIS (Integrated Automated Fingerprint Identification System), the database
monitored by FBI based on fingerprints of criminals.
 CODIS (Combined DNA Index System) also maintained by FBI work on federal ,
local and state level and match DNA profiles online.
 NIBIN (National Integrated Ballistics Information Network) contains the data
regarding ballistics, firearms etc. and comparison of guns cartridges.
 PDQ (Automotive Paint Data Query) database deals with information regarding
paints and their chemical composition & color.
 SICAR (shoeprint image capture and retrieval) deals with comparison of shoeprints.
Some Databases based on DNA profiling are explained here.
CODIS (Combined DNA Index System)
CODIS, the database developed by the FBI in 1997 based on DNA profiling by STR
analysis and 13 loci that are nationally and internationally known standards for human
identification which are analyzed are given below and also the position of these in the
picture.
CSF1PO
FGA TH01
TPOX VWA
D3S1358 D5S818
D7S820 D8S1179
D13S317 D16S539
D18S51 D21S11

13. CODIS Indexes
There are two indexes of CODIS missing person index and reference index
 The missing person’s index contains the data of unknown persons; the profiles
are made by the DNA obtained from teeth, hair or bones.
 The reference index contains DNA profiles from relatives of the missing persons
that will be run time to time with unknown person’s index. All the samples are
analyzed by mtDNA & STR PCR analysis.
Two other indexes are:
 The convicted lawbreaker index DNA reports of individuals convicted of
positive sin e.g. physical attack or murder.
 The forensic index contains DNA profiles from crime scene proof i.e. saliva,
semen or blood.
Then all the data is analyzed on computers that will search and find match between
these indexes
THE NATIONAL DNA DATABASE (NDNAD)
This database was the first, one held in 1995 in United Kingdom & Wales, and
Scotland &Northern Ireland developed there individual DNA database and put forward
their data to the National DNA database. Currently NDNAD using SGM+ technique for
DNA profiling, in this 10 STR loci are analyzed and profiles are made, but previously
SGM technique was used by NDNAD which make profile on the bases of only 6 STR
loci.
.
Relative size of CODIS & NDNAD
In 2007, it was noted that CODIS contains 4,582,516 profiles while NDNAD contains
3,976,090 profiles making CODIS the largest database.
The EMPOP database
EMPOP database built up by Institute of Legal Medicine (GMI), Innsbruck Medical
University and Institute of Mathematics, (UoI) the database which helps in solving
forensic cases on the basis of mt DNA analysis, database for collection, quality control

14. and searchable presentation of mtDNA control region haplotypes from all over the world
(http://empop.org).
STATUS IN PAKISTAN
In Pakistan there are many institute and agencies working on forensics and that are as
follows.
Punjab Forensic Science Agency (PFSA) Lahore, developed in 2005 and is working
and providing many services (http://www.pfsa.gop.pk) i.e.
• Toxicology
• Narcotics
• DNA & Serology
• Firearms-Tool Marks
• Questioned document
• Latent finger prints
• Pathology
• Forensic photography
• Trace chemistry
• Crime scene specialist
• Death Scene Investigators
• Computer forensics
• Polygraph
• Audiovisual
National Forensic Science Agency (NFSA) has also established in Islamabad since
2007 and the Forensic disciplines this agency is dealing (http://nfsa.gov.pk) are as
follows:
• Biology
• Chemistry
• Ballistics/explosives
• Scientific investigation
• Crime scene investigation
Resources of NFSA

15. • Ministry of Interior
• Federal Investigation Agency
• The National Response Centre For Cyber Crime
• National Database And Registration Authority
• Islamabad Capital Territory Police
• Punjab Police
• Sindh Police
• Balochistan Police
• Forensic Science Service, UK
Forensic DNA laboratory at CEMB, Punjab University, Lahore
The main contribution of forensic science in Pakistan is of “Centre of Excellence for
Molecular Biology (CEMB)”, because most of cases are solved and processed by this
centre, recently the case of bomb suicider in Karachi will be processed by this centre.
The first case of Sultan Rahi in 1995 is also processed by CEMB but official DNA typing
reports were not submitted to Police officials (http://cemb.edu.pk).
Agha Khan University Karachi is also working on forensic typing in Pakistan.
Conclusion
In forensic studies DNA based analysis are very useful due to their high accuracy,
also helpful in criminal investigation and paternity assessment. But nothing is perfect,
DNA based analysis are very laborious and costly that is limiting its use. The databases
built up by different authorities of different countries are very helpful but some ethical
issues like privacy concern are also raised.
Future Development
Some up-gradation is required for its better use i.e. less costly and simple and fast
procedures and falling errors. For example in future the DNA sample of a suspect will be
taken and run against National DNA database/CODIS and the results will be shown in
minutes.

16. References
http://cemb.edu.pk
http://en.wikipedia.org/wiki/Forensic_science
http://lifeloom.com/I2Aggrawal.htm
http://nfsa.gov.pk
http://nfsa.gov.pk
http://www.crimezzz.net/forensic_history/index.htm
http://www.cstl.nist.gov/biotech/strbase/intro.htm
http://www.ehow.com
http://www.pfsa.gop.pk
http://www.promega.com
http://www5.semo.edu
http://empop.org