Comparative Genomic Identification and Characterisation of A Novel B-Defensin Gene Cluster in the Equine Genome

Comparative Genomic Identification and Characterisation of a Novel
β-Defensin Gene Cluster in the Equine Genome
Name: Gillian Johnson
I.D. Number: 10100377
Supervisor: Dr. Sean Fair
Degree: Bsc. Equine Science
Option: Equitation
Submitted to the University of Limerick
April 2014

Overview
I
Overview
Overview
Declaration
Acknowledgements
Abstract
Table of Contents
List of Figures
List of Tables
List of Abbreviations
Page
I
II
III
IV
V
VI
VII
Chapter I
Chapter II
Chapter III
Chapter IV
Chapter V
Chapter VI
Literature Review
Materials and Methods
Results
Discussion
Conclusion
Bibliography
1
30
37
50
57
59

Declaration
II
Declaration
I hereby declare that this is entirely my own work, and has not been submitted to any other
university or higher education institution, or for any academic award in this university. Where
use has been made of the work of other people, it has been fully acknowledged and
referenced.
Signed:
Date:

Abstract
III
Acknowledgements
Firstly the author would like to thank Dr. Sean Fair, for all of the guidance, help and
encouragement over the last four years.
The author also acknowledges the contribution of Dr. Kieran Meade, Animal & Grassland
Research and Innovation Centre, Teagasc, Grange, Dunsany, Co Meath, Prof. Cliona
O’Farrelly, Comparative Immunology Group, School of Biochemistry and Immunology,
Trinity College Dublin, Dublin, and Dr. Andrew Lloyd, Department of Science & Health,
Carlow Institute of Technology, Kilkenny Road, Co. Carlow, in addition to Mr Pat Duffy,
Lyons Research Farm, University College Dublin, Newcastle, Co. Dublin, and Mr Philip
McManus, Rockmount Veterinary Clinic, Claregalway, Co. Gawlay for the sample provision
and collection.
Acknowledgements

Abstract
IV
Abstract
The thoroughbred horse industry is worth €1.1 billion annually to the Irish economy, with the
breeding industry making up a significant proportion (approx €216 million) of this activity.
Given that mares have an 11 month pregnancy, the window to get mares back in foal is small,
so-as to achieve the target of a foal every year. One of the major difficulties with getting
mares pregnant is an inflammatory condition, with subsequent fluid accumulation in the
uterus, known as persistent post breeding endometritis. This project focuses on a relatively
small, cationic group of proteins called β-defensins. β-defensins are proteins with potent
immunoregulatory and antimicrobial activity which are produced constitutively and inducibly
by eukaryotic cells, including epithelial and immune cells. Traditionally regarded as vital
effector molecules of the innate immune system, recent studies are shedding light on
reproductive roles for these molecules, where they have been shown to coat sperm and
facilitate the passage of sperm through the mucus secretions of the female reproductive tract,
as well as mediating the binding of sperm with the epithelial lining of the female reproductive
tract. This study profiles a cluster of 13 novel β-defensins genes along chromosome 22 of the
Equus caballus genome. Using quantitative Real-Time PCR, the cluster of 13 genes were
shown to be expressed across the reproductive tract of both stallions (n=3) and mares (n=3) in
a region specific manner. Samples were taken from the testis, caput, corpus, and caudal
epididymis, as well as the vas deferens in the stallion, and from the ovary, oviduct, uterine
horn, uterus, cervix and vagina in the mare. This is the first study to identify and characterise
this cluster of β-defensin genes in the horse and their preferential regional expression in the
caput epididymis in the stallion and the oviduct in the mare suggests a possible role in equine
fertility.

Table of Contents
V
Table of Contents
Page
Overview I
Declaration II
Acknowledgments III
Abstract IV
Chapter I Literature Review Page
1.0 Introduction 1
1.1 Literature Review 4
1.2 Irish Equine Breeding Industry 4
1.3 Mare Fertility 6
1.4 Stallion Fertility 7
1.5 Spermatogenesis 8
1.6 Sperm Maturation in the Epididymis 10
1.7
1.7.1
1.7.2
1.7.3
Sperm Transport in the Reproductive tract of the Mare
Capacitation
Hyperactivation
Acrosome Reaction
14
14
15
16
1.8
1.8.1
1.8.2
Defensins
Defensins in the Horse
Role of Defensins in Reproduction
19
21
25
1.9 Objectives 28
Chapter II Materials and Methods Page
2.0 Materials and Methods 30
2.1 Bioinformatic Identification of Equine Amp Orthologs 30
2.2 Reproductive Tissue Collection 30
2.3 RNA Extraction and cDNA Synthesis 31
2.4 Primer Design 34
2.5 qRT-PCR 34

Table of Contents
VI
2.6 Statistics 34
Chapter III Results Page
3.0 Results 37
3.1 Discovery of Novel β-Defensins in the Equine Genome 37
3.2 Advanced Bioinformatic Analysis 38
3.3 Expression of Novel Defensins Across Equine
Reproductive Tissues 42
Chapter IV Discussion Page
4.0 Discussion 51
Chapter V Conclusions Page
5.0 Conclusions 57
Chapter VI Bibliography Page
6.0 References 59

List of Figures
VII
List of Figures
List of Figures Page
Figure 1 Cross section of testicle, and further cross section of a
seminiferous tubule. 9
Figure 2 Schematic presentation of a stallion spermatozoon. 13
Figure 3 Sequence of interactions between male and female gamete
required for fertilization. 17
Figure 4 Schematic representation of a sperm’s equatorial region binding
laterally with the oolemma. 18
Figure 5 A phylogenetic tree showing the separation of the different
species in the Laurasiatheria clade. 22
Figure 6 Expression of equine antimicrobial peptides in different tissues
of the horse. 24
Figure 7 The location of sample collection in the reproductive tract of the
mare (Panel A) and the stallion (Panel B). 31
Figure 8 Amino acid sequences of 13 equine β-defensins, showing the
conserved six cysteine residues (indicated with arrows). 39
Figure 9 Multiple sequence alignment of both bovine and equine β-
defensins which had the largest intron, showing the conserved
characteristic six cysteine residues (brown), in addition to
glycine (orange), and glutamic acid (red). 40
Figure 10 Graph showing predicted N-glycosylation site for equine β-
defensin 129. Significant support shown by line above threshold
(red line). 41

List of Figures
VIII
Figure 11 Phylogenetic tree showing the relatedness between the thirteen
novel β-defensins in the equine and bovine genomes. 43
Figure 12 Variation in expression of selected equine β-defensin genes
across the male reproductive tract of 3 stallions. Expression was
normalised to the average of eGAPDH and ACTβ gene
expression, represented by 0 on the graph for equine β-defensins
115, 119, 122a and 124. 43
across the female reproductive tract of 3 stallions. Expression
was normalised to the average of eGAPDH and ACTβ gene
115, 119, 122a and 124. 44
across the male reproductive tract of 3 stallions. Expression was
normalised to the average of eGAPDH and ACTβ gene
117, 120, 116 and 126. 46
across the female reproductive tract of 3 stallions. Expression
was normalised to the average of eGAPDH and ACTβ gene
117, 120, 116 and 126. 47
Figure 16 Analysis of the tissue expression profiles of 13 novel equine β-

List of Figures
IX
defensins, reference gene eNAP 2, DEFL 2 & 3, and
housekeeping genes ACTβ and GAPDH across the stallion and
mare reproductive tracts, using gel electrophoresis following
qRT-PCR. 48

List of Tables
X
List of Tables
List of Tables Page
Table 1 Sequences for the designed primers of the reference genes
eGAPDH, ACTβ, DEFL 2 & 3 and eNAP 2, and the 13 novel
equine β-defensin genes.
33
Table 2
Summary of the β-defensin genes found, and their location in
the equine genome (UCSC version equCab2) using a
combination of BLAST, and BLAT search tools. 38

XI
List of Abbreviations Meaning
α Alpha
β Beta
θ Theta
µg Microgram
µL Microlitre
ACTβ Beta-actin
AMP Antimicrobial peptide
ATP Adenosine triphosphate
bBD Bovine Beta defensin
Bin1b Beta defensin 1 like protein
BLAST Basic local alignment search tool
BLAT BLAST like alignment tool
Ca2+
Calcium
cAMP Cyclic adenosine monophosphate
cDNA Complementary DNA
CEM Contagious equine metritis
CPD Cyclic adenosine monophosphate
phosphodiesterase
DEFB Beta defensin
DEFL Defensin like protein
DNA Deoxyribonucleic acid
eBD Equine Beta defensin
eNAP 2 Equine neutrophils antimicrobial peptide 2
GAPDH Glyceraldehyde 3-phosphate dehydrogenase
GPI Glycosyl phosphatidyl inositol
HD-5 Human intestinal defensin-5
HDP Host defence peptides
HMM Hidden Markov model

XII
ID Irish Draught
IL-8 Interleukin 8
ISH Irish Sport Horse
IVF In vitro fertilisation
kb Kilo base
kDa Kilo Dalton
mL Millilitre
OEC Oviductal epithelial cells
pH Power of Hydrogen
PPBEM Persistent post breeding endometritis
PMIE Post mating induced endometritis
RNA Ribonucleic acid

Introduction
1
1.0 Introduction
Mammalian defensins can be segregated into three subfamilies; α-, β-, and θ-defensins. The
classification of each subfamily is not only determined according to amino acid sequence and
length, but also their specific intermolecular disulfide-bond pattern and cysteine positioning
(Bruhn et al., 2009b, Davis et al., 2004). α -defensins are characterised by having disulfide
bonds between cysteines 1-6, 2-4, and 3-5, while, this is in contrast to β-defensins which are
comprised of disulfide linkages between cysteine residues 1-5, 2-4, and 3-6 (Ganz, 2003,
Davis et al., 2004). The three disulfide bonds positioned in an orderly manner creates the
defensin motif, which is conserved across peptides and species (Semple et al., 2003).
Whereas θ-defensins only occur in primates, α-defensins which are present from very early in
mammalian evolution and subsequently lost in most artiodactyls, although are retained in the
horse. Similarly, β-defensin genes have been found in most vertebrate genomes, and encode
small, cationic proteins produced by various cell types, including epithelial and immune cells,
such as leukocytes in mammals (Schneider et al., 2005). Given their antimicrobial activity
(Schöniger et al., 2013, Choi et al., 2012, Narciandi et al., 2011), β-defensins are traditionally
regarded as vital effector molecules of the innate immune system (Ganz, 2004, Davis et al.,
2004, Ganz, 2003). However, recent studies in other species have shown localisation of
expression to reproductive tissues in mice, rats and cattle. This has led to speculation about a
potential role in the protection of the reproductive tract against pathogens, or in the regulation
of fertility (Tollner et al., 2009, Tollner et al., 2011b, Yudin et al., 2003). Research has
recently revealed a cluster of 19 novel β-defensin genes in the bovine genome, and these
genes were found to be expressed in a region specific manner, across the male and female
reproductive tract (Narciandi et al., 2011). Evidence for β-defensin mediated regulation of
fertility, has been supported by recent findings in humans, where DEFB126 has been
demonstrated to coat the entire surface of sperm until the sperm become capacitated (Tollner
et al., 2009), and the removal of DEFB126 from the sperm head is required for sperm-zona
recognition (Liu et al., 2013). β-defensin 126 has been shown to facilitate ejaculated macaque
sperm to swim through cervical mucus in vitro (Tollner et al., 2008b), while playing an
important role in capacitation (Tollner et al., 2009), binding to oviductal epithelial cells as
well as zona pellucida recognition, and binding (Liu et al., 2013). β-defensins have been

Introduction
2
shown to assist in sperm maturation in rats (Zhou et al., 2004), and provide immunoprotection
to sperm as they migrate along the reproductive tract in other species, such as the pig (Taylor
et al., 2008), and macaque (Yudin et al., 2005a). In mice, β-defensin 22 forms a major part of
the sperm glycocalyx (Yudin et al., 2008). Polymorphisms in hBD126 are also known to
contribute to sub-fertility in males (Tollner et al., 2011a). Furthermore, a recent study has
shown that β-defensin gene knock-out male mice are completely infertile (Zhao et al., 2011).
Since the publication of the equine genome in 2007, 38 α-defensins have been identified in
the equine gastrointestinal tract (Bruhn et al., 2009b, Bruhn et al., 2009a), twenty of which
have the potential to code for functional proteins (Bruhn et al., 2009b). The retention of
protein coding α-defensins genes identifies the horse genome as distinct from other members
of the artiodactyl species, for which genomes are available. The equine genome encodes a
high number of functional α-defensins (Bruhn et al., 2007, Bruhn et al., 2009b) which are not
present in other members of this order studied to date (Fjell et al., 2008). Only two β-defensin
genes have been comprehensively characterised in the horse, β-defensin-1 and β-defensin 103
(Bruhn et al., 2009a, Bruhn et al., 2011, Bruhn et al., 2009b). β-defensin-1 was reported to be
expressed in multiple tissues, including the small intestine, liver, heart and uterus (Schöniger
et al., 2013), while β-defensin 103 was reported to be exclusively expressed in the tongue of
the horse, as in humans (Bruhn et al., 2011).
The single biggest obstacle to getting mares pregnant is a condition called persistent post
breeding induced endometritis (PPBEM; persistent fluid accumulation within the uterus),
which affects approximately 15% of thoroughbred mares, following natural mating
(Maischberger et al., 2008). While every mare has a transient inflammatory response in their
uterus in response to sperm (and bacteria) post mating, this resolves naturally within 24 to 48
hours so that the uterine environment is ready to support the embryo, when it descends from
the oviducts into the uterus five to six days after ovulation (LeBlanc, 2010). However, mares
which are susceptible to PPBEM have impaired uterine defence and clearance mechanisms,
and if the endometritis persists for more than 72 h post mating, early embryonic death rates
are three times higher than normal. In addition, there is evidence which suggests that some
stallions induce PPBEM more than others (Maischberger et al., 2008).

Introduction
3
The aim of this study was to use a comparative genomics approach to characterise a novel
cluster of β-defensin genes in the equine genome, and to quantify the expression of these
genes, in site specific manner, across the reproductive tracts of the mare and stallion.

Literature Review
4
1.1 Literature Review
1.2 Irish Equine Breeding Industry
The Irish Equine Industry is segregated into two main subgroups, Sport Horses and
Thoroughbreds.
Sport Horse breeding is a vast and expanding industry in Ireland, with approximately 124,000
horses in the national horse herd. This is comprised of a mare herd of roughly 20,000, which
produces approximately 9,324 foals annually (Fahey, 2012). These breeding animals provide
a valuable, and unique genetic resource. Sport horses mainly include the Irish Sport Horse
(ISH), Irish Draught Horse (ID), and the Connemara Pony, or any other horse not used in the
racing industry. Ireland is the most equine densely populated country in the EU, with 35
horses for every 1,000 people (Hennessy, 2008). This has resulted in over 47,096 people
being involved with sport horses, contributing to the household income of 29,295 people,
while there are 12,512 full-time job equivalents in the Irish Sport Horse industry, of which
11,417 are directly employed. The Irish Sport Horse contributes in excess of €708 million
annually to the Irish economy (Fahey, 2012).
There are 15,110 active Irish Sport Horse breeders in Ireland, which accounts for a total
expenditure of €226 million, within the economy. The majority of sport horse breeders in
Ireland operate on a small scale, with 73% of ISH breeders, and 82% of ID breeders
registering only 1 foal per year (Fahey, 2012). Of mare owners, 23% have only one mare,
while 80% of stallion owners have less than three stallions. Figures also show that the
majority of Irish Sport Horse breeders are older than fifty years of age, with only 8.1% of
breeders being younger than thirty years of age (Fahey, 2012). While breeders are breeding on
a small scale, 69% of them breed for more than one discipline, with the majority of horses
being bred in Ireland intended for show jumping, at 31%. Moreover, event horse breeding
makes up 26% (Fahey, 2012).
While Ireland has a high number of Sport Horses, very few ever make it to international level.
Most horses end up in the leisure and amateur industry, or for use in hunting. Hunting is the
largest equestrian activity in Ireland, with in excess of 150, 000 caps per year (Harty, 2011).

Literature Review
5
Ireland has long been one of the top producers of horses in the world. The world ranking list
by studbook reviled that, the Irish Sport Horse was number one in the global event horse
rankings up until 2010, and currently ranks eleventh on the global show jumping circuit.
Horse Sport Ireland maintains the ISH and ID studbooks, and implemented new breeding
policies in 2010. The principles of these new breeding policies are; that there is an open
transparent system, with a public stallion classification process, that the maximum amount of
information is relayed to the breeders, that direction will be given regarding which stallions
are approved, and that stallions and mares are given approval based on their own
performance, and on their progeny (Harty, 2011). The goal of the ISH studbook is to produce
a performance horse, that is sound, athletic with good paces, and has a suitable temperament
to be competitive at the highest international level in the International Federation for
Equestrian Sports (FEI), while the ID studbook holds an emphasis on breeding horses with
good conformation, movement, and temperament, which conform to the breed standard, and
will make good quality, sound and versatile horses.
Ireland is one of the largest producers of Thoroughbred foals in the world, coming third to
America and Australia. Remarkably, Ireland produces 42% of all thoroughbred foals in
Europe, making it a global market leader in this field. This is an extraordinary statistic for a
country with only 0.56% of the EU population. Irish foal’s superior quality is recognised
worldwide, and is a direct result of the fact that the majority of the industry’s top stallions
stand in Ireland. For each of the last eighteen years, the champion sire in Europe has been
standing in Ireland (Dukes, 2009). The Thoroughbred industry contributes a staggering €1.1
billion to the national economy (Dukes, 2009), and employs over 17,000 people. The export
of 6,222 Irish thoroughbreds to the value of €216 million, were exported to 42 countries in
2009 alone.
There is relatively the same number of Thoroughbred breeders as there are Irish Sport
Breeders in Ireland. Currently there are 10,106 registered Thoroughbred breeders, 93% of
whom own less than 5 mares (Dukes, 2009). The majority of breeders (8,218) have as little as
one or two broodmares. In 2008, the Irish Thoroughbred herd consisted of 416 stallions, and
20,038 mares, producing 12,419 foals.
A thoroughbred horse is a horse that has been registered in the Thoroughbred Horse Stud
Book, and must follow strict criteria in order to be registered. The animal’s dam and sire must

Literature Review
6
both be registered thoroughbred horses, the horse must be blood-typed, with its markings
recorded, and must be implanted with a microchip for further identification (Younge, 2011).
Every thoroughbred must also possess a passport. Registration and the management of the
thoroughbred studbook is the responsibility of Weatherbys Ireland.
1.3 Mare Fertility
Despite the huge involvement, and level of expertise the Irish breeding industry possesses, in
2011 alone only 65% of mares produced a live foal (Weatherbys, 2011). This was
predominately due to physiological reproductive problems, as opposed to environmental, or
management factors.
Endometritis is the failure of the uterus to clear foreign contaminants, resulting in
inflammation of the lining of the uterus, the endometrium, causing subfertility or infertility in
the mare (Drost et al., 2009). Endometritis is primarily caused by bacterial infections from
pathogens such as; Streptococcus zooepidemicus, Escherichia coli, Pseudomonas aeruginosa,
Klebsiella pneumonia, and less commonly, may be caused by Taylorella equigenitalis, the
pathogen which causes contagious equine metritis (CEM; (Drost et al., 2009). Other causative
agents include; yeast and fungi, such as Candida spp. and Aspergillus spp. The mare’s
reproductive tract is usually protected from external contamination by the vulva, vestibule,
vagina, and cervix, which function collectively as a physical barrier against foreign
contaminants, however, injury, anatomical abnormalities, or loss of structural function post-
foaling, can permit the entry of pathogenic microorganisms, resulting in endometritis
(Maischberger et al., 2008). The mare’s innate immune system also functions to protect
against non-specific pathogen invasion. In cases where endometritis persists, a chronic
endometritis can develop, with the addition of endometrial fibrosis, known as endometriosis.
This condition is more commonly seen in older, multiparus mares (Drost et al., 2009).
Semen can also induce inflammation of the endometrium. In nearly all cases, mares develop a
transient post-breeding endometritis, regardless of breeding technique. However, a persistent
mating induced endometritis (PMIE) can develop in mares, inhibiting sperm transport,
resulting in a high incidence of fertilisation failure, and reproductive wastage (Drost et al.,
2009). As high as 15% of thoroughbred broodmares develop PMIE, generating significant
reproductive and economic loss (LeBlanc, 2010).

Literature Review
7
The main sign of endometritis in the mare is reduced fertility, with affected mares returning to
oestrus early after breeding to a fertile stallion, or they exhibit a shortened interestrous
interval (Drost et al., 2009). Endometritis is assigned a grade ranging from Grade 1 to Grade 3
following endometrial biopsy examination. Foaling rates are predicated to be 80-90% in
mares with Grade 1, 50-80% with Grade 2A, 10-50% with Grade 2B, and less than 10% in
mares with Grade 3 (Drost et al., 2009).
1.4 Stallion Fertility
Stallion fertility is an economically significant trait, with a complex environmental and
genetic background. Subfertility in the stallion is also a large cause of reproductive wastage to
the equine breeding industry. Stallion subfertility may be caused by a variety of factors, which
can often be difficult to pinpoint, some of the most common causes include; low numbers of
normal sperm, testicular degeneration, genital tract trauma, inadequate stallion and/or mare
management, poor overall health and endotoxemia (Meyers, 1996).
Some factors of stallion subfertility are more difficult to control than others, for example the
variance in individual fertility, stallion’s age, time of the year, semen quality, the quality of
the mares being bred, including their age and breeding status, i.e. maiden, foaling, or barren,
and whether the mare is being bred on her foal heat. However, other factors that can be
managed to some extent include; the amount of mares the stallion covers in a season, and the
amount serviced daily, the interval from breeding to ovulation, and the choice whether or not
to use reinforcement breeding (Blanchard, 2010).
Sterile or subfertile stallions with no history of trauma, infectious disease or managerial
problems, are often considered to have genetic inadequacies (Edwards, 2008). These may be
associated with semen abnormalities or, in atypical cases, chromosomal abnormalities. In
some very rare cases hermaphrodites have been reported, however this is often seen to have
obvious abnormalities of the animal’s genitalia. Animals suffering from unfavourable
heritable conditions should ideally not be bred from, as they may spread abnormalities among
the equine population. Cryptorchidism is a heritable condition and may be associated with
degrees of testicular hypoplasia in stallions (Edwards, 2008).

Literature Review
8
1.5 Spermatogenesis
Spermatogenesis is the development of spermatids in the testis from spermatogonia, which
are derived from primordial germs cells (Giesecke et al., 2010). It describes the complete
series of events which occur within the seminiferous tubules of the testis, producing millions
of spermatozoa per day, subsequently resulting in each spermatozoon containing a haploid
complement of chromosomes. In the stallion, meiosis and spermatogenesis do not begin in the
testes until puberty, where it then goes on continuously throughout the stallion’s life in the
epithelial lining of the seminiferous tubules (Maischberger et al., 2008). A testicle contains
about 250 testicular lobules; inside of which are 1 to 3 tightly coiled seminiferous tubules.
Embedded among the spermatogenic cells in the seminiferous tubules, are large Sertoli cells,
which extend from the basement membrane to the lumen of the tubule (Tortora and
Derrickson, 2010). Internal to the basement membrane and spermatogonia, tight junctions join
Sertoli cells to one another, it is these junctions that form the blood-testis barrier, as
substances must first pass through the Sertoli cells before they reach developing sperm
(Tortora and Derrickson, 2010). Leydig, or interstitial cells which secrete testosterone, are in
the spaces between adjacent seminiferous tubules, also present are somatic cells, including
peritubular myoid (primordial) and germ cells (Johnson et al., 1997).

Literature Review
9
Figure 1: Cross section of a testicle and a further cross section of a seminiferous tubule, showing the site of
spermatogenesis and the accessory cells involved. The initial primordial germ cell starts life in the outer edge of
the seminiferous tubule, and migrates towards the centre (the lumen) as it matures. Mature sperm are found in
the lumen of the tubule (Krawetz, 2005).
Spermatogonia are immature germ cells, which are located around the outer edge of the
seminiferous tubules; here they proliferate continuously by mitosis (Maischberger et al.,
2008). Mitosis produces daughter cells, some of which stop proliferating and differentiate into
primary spermatocytes, and go on to enter the first meiotic prophase. During the first meiotic

Literature Review
10
prophase, the paired homologous chromosomes partake in crossing-over, subsequent to which
division one of meiosis takes place, in order to produce two secondary spermatocytes
(Johnson et al., 2008). Each of the secondary spermatocytes contains 31 pairs of autosomal
chromosomes, and either a duplicate X, or a duplicated Y chromosome. Four spermatids are
formed when two secondary spermatocytes complete meiotic division II; each of the
spermatids contains a haploid number of chromosomes. The spermatids then undergo
morphological differentiation into sperm, which in turn escape into the lumen of the
seminiferous tubule (Johnson et al., 1997, Johnson et al., 2008). All stages of spermatogenesis
take place in between the Sertoli cells, which extend from the base, to the lumen of the
seminiferous tubules, and are analogous of the follicle cells of the ovary (Johnson et al.,
1997). Leydig cells are fundamental to spermatogenesis, in that they secrete testosterone upon
which spermatogenesis depends. The time for a spermatocyte to complete meiosis, and
become a spermatid is roughly 24 days in the stallion; however it takes another 35 days for
the spermatid to fully develop into a sperm. Transit time through the epididymis is
approximately 7 days (Johnson et al., 2008).
During spermatogenesis, the sperm plasma membrane, and other structures, are tailored for
their roles during transport through the female reproductive tract, and interaction with the egg
(Gadella et al., 2001). Components of the plasma membrane cannot be newly synthesized,
due to the concurrent loss of the majority of the cells organelles, and the cessation of DNA-
transcription, thus spermatozoa are unable to produce proteins or maintain vascular transport.
1.6 Sperm Maturation in the Epididymis
Furthermore, sperm leaving the testis, that are entering the epididymis, are not fully matured,
and it is during the transit through the epididymis, that the plasma membrane is altered
significantly by the release, modification, and absorption of proteins and lipids (Gadella et al.,
2001). These gradual modifications occur in response to variations in luminal fluid
composition (Gatti et al., 2005). Sperm maturation occurs in the caput and corpus epididymis,
while mature sperm, is stored in the caudal epididymis, in a quiescent state, until ejaculation
(Gupta, 2005). During this maturation, spermatozoa lose their cytoplasmic droplet, and
undergo remodelling of the sperm surface, chromatin condensation is induced, motility

Literature Review
11
acquired, and the potential for capacitation in the female genital tract gained. The remodelling
of the sperm surface may be as a result of the incorporation of protein, lipid, and sugar
determinants (Gupta, 2005).
One of the more striking changes that takes place is the transfer of extremely hydrophilic
proteins, present in the epididymal fluid, and of proteins that ordinarily have glycosyl
phosphatidyl inositol (GPI) tails, to the sperm membranes (Gatti et al., 2005). Proteins such as
these are not free in fluid, and are normally located in a membrane environment, therefore it is
believed that transport vesicles (epididymosomes) or lipid micelles, might exist in the
epididymis (Gatti et al., 2005). Evidence has been found that such vesicles exist in the caudal
epididymal fluid of rams, and are believed to be derived from the accessory glands, such as
the prostate gland, or seminal vesicles.
The acrosome experiences morphological changes, where several intra-acrosomal proteins
exhibit structural change in morphology, exhibit alterations in their molecular form, and
antigenicity, during the spermatozoa’s time in the epididymis. DNA stability is another
characteristic of sperm maturation in the epididymis. It has been found that mature sperm,
from the caudal epididymis, have the ability to incorporate foreign DNA in a buffer
containing only salts and calcium, whereas immature sperm were unsuccessful in DNA
binding (Gupta, 2005). Ram, bovine, boar, and goat spermatozoa have all been found to have
increased cyclic AMP (cAMP) levels during transit through the epididymis. The level of
cAMP is mediated by the relative rates of cAMP synthesis and degradation, more specifically
by the activities of adenylate cyclase, and its cyclic AMP phosphodiesterase (CPD). CPD is
also thought to play an important role in epididymal sperm maturation (Gupta, 2005). Motility
is initiated in the epididymis, and is believed to be regulated by intrasperm pH. Intrasperm
pH was shown to increase by 0.4 unit form the caput, to the cauda epididymis in the goat
(Gupta, 2005).
Epididymal fluid originates from rete testis fluid entering from the efferent ducts in the
proximal section of the epididymis, which goes on to take part in epididymal secretion and
absorption, proteolytic activity of pre-existing proteins in the fluid, and finally metabolic
activity of spermatozoa (Fouchecourt et al., 2000). Epididymal fluid is composed of a high
concentration of organic compounds, with low molecular weights. Passive migration of
spermatozoa through the epididymis, may allow for the acquisition of the low molecular

Literature Review
12
weight, water-soluble compounds, by a process of iso-volumetric regulation (Cooper, 2007).
A result of this is an increased fertilisation rate in inseminated spermatozoa recovered from
the distal epididymis, suggesting that these spermatozoa are able to regulate their volume, and
reach an oocyte, as a consequence of the uptake of epididymal osmolytes.
The extremely dynamic structure of the sperm plasma membrane plays a critical role in
regulating sperm-egg interaction. The mature sperm has highly specialised regions, the head
containing the DNA, which is vital for sperm-oocyte interaction, the midpiece, which
contains the mitochondria, necessary for energy production, and the flagellum, which is
involved in sperm motility. The head piece contains little more than the nucleus, a small
amount of cytoplasm, and its apical extreme, the acrosome (Figure 2). Typical sperm are
"stripped-down" cells, equipped with a strong flagellum to propel them through an aqueous
medium but unencumbered by cytoplasmic organelles such as ribosomes, endoplasmic
reticulum, or Golgi apparatus, which are unnecessary for the task of delivering the DNA to
the egg. The mitochondria are strategically placed in such a way, where they can most
efficiently power the flagellum.

Literature Review
13
Figure 2: Schematic presentation of a stallion spermatozoon. Panel A: a sectional view of the spermatozoon.
Panel B: plasma membrane subdomains of the sperm head. Panel C: the acrosome reaction. Solid lines represent
membrane bilayers: (1) plasma membrane; (2) outer-acrosomal membrane; (3) acrosome fluid; (4) inner-
acrosomal membrane; (5) nuclear envelope; (6) nucleus; (7) nuclear ring; (8) mitochondria; (9) proximal part of
the flagellum (mid-piece); (10) annular ring; (11) distal part of the flagellum (principal and end pieces); (12)
fibrous sheath; (13) apical subdomain; (14) pre-equatorial subdomain; (15) equatorial subdomain; (16) post-
equatorial subdomain; (17) mixed vesicles formed during the acrosome reaction via fusions of the plasma
membrane with the outer acrosomal membrane (Gadella et al., 2001).

Literature Review
14
1.7 Sperm Transport in the Reproductive Tract of the Mare
1.7.1 Capacitation
For sexual reproduction to be successful, the sperm and oocyte must fuse to form a diploid
zygote (Gadella et al., 2001). In the horse, as with other mammals, this is preceded by
multiple complex changes in the plasma membrane of the sperm, known as capacitation, a
critical step, upon which successful fusion depends. Stallion sperm is deposited in the uterus
of the mare; it is here where sperm is activated by capacitation factors, initiating a precise
reorientation and modification of the molecules within the plasma membrane (Gadella et al.,
2001). It is only after these changes, that the sperm is able to bind to the extracellular matrix
of the oocyte (zona pellucida). Sperm is subsequently primed by the zona to initiate the
acrosome reaction, an exocytotic event essential for sperm to penetrate the zona pellucida.
The ability of sperm to undergo capacitation is a crucial factor in sperm’s fertilising ability.
Capacitation, and the viability status of sperm, can be detected simultaneously with the use of
merocyanine 540, and Yo-Pro-1 stains, respectively. Phospholipids are spread asymmetrically
between the inner, and outer layers of the sperm plasma membrane bilayer, and have been
found to be maintained enzymatically (Neild et al., 2005). Capacitation induced by
bicarbonate, results in the breakdown of phospholipid asymmetry, in turn the plasma becomes
more fusogenic; this relative phospholipid disorder allows for merocyanine 540 intercalation,
therefore, an increase in merocyanine 540 uptake is indicative of capacitation (Neild et al.,
2005). The breakdown of phospholipid asymmetry is characteristic of capacitation in stallion
sperm, and is a significant molecular change which occurs within the female reproductive
tract.
Cholesterol is distributed evenly over the entire sperm head of non-capacitated sperm. Filipin
is a fluorescent, antibiotic marker, used to monitor changes in sperm cholesterol distribution.
In the presence of bicarbonate, a known inducer of capacitation, cholesterol leaves the
equatorial and post-equatorial regions of the sperm, and becomes concentrated in the apical
region. Subsequently, cholesterol is removed from the sperm plasma membrane by proteins,
such as albumin (Neild et al., 2005). This loss of cholesterol is a rate limiting step, essential
for the activation of tyrosine kinases. Tyrosine phosphorylation is critical to capacitation, as it

Literature Review
15
leads to changes in protein conformation, that contribute to an increased zona pellucida
affinity, hypermotility, and the induction of the acrosome reaction.
Changes that enable the sperm to recognise the zona pellucida, and to undergo the acrosome
reaction in response to zona binding, are of the utmost importance. Such changes include the
facilitation of calcium entry into the cell, increased intracellular calcium and cAMP levels,
alterations in lipid composition and architecture, resulting in increased membrane fluidity,
and hypermotility as a result of changes in metabolic activity (Neild et al., 2005). The cell
surface of sperm has a progesterone receptor, that enables a Ca2+
influx by opening the
voltage gated Ca2+
channels.
The process of binding, and subsequently unbinding to the oviductal epithelial cells (OEC), is
thought to hold a key role in the sperms ability to fertilise an ovulated oocyte. In the mare, a
reservoir of stallion spermatozoa is believed to establish after mating, which is achieved by
the attachment of the spermatozoa to the epithelium of the oviduct (Ellington et al., 1999). It
has been found that the development of a spermatozoal reservoir,r occurs primarily in the
oviductal isthmus (Hunter, 1981), while equine spermatozoa preferentially bind to the
oviductal isthmus of mares in the preovulatroy, or luteal phase of the oestrous cycle (Thomas
et al., 1994). As a result of this attachment, spermatozoa may have prolonged motility and
fertilizing ability in vitro (Thomas et al., 1994). The attached spermatozoa are released over a
period of time, through the process of hyperactivation, and go on to potentially initiate and
complete the fertilisation of an ovulated oocyte.
1.7.2 Hyperactivation
Hyperactivation is one of the first signals that capacitation is underway. It has been shown
recently, that sperm exposed to IVF medium, become hyperactivated within seconds (Neild et
al., 2005) and that this is triggered by phosphorylation of threonine and serine residues of
specific sets of sperm proteins. This phosphorylation, is as a result of bicarbonate/soluble
adenylate cyclise activation of protein kinase A (Neild et al., 2005). Hyperactivation is
characterised by rapid whip-like motion of the sperm tail, with greater curvature towards one

Literature Review
16
direction (Hinrichs, 2012), resulting in amplitude of lateral head movement, which in turn
produces a circular or star like motility pattern.
It has long been known, that calcium is required for the initiation of hyperactivated motility.
(Hinrichs, 2012) described that the sperm-specific calcium channel CatSper, is fundamental
for hyperactive motility. The CatSper channel is made up of four key protein units, and
ancillary proteins. Intracellular alkalinisation causes this channel to open, allowing for an
influx of calcium into the sperm. This influx of calcium is believed to trigger changes in
flagellar function, through calcium-calmoduline-calmodulin-kinase-related effects on dynein
function, however the precise mechanisms by which hyperactivated motility is induced, is still
somewhat unknown (Hinrichs, 2012).
There is some evidence to suggest that the increase in calcium levels may induce asymmetric
flagellar movement, by regulating the activity of the dynein arms. The dynein arms mediate
movement by sliding the flagellar microtubules against one another (Hinrichs, 2012). It was
found that this asymmetric movement required an alkaline environment, which could be
related to the activity range of the dynein ATPases. Additionally, the inner and outer dynein
arms are thought to have differential pH sensitivity. Demembranated bull sperm required the
presence of calmodulin and calmodulin kinase II for the induction of hyperactivation; both of
these are localized within the axoneme (Hinrichs, 2012). Therefore, it is possible that the
influx of calcium, in the presence of an alkaline pH, induces calmodulin-calmodulin kinase
activation of specific groups of dynein arms, this could potentially be on one side of the
flagellum, resulting in an increased curvature of the bend in one direction.
1.7.3 Acrosome Reaction
The acrosome reaction, is an irreversible exocytic event, initiated immediately after primary
binding of sperm to the oocyte, and can only occur after capacitation is complete (Neild et al.,
2005). The acrosome contents (mainly enzymes), are released following the fusion of the
sperm plasma membrane to the underlying acrosomal membrane, this fusion occurs at
multiple sites (Figure 3), and forms a continuous membrane structure, with the plasma
membrane, which is similar looking to a hairpin structure (Flesch and Gadella, 2000).

Literature Review
17
Figure 3: Sequence of interactions between the male and female gamete required for fertilization: (1) sperm
binding to the zona pellucida with its apical subdomain; (2) the acrosome reaction, a multiple fusion event of the
outer-acrosomal membrane with the apical and pre-equatorial plasma membrane; (3) the penetration of the
sperm cell through the zona pellucida; (4) sperm binding and fusion with the oolemma (fertilization) are both
exclusive events for the equatorial plasma membrane; (5) activation of the oocyte by cytosolic factors and fast
poly-spermy block; (6) secretion of cortical granules (cortical reaction) causing a definitive poly-spermy block.
Moreover, this promotes sperm interaction with, and subsequent digestion and penetration of
the zona pellucida. The hydrolytic enzymes dissolve the zona pellucida matrix surrounding
the penetrating sperm, allowing the sperm to enter the perivitelline space (Gadella et al.,
2001). The acrosome reaction induces fusogenicity by the equatorial segment of the sperm
plasma membrane; an important consequence required for the sperm to bind to, and fuse with
the plasma membrane of the egg (oolemma; (Neild et al., 2005). Subsequent to the sperm cell
binding to the oolemma, the head of the sperm binds laterally with its equatorial region, the
hairpin structure is involved in this step (Flesch et al., 2001); Figure 4).

Literature Review
18
Figure 4: Schematic representation of the sperm’s equatorial region binding laterally with the oolemma.
Following effective capacitation, hyperactivation, and acrosome reaction, fertilisation can
take place.

Literature Review
19
1.8 Defensins
Defensins are a family of cationic proteins with molecular masses ranging from 2 to 6 kDa.
These peptides exhibit antimicrobial activity at physiologic ambient conditions and peptide
concentrations (Choi et al., 2012, Ganz, 2004). Defensin peptides are generated by the
proteolytic processing of a 60-95 amino acid precursor molecule, and contain 29-35 amino
acid residues (Davis et al., 2004). These inactive precursor proteins require proteolytic
excision of the N-terminal inhibitory anionic propeptide for maturation and activation (Bruhn
et al., 2011).
Mammalian defensins can be segregated into three subfamilies; α-, β-, and θ-defensins. The
classification of each subfamily is not only determined according to amino acid sequence and
length, but also their specific intermolecular disulfide-bond pattern and cysteine positioning
(Bruhn et al., 2009a, Davis et al., 2004). Alpha-defensins are characterised by having
disulfide bonds between cysteines 1-6, 2-4, and 3-5, this is in contrast to β-defensins which
are comprised of disulfide linkages between cysteine residues 1-5, 2-4, and 3-6 (Ganz, 2003).
Additionally, the spacing of the cysteine residues is highly conserved; β-defensins have a 6, 4,
9, 6, and 0 spacing pattern, while α-defensins display spacing between cysteine residues of 1,
4, 9, 9, and 0 amino acids (Davis et al., 2004). Beta- and α-defensins are comprised of three
antiparallel β-sheets. In addition to this, some β-defensins have an N-terminal α-helix, while
θ-defensins are shown to exhibit a cyclic β-sheet. This is a result of a posttranslational ligation
of two truncated α- defensin precursors (Bruhn et al., 2011).
Beta-defensin’s coding sequences, in most cases, consist of two exons; the first of which
includes the 5’- untranslated region and leader domain of the pre-proprotein, whereas the
second exon encodes for the mature peptide, with the 6-cysteine domain (Choi et al., 2012).
The genomic structure of β-defensins also consists of one intron of approximately 1.5kb
(Looft et al., 2006). Antimicrobial peptide gene anatomy differs greatly between the peptide
families, most of which consist of 2-5 exons. (Bruhn et al., 2011) illustrated that genes of
structurally related antimicrobial peptides are commonly arranged in clusters, thus indicating
a common evolutionary ancestor.
Antimicrobial peptides (AMPs) are synthesized constitutively, or following stimulation by
proinflammatory or pathogen associated molecules in circulating phagocytic cells, epithelial

Literature Review
20
cells of mucosal tissue, glandular cells, leukocytes and granulocytes (Bruhn et al., 2011).
Average concentration of defensins in epithelial cells ranges from 10-100 µg mL-1
, however,
these are not evenly distributed and may have local concentrations much higher or lower than
this range (Ganz, 2004). Defensin concentration has been found to be highest (> 10 mg mL-1
)
in granules, the storage organelles of leukocytes.
Often defensins have an N- terminal signal peptide which mediates correct subcellular sorting
and trafficking. These effector molecules act as endogenous antibiotics of the innate immune
system, and protect the organism against infections from a broad spectrum of microorganisms
(Bruhn et al., 2009a). Their antimicrobial activity is active against Gram-positive and Gram-
negative bacteria, fungi and some enveloped viruses (Daher et al., 1986). Defensins play a
role in connecting the adaptive and innate immune responses in higher organisms. They have
been found to act as signalling molecules in the immune system and as chemoattractants for
T-lymphocytes and immature dendritic cells (Choi et al., 2012). Choi et al. (2012) also
described that since defensins have both antimicrobial and immunomodulation activity, they
can be entitled “host defence peptides” (HDPs). Immunomodulatory functions include;
altering host gene expression, acting as chemokines to recruit leukocytes, or inducing
chemokine or cytokines such as IL-8 and monocyte chemoattractant protein production, and
promoting wound healing (Melia, 2013).
The killing efficacy, target specificity, mode of action, and biochemical properties differ
between the different defensin peptides (Bruhn et al., 2011). As previously mentioned, most
defensins display a cationic charge; this is combined with an amphipathic character, thus, the
peptides have both hydrophilic and hydrophobic properties (Bruhn et al., 2011). Being
amphipathic in nature, allows the defensins to interact with biological membranes, in such a
way that the cationic domains are located near the negatively charged phospholipid
headgroups, whilst the hydrophobic portions of the peptide are submerged within the
hydrophobic interior of the membrane, which consists of fatty acid chains (Ganz, 2004).
Their action is primarily attributed to an initial electrostatic interaction with the negatively
charged compounds of the bacterial cytoplasmic membrane. This is followed by insertion, and
subsequent permeabilization of the membrane, resulting in the lysis of the targeted microbes
(Bruhn et al., 2011). This has been found to coincide with the inhibition of RNA, DNA and
protein synthesis and decreased viability in bacteria (Ganz, 2004). Ganz (2004)

Literature Review
21
comprehensibly described that as leukocytes ingest microbes into phagocytic vacuoles, the
granules fuse with these and deliver their contents into the target microbe. Phagocytic
vacuoles have little free space, thus the microbe is exposed to highly concentrated granule
material. Similar to this, Paneth cells of the small intestine contain secretory granules which
they release into the narrow intestinal pits, known as crypts. It has been found however, that
defensins can also affect intracellular processes via interactions with receptors, or signalling
molecules, here they mediate chemotactic or proinflammatory effects (Bruhn et al., 2011).
1.8.1 Defensins in the Horse
The horse (Equus caballus) has been shown to express both α-, and β-defensins. Alpha-
defensins, which are primarily synthesised in neutrophils and intestinal Paneth cells, are
known to play a role in the pathogenesis of intestinal diseases, and could potentially regulate
the flora of the intestinal tract. (Bruhn et al., 2009b) demonstrated that 38 α-defensins are
present in the equine intestinal tract, where it subsequently became evident that at least twenty
of these could potentially code for functional peptides. This was due to the fact that typical
conserved α-defensin characteristics are present in the primary sequences. It is believed that
Equidea are the only species of the Laurasiatheria clade to possess α-defensins (Bruhn et al.,
2011). Horse’s last common ancestor with cows and sheep is 82.4 million years ago (Figure
5), and it has been questioned as to why these species have seemingly lost their complete set
of α-defensin genes, while the number in the horse has increased drastically.

Literature Review
22
Figure 5: A phylogentic tree showing the separation of the different species in the Laurasiatheria clade. About
82.4 million years ago the horse had its last common ancestor with the cow. It is thought that around this time
the other species lost their α-defensins, while the horse kept them.
Beta-defensin one (β-defensin-1) was the first β-defensin to be observed in the horse. The
amino-acid sequence illustrates the typical conserved six cysteine residues. Davis et al.,
compared the cDNA sequences to other β-defensins, revealing a 45-52% similarity to the
caprine, bovine, and porcine homologs. The expression of β-defensin-1 was detected across a
broad range of tissues including; the heart, liver, gastrointestinal tract and the lungs. Therefore
the assumption was made that this gene has a constitutive expression.
Recently, the presence of β-defensin-1 was discovered in the endometrium of the mare
(Schöniger et al., 2013). The study demonstrated the expression of β-defensin-1 in both
healthy, and diseased equine endometrium, clearly indicating that β-defensin-1 contributes to
the endometrial immune defence in the mare.
Equine β-defensins have also been detected in glands and glandular secretions. Using
immunohistochemistry, β-defensin protein was shown in products of the apocrine and
sebaceous glands of the external auditory canal (Yasui et al., 2007), scrotal skin (Yasui et al.,

Literature Review
23
2007), and was also observed in the oesophagus. During immunohistochemistry, cross-
reactive anti-human β-defensin-2, and anti-human β-defensin-3 antibodies were used. It has
been suggested that, the presence and secretion of this defensin leads to a protective effect,
and a non-specific defence against multiple microorganisms being exhibited by the apocrine
glands (Bruhn et al., 2011).

Figure 6: Expression of equine antimicrobial peptides in different tissues of the horse. To date, only two β-defensins have been characterised in the horse, DEFB1, and
DEFB103. Additionally, two defensin like genes have been discovered, DEFL2 and DEFL3 (Bruhn et al., 2011).

25
Bruhn et al. (2011) screened a panel of epithelial tissues of a single horse, and the umbilical
cord of a foal for the transcription of the genomic sequences of the putative genes; DEFA5L,
DEFB103, DEFL1, DEFL2, and DEFL3. Equine defensin like 2 & 3 were detected in several
tissues, including the uterus. Beta defensin like -2 and -3 are duplicates of DEFB1, and a
function has yet to be described. As in humans, β-defensin-103 was found to be exclusively
transcribed in the tongue of the horse, thus indicating to the presence of a special oral
defensin.
1.8.2 Role of Defensins in Reproduction
Defensins were originally thought to solely protect the reproductive tract from invading
pathogens, more recently however, they have been shown to be directly correlated with
specific sperm functions, including initiation of motility, and capacitation (Yudin et al.,
2005a). Secretion of β-defensins in the epididymis was found to be under androgen control,
therefore, suggesting that these glycoproteins have a role in sperm physiological functions
within the female reproductive tract, in addition to their unspecific antimicrobial activities.
Many β-defensins are found to be highly expressed in the functionally unique tissues of the
male reproductive tract. (Tollner et al., 2008a) has examined in detail the expression, and
function of DEFB126 in the macaque and in humans (Tollner et al., 2011b).
Defensins have been shown to be expressed in the male reproductive tract of many species.
Alpha and β-defensins were shown to be expressed in the male reproductive tracts of humans,
mice and rats (Com et al., 2003). Human β-defensin-1’s in situ immunolocalization was
studied in depth in human testicular biopsies, seminal plasma, and ejaculated spermatozoa
using a combination of cytochemistry and immunohistochemistry. This study showed that the
male urogenital tract of mammals expresses a broad range of defensins, thus suggesting the
presence of innate defences against infection, or other reproductive functions (Com et al.,
2003). A cluster of nineteen novel defensin genes have been recently discovered in the bovine
genome (Narciandi et al., 2011). These were shown to be expressed in a region specific
manner in the bovine male and female reproductive tract. Expression was predominantly
found in the male testis, in the absence of infection, thus suggesting a non-defence role for
these molecules.

Literature Review
26
The means by which sperm reach the oocyte, while at the same time manage to evade the
immune response within the hostile environment of the female tract is relatively unknown.
DEFB126, which coats the entire surface of sperm, is a primary candidate for providing such
immune protection within the female tract. The uniform cloaking of DEFB126 spanning the
entire sperm surface, protects these foreign cells as being recognised as a threat in the female
reproductive tract (Yudin et al., 2005a). Sialic acid moieties are responsible for sperms high
negative charge, which appears to be responsible for the immune protective function of
DEFB126. β-defensin 118 was also found on the surface of macaque sperm, and like DEFB
126 possesses antimicrobial activity, and has an extended carboxyl tail with many O-
glycosylation sites (Yudin et al., 2005b).
Tollner et al. (2008b) demonstrated that β-defensin 126 is the dominant component of the
macaque sperm glycocalyx, and coats the entire surface of macaque sperm. This coating
protein is absorbed onto the entire surface of macaque sperm in the caudal epididymis, and
has interestingly been found to remain on viable sperm collected from the cervix, and uterus
of mated female macaques (Tollner et al., 2008a) suggesting that DEFB126 is retained on
sperm in the upper female reproductive tract. Coating of DEFB126 was shown to facilitate the
ability of sperm to penetrate cervical mucus, and when removed this penetration of cervical
mucus was lost. It was concluded from the study that, because of the presence of multiple
sialylated oligosaccharides, DEFB126 has a high negative charge, which appears to be critical
for cervical mucus penetration (Tollner et al., 2008b).
In addition, Tollner et al. (2008a) discovered that DEFB126 plays a pivotal role in sperm
binding to oviductal epithelial cells. The ability to remain firmly tethered to the apical
surfaces of the oviduct is fundamental to the formation of a sperm reservoir. When DEFB126
was removed from the sperm it significantly altered the ability of sperm to bind to oviductal
epithelial cells. Moreover, when soluble DEFB126 was added back to this sperm, there was a
recovery of sperm-epithelial binding (Tollner et al., 2008a).
However, for sperm to recognise and bind to the zona pellucida, removal of DEFB126 from
the head of the sperm is required (Tollner et al., 2009). This removal of the sperm surface
coats is a well-recognised component of capacitation, which exposes specific receptors on the
plasma membrane, allowing for zona pellucida recognition.

Literature Review
27
Interestingly men with mutations of this gene are found to be subfertile (Tollner et al., 2011b).
Men with the homozygous variant (del/del) of DEFB126 had significantly reduced binding of
the sperm surface glycocalyx to Agaricus bisporus lectin, suggesting that this genotype has
fewer O-linked oligosaccharides in their sperm glycocalyx. A group of newly married
couples, trying to conceive by natural means were examined. Couples were less likely to
become pregnant, and took considerably longer to achieve a live birth where the male was
homozygous for the variant sequence (Tollner et al., 2011b). Sperm of this variant were found
to have reduced mucus penetration abilities.
Defensins are not restricted to the male tract; human intestinal defensin-5 (HD-5) is expressed
in the human female genital tract epithelia (Quayle et al., 1998). A range of female
reproductive tissues were shown to express HD-5; including the ectocervix, vagina,
endometrium, and fallopian tube. Endometrial expression was found to be highest during the
early secretory phase of the menstrual cycle, where it was concluded that; the expression of
HD-5 is potentially modulated by hormonal, and proinflammatory factors, and is an intrinsic
part of the female urogenital innate immunity (Quayle et al., 1998).
The initiation of sperm maturation and the induction of motility are mediated by β-defensins.
The epididymis has long been known to be the site of sperm maturation; however, the
molecular basis of this maturation is somewhat unknown. β-defensin, Bin1b, has been linked
to the process whereby sperm acquire their forward motility in the caput epididymis (Zhou et
al., 2004). The induction of motility was found to be regulated by Bin1b-induced uptake of
Ca2+
; this is known to be less prominent in maintaining motility of mature sperm. Epididymal
sperm was cocultured with anti-Bin1b antibodies; the results showed that progressive
movement and motility was greatly reduced in mature sperm, revealing that Bin1b is essential
for the progressive movement of sperm (Zhou et al., 2004).

Objectives
28
1.9 Objective
The objective of this study is to determine if newly discovered β-defensins in cattle are
conserved in the equine genome, and regionally expressed in the reproductive tracts of both
mares and stallions.

Chapter II

30
2.0 Materials and Methods
2.1 Bioinformatic Identification of Equine Amp Orthologs
Homology searches with the Basic Local Alignment Search Tool (BLAST) (Altschul et al.,
1990) were performed using gene sequences for the 19 known bovine chromosome 13 b-
defensins against the equine genome. The bioinformatic tool, BLAST-Like Alignment Tool,
(BLAT) was used to determine the chromosome and the position on that chromosome of the
β-defensin genes. BioEdit software was used to perform multiple sequence alignments
between the equine and bovine protein sequences. To annotate the putative β-defensin-
encoding sequences identified from our analysis, a phylogenetic analysis was performed using
MEGA version 5.2, software and the 13 amino acid sequences corresponding to the β-
defensin prepropeptide, together with previously reported β-defensins from cattle. We
annotated equine β-defensin genes on the basis of sequence similarity and phylogenetic
relationships to previously described β-defensins in cattle to maintain consistency in the
comparative analysis of β-defensins with other species. Nucleotide sequences were firstly
aligned using the Clustal program as implemented in BioEdit (Hall, 1999).
2.2 Reproductive Tissue Collection
The reproductive tracts of 2-4 year old sexually mature Connemara stallions (n=3) were
collected immediately post castration and tissue samples (3mm sized sections) were dissected
from the testicle, caudal, corpus and caput epididymis, as well as from the vas deferens
(Figure 1). Mare reproductive tracts in the luteal phase (confirmed by the presence of a corpus
luteum; n=3) were retrieved from 5-8 year old Connemara mares (n=3) post mortem, at a
local abattoir within 20 min of slaughter. Tissue samples (3mm sized sections) were dissected
from the ovary, oviduct, uterine horn, uterus, cervix, and vagina (Figure 1). All samples were
placed in RNAlater (Qiagen, Crawley, UK), held at 4°C overnight, and subsequently stored at
-20°C.

31
Figure 7: The location of sample collection in the reproductive tract the mare (Panel A) and stallion (Panel B).
2.3 RNA Extraction and cDNA Synthesis
Total RNA extraction was carried out using a Qiagen RNeasy kit (Qiagen, Crawley, UK). The
tissue was firstly homogenised in 600 µL RLT buffer (provided with the kit), using a hand
held homogenizer. RLT is a lysis buffer used for lysing cells and tissue, prior to RNA
isolation. Seven hundred microlitres of 70% ethanol was added to each sample, prior to them
being placed in spin columns, and washed multiple times (8,000 for 15 sec) with the RW1
wash buffers provided, before eluting with 30µL RNase free water, to achieve a clean, pure
RNA suspension. DNA was removed following a 15 min incubation with 10 µL rehydrated
DNase mixed with 70 µL RDD buffer. RNA quantity was assessed using a Nanodrop
Sperctrophotomer (Thermo Fisher Scientific, Waltham, MA, USA), while the quality was
determined with the use of an Agilent Bioanaylser. cDNA was synthesised using an Applied
Biosystems cDNA reverse transcription kit, and an Eppendorf Mastercycler.

32
Table 1: Sequences for the designed primers of the reference genes GAPDH, ACTβ, DEFL2&3 and eNAP2, and
the 13 novel equine β-defensin genes.
OligoName Sequence (5'- 3')
eGAPDHF AAGGTCATCCCTGAGCTGAA
eGAPDHR TGGAAGAGTGGGTGTCACTG
eACTbF GATCTGGCACCACACCTTCT
eACTbR GAGTCCATCACGATGCCAGT
eDEFL2F CCTTCTCATCTTTGTTGTCCTC
eDEFL2R TTCCTCCTCAGGCAGACACT
eDEFL3F CTTGTGTGTCTCATCCAGACG
eDEFL3R CGTGTTTTCTCCCCGTTTT
eNAP2F GCTTGTAGCTGTCCAGTTTTCC
eNAP2R CACACAGATCAATGGAGCAGA
eBD115F
eBD115R
eBD116F
eBD116R
eBD117F
eBD117R
eBD119F
eBD119R
eBD120F
eBD120R
eBD122aF
eBD122aR
eBD123F
TATGCTGCTGGATCATTCCTC
GTTACCTGGGGAAGCCTGA
CCATCCTTCTGATGCTGGTT
TTCTGCACATGCCTTGGTAA
GACATTGCAGGAAAGACTGC
TGGATTGGTCTGTGTGGTTG
CTTTCTGGCCATGGAACCAG
TGTTACCCATGCACTGAAGG
CGGTTGGTGTGCAAAGATGA
CCAGGGGAGTTCTCCATCAA
GCTGGAATCTTCATGGCACC
CAGTGGTAAATTCGGCTGGA
ACCCGAAAATGCTGGAATCT
eBD123R TGGTACTTGGGCTTCACACA
eBD124F AATTCAAACGGTGCTGGAAG
eBD124R TGAGTCCGTAGGGGAGACAG
eBD125F GCTGGCTGGGAAGTCAAA
eBD125R AATCCTCCTCACTCGTTATGG
eBD126F GGTATGTGAGAAAGTGTGGAAACA
eBD126R
eBD127F
EBD127R
EBD129F
EBD129R
TCTTTGCTGCACATGCCAGT
ACTTAAGAAATGCTGGGGTGA
GTCATTGGCTTTGGACGTGT
TGGGGAGATGCAAAGACCAT
ACCGGTGCTTTTGATTTTGGA

33
2.4 Primer Design
Primers were designed using Primer 3 software, and commercially synthesised (Sigma
Aldrich, MO, USA). Primers were designed for the novel defensin genes, as well as for the
house keeping genes equine GADPH and equine ACTβ, for use as reference genes. Primers
for DEFL 2 & 3, eNAP2 were also designed for reference purposes. Nucleotide sequences
were retrieved from the University of California, Santa Cruz (UCSC) Genome Browser, and
inputted into Primer 3 to determine the best best nucleotide sequence for both a forward and
reverse primer, for each gene (Table 1). Where possible primers were designed to be intron
spanning.
2.5 qRT-PCR
Quantitaive real time PCR (qRT-PCR) samples were prepared using a 20µL reaction mix
protocol: 10 µL SYBR green PCR Master Mix (Invitrogen Ltd, Paisley, UK), 2.5 µL primer
and dH2O mix, 5.5 µL dH2O, and 2 µL sample. Plates were run in an ABI 7500 Fast
Thermocycler. A non-template control (NTC) was run in each 96-well plate to confirm the
absence of contamination. All products were run on an agarose gel to confirm the presence of
a single PCR product, of the correct size. A 1% agarsoe gel was stained with 5 µL ethidium
bromide, while each 20 µL PCR product was stained with 3 µL blue tracking dye. Three
microlitres of 1kb ladder was used, while 5 µL of sample was added into each well. Gels
were run at 100mV, for 40 min. Gel electrophoresis images were acquired using a
FluorChem system (Alpha Innotech, CA, USA). Levels of gene of interest expression was
determine using fold changes, calculated using the ΔCt (cycle threshold) method, compared
with the average of housekeeping genes GAPDH and ACTβ.

34
2.6 Statistics
Expression of the novel β-defensin genes were normalised to the average of the two
housekeeping genes, and using these values the fold change was calculated. This indicated the
direction of change of the expression compared with that of the average of the housekeeping
genes. Glycosylation sites in the β-defensin peptides were predicted using in silico tools
(NetOGlyc 3.1, NetNGlyc 1.0 and NetCGlyc 1.0) available at www.cbs.dtu.dk/services/
(Julenius et al., 2005). Gene expression data between each tissue (within gender) were
examined for normality of distribution, transformed where appropriate using an artan
transformation, and analysed using analysis of variance in Statistical Package for the Social
Sciences (SPSS, Version 21.0; IBM, USA). Post-hoc tests were carried out using the
Bonferroni test and a P value < 0.05 was considered statistically significant.

Results
36
3.0 Results
3.1 Discovery of Novel β-defensins in the Equine Genome
Of the 19 novel β-defensin genes recently reported in the bovine, thirteen were found to be
present on chromosome 22 in the equine genome (Table 2). This provides exciting clues that
these novel genes may play similar roles in equine reproduction, as in other species. There
were no close gene matches to bovine β-defensins, bBD118, bBD121, bBD122, bBD125a,
bBD128, bBD142 or Defensin like (DEFL) 2 & DEFL 3 in the equine genome. bBD132 was
found to only have one conserved exon. In addition, eNAP 2, ACTβ and GAPDH were also
shown to be present. Identification of the missing genes of this cluster found in cattle may be
identified with a more complete draft of the equine genome, or with the use of more sensitive
search tools such as HMM in the future (Kyte and Doolittle, 1982).

Results
37
Table 2: Summary of the β-defensin genes found, and their location in the equine genome (UCSC version
equCab2) using a combination of BLAST, and BLAT search tools.
Beta Defensin Chromosome Start Position Finish Position
Horse 132 Chr 22 22105463 22105513
Horse 129 Chr 22 22136194 22138292
Horse 127 Chr 22 22192358 22192582
Horse 126 Chr 22 22207554 22207679
Horse 125 Chr 22 22264333 22270987
Horse 115 Chr 22 22315338 22510961
Horse 116 Chr 22 22391758 22396465
Horse 117 Chr 22 22440878 22440997
Horse 120 Chr 22 22474538 22474687
Horse 119 Chr 22 22475857 22475916
Horse 122a Chr 22 22510961 22511080
Horse 123 Chr 22 22546361 22546486
Horse 124 Chr 22 22559089 22562585
3.2 Advanced Bioinformatic Analysis
Multiple sequence alignemnts were carried out using BioEdit software. This was used to show
that the newly discovered equine defensins contain the characteristic six cysteine residues in
their amino acid sequence, and their simialrity to the respective bovine defensins (Figure 8 &
9).

Results
38
Figure 8: Amino acid sequences of 13 equine β-defensins, showing the conserved six cysteine residues
(indicated with arrows).
Figure 9: Multiple sequence alignment of both bovine and equine β-defensins which had the largest intron,
showing the conserved characteristic six cysteine residues (brown), in addition to glycine (orange), and glutamic
acid (red).

Results
39
Analysis of glycosylation sites in the β-defensins revealed that only eBD129 possessed N-
glycosylation. No glycosylation sites were found in any other genes for N, O, or C
glycosylation.
Figure 10: Graph showing the predicted N-glycosylation site for equine β-defensin 129. Significant support
shown by line above threshold (red line).

Results
40
Figure 11: Phylogenetic tree showing the relatedness between the thirteen novel β-defensins in the equine and
bovine genomes.
Phylogenetic analysis revealed the sequence similarity and phylogenetic relationships
between the thirteen novel β-defensins in the equine and bovine genomes. The clusters of
novel equine and bovine defensins are present in two semi-distinct groups pivoting around the
potential progenitor peptides, eBD123 and eBD122a. The smaller of the two groups consisted
of the five genes; eBD117, eBD119, eBD120, eBD125 and eBD127; whilst the larger group is
made up of the remaining six genes; eBD 115, eBD116, eBD124, eBD126 and eBD132This
indicates that there may be slight differences in protein properties occurring between these

Results
41
two groups of β-defensins within the equine genome. Following examination of the protein
properties, the smaller group of β-defensins are, in general, less positively charged than those
of the larger group (Kyte and Doolittle, 1982).
Following examination of the protein properties, it was found that the smaller group of β-
defensins are, in general, less positively charged than those of the larger group. β-defensins in
the larger group also tended to be more hydrophilic than those of the smaller group.
3.3 Expression of Novel Defensins Across Equine Reproductive Tissues
Expression of the thirteen completely novel equine β-defensins, eNAP 2, and normaliser
genes ACTβ and GAPDH were found across a panel of male, and female reproductive tissues
in the horse, in the absence of infection. Representative plots of β-defensin gene expression
are shown for each of the male and female tissues sampled (Figures 11, 12, 13 & 14).
Some β-defensins were found to be homogeneously expressed across the genital tract in both
males and females (eBD129 and 122a), whereas, eBD115 and 116 were more highly
expressed in the male reproductive tract (P < 0.01). The testes had very similar expression
levels of all 13 novel equine β-defensins. eBD119 was found to be lowly expressed across all
tissue samples (both mare and stallion), while, eBD117 was shown to have the overall highest
expression in the stallion (P < 0.01; Figure 11&12). Defensin like 2 and 3 (DEFL 2 & 3) were
lowly expressed in the reproductive tract in both the mare and the stallion. In general, highest
expression for the majority (10 of 13) of these novel genes was in the caput epididymis.

Results
42
Figure 12: Variation in expression of selected equine β-defensin genes, across the male reproductive tracts of 3
stallions. Expression was normalised to the average of eGAPDH and ACTβ gene expression, represented by 0 on
graph for equine β- defensins 115, 119, 122a and 124. T, testis; E-CT, caput epididymis; E-CS, corpus
epididymis; E-CL, caudal epididymis; VD, vas deferens.

Results
43
Figure 13: Variation in expression of selected equine β-defensin genes, across the female reproductive tracts of
3 mares. Expression was normalised to the average of eGAPDH and ACTβ gene expression, represented by 0 on
graph for equine β- defensins 115, 119, 122a and 124. OV, ovary; FT, fallopian tube; UH uterine horn; UT,
uterus; CX, cervix and VG, vagina.
eBD116 was highly expressed in the corpus and caudal epididymis, while, eBD126 had
highest expression in the caudal epididymis of the stallion. eBD124 had the highest
expression in the caput epididymis, whereas, for eBD125, highest expression was in the
corpus region of the epididymis. Equine β-defensin 120 had a low, and varied expression
across the reproductive tract of the stallion. In other cases there was less variation, as seen
with eBD123, while the expression of the reference genes ACTβ and GAPDH, and eNAP 2
was consistent across all sample tissue types (Figure 15). Variability of eBD126 was seen
between the corpus epididymis samples of the three stallions, while the expression is
relatively homogenous across the other sections of the male tract.
As with the stallions, variation is evident between individual mares as well as along the
reproductive tract. β-defensin expression was relatively uniform with the average housekeeper

Results
44
expression across the uterus, cervix and vagina. Lowest expression was found in the uterine
horn, while the oviducts had significantly higher expression of eBD120 and eBD122a (P <
0.01). eBD120 was, on average, the highest expressed β-defensin in the mare, having highest
expression in the vagina. The oviduct and the uterus were found to be the predominant sites of
β-defensin expression in the mare, with the exception of eBD119, which had significantly
lower expression than all other genes, in all regions. eBD120 was found to be expressed at
levels equivalent to that of the average of the reference genes ACTβ and GAPDH in the
female reproductive tract.
Unlike the stallion, eBD116 had notably lower expression in the mare’s reproductive tract, in
particular in the cervix and uterine horn in the mare, as did eBD126, which displayed
extremely low expression in the ovary and uterine horn. Equine β-defensin 115 and 117 had
differential regional expression across the female reproductive tracts. Both are highly
expressed in the common body of the uterus of the mare; however, they have a much lower
expression in the anatomically adjacent uterine horn. The expression of β-defensin 115 and
117 is considerably lower in the equine ovary and oviduct. In all cases mare three was the
outlier, with significantly lower regional expression; in particular in her ovary and uterine
horn samples.

Results
45
Figure 14: Variation in expression of selected equine β-defensin genes, across the male reproductive tracts of 3
stallions. Expression was normalised to the average of eGAPDH and ACTβ gene expression, represented by 0 on
graph for equine β- defensins 117, 120, 116 and 126. T, testis; E-CT, caput epididymis; E-CS, corpus
epididymis; E-CL, caudal epididymis; VD, vas deferens.
Stallion1 Stallion2 Stallion3
eBD 117
eBD 116 eBD 126
eBD 120

Results
46
Figure 15: Variation in expression of selected equine β-defensin genes, across the female reproductive tracts of
3 mares. Expression was normalised to the average of eGAPDH and ACTβ gene expression, represented by 0 on
graph for equine β- defensins 117, 120, 116 and 126. OV, ovary; FT, fallopian tube; UH uterine horn; UT,
uterus; CX, cervix and VG, vagina.
Mare 1 Mare 2 Mare 3
eBD 117 eBD 120
eBD 126eBD 116

Results
47
Figure 16: Analysis of the tissue expression profiles of 13 novel equine β-defensins, reference genes eNAP 2,
DEFL 2 & 3, and housekeeping genes ACTβ and GAPDH across the stallion and mare reproductive tracts, using
gel electrophoresis following qRT-PCR. Samples shown are from a representative stallion and a representative
GAPDH
ACTb
eNAP 2
DEFL 3
DEFL 2
eBD 129
eBD 127
eBD 126
eBD 132
eBD 124
eBD 123
eBD 122a
eBD 120
eBD 119
eBD 117
eBD 116
eBD 115
eBD 125
T E-CT E-CS E-CL VD OV FT UH UT CX VG NTC

Results
48
mare (T, testes;CT, caput epididymis; CS, corpus epididymis; CL, caudal epididymis; VD, vas deferns; OV,
oviduct; FT, fallopian tube; UH, uterine horn; UT, uterus; CX, cervix; VG, vagina; NTC, non template control).

Discussion
50
4.0 Discussion
This study is the first comprehensive genetic analysis of the β-defensin gene cluster on
chromosome 22 in horses and also the first demonstration of β-defensin gene expression
along the male and female genital tract. Clear and distinct patterns of β-defensin gene
expression were seen in the reproductive tracts of all animals, in the absence of infection,
suggesting an immune-reproductive role.
The reason for the retention of α-defensins in the equine genome is not clear but may be due
to differences in pathogenic selection pressures between horses and other artiodactyls over the
course of evolution (Bruhn et al., 2011). While 38 α-Defensins have been documented, the
numbers of β-defensins contained within the equine genome has not been extensively
analysed. Diverse patterns of gene expression have been shown for the limited number of
equine β-defensins analysed in the literature – including expression along the gastrointestinal
tract as well as in the liver (Bruhn et al., 2011). To-date, there has been no study exploring β-
defensins, and their potential immuno-reproductive role in the horse.
Using a comparative genomics approach, the Equus caballus genome was profiled for the 19
recently discovered β-defensins genes that make up a cluster of reproductive defensins on
chromosome 13 in the bovine genome. Thirteen novel genes were found to be present on
chromosome 22 in the equine genome. Bioinformatic analysis also revealed that the equine
defensins are present in a similar syntenic order to those of the bovine, starting with eBD132
and finishing with eBD124. The reason as to why the equine genome does not encode the
remaining six bovine genes is unknown but may reflect the loss of these genes over millions
of years of evolution since the horse and cow last shared a common ancestor.
Comparison of both genomes shows the high sequence similarity between the equine and
homologous bovine β-defensin gene sequences. As expected, all the equine β-defensin genes
contain the conserved characteristic six cysteine residues (Ganz, 2003). Multiple sequence
alignment revealed similar amino acid sequences between the novel equine β-defensins have
to that of the bovine β-defensins (Narciandi et al., 2013).
Phylogenetic analysis revealed that the clusters of novel equine and bovine defensins are
present in two semi-distinct groups pivoting around the potential progenitor peptides, eBD123

Discussion
51
and eBD122a. The smaller of the two groups consisted of the five genes; eBD117, eBD119,
eBD120, eBD125 and eBD127; whilst the larger group is made up of the remaining six genes;
eBD 115, eBD116, eBD124, eBD126 and eBD132. The presence of two groups indicates to
possible functional differences within this cluster of β-defensins. This second smaller
subgroup is similar to the Class A β-defensins described in cattle (Narciandi et al., 2013,
Narciandi et al., 2011), which showed low and preferential expression in the epididymis and
vas deferens and with no expression in the immature bull or the cow genital tract (Narciandi
et al., 2011).
The mechanism by which β-defensins invade pathogens has been attributed to an initial
electrostatic interaction with the negatively charged compounds of the bacterial cytoplasmic
membrane (Choi et al., 2012, Ganz, 2004). This is followed by insertion, and subsequent
permeabilization of the membrane, resulting in the lysis of the targeted microbes (Bruhn et
al., 2011). In silico analysis showed that the peptides in the group with six peptides possess a
higher net positive charge, and were more hydrophilic than peptides in the group with five.
This potentially indicates that the smaller of the subgroups have a higher affinity for the lipid
membranes of invading pathogens, while the larger group have a higher affinity for more
aqueous environments, and the negatively charged phospholipid headgroups of a
phospholipid bilayer (Choi et al., 2012).
Expression analysis of β-defensins in the reproductive tracts of other species demonstrated
quantitative variation in gene expression in various sections of the genital tract, thus
suggesting that site-specificity of gene expression may reflect differences in the biological
role of these β-defensins (Com et al., 2003, Jelinsky et al., 2007, Zhou et al., 2004). All genes
examined were found to be expressed across the reproductive tracts of all three stallions. The
high expression found in the caput epididymis for all genes, in all stallions, and the low gene
expression patterns found in the vas deferens, for the majority of the genes (8 out of 13) in
stallions, is in agreement with studies which suggest that initiation of sperm maturation and
the induction of progressive motility are associated with β-defensin absorption, which occurs
in the epididymis of humans (Tollner et al., 2011b), macaques (Tollner et al., 2008b), rats
(Zhou et al., 2004), mice (Yudin et al., 2008), pigs (Choi et al., 2012) and cattle (Narciandi et
al., 2013). This consistent and high expression of β-defensins, relative to ACTb and GAPDH

Discussion
52
(normaliser genes), in the caput epididymis of the male tracts is suggestive of a potential role
in final sperm maturation for these genes.
β-defensin 126 is a gene of particular interest as it has been documented to regulate human
male fertility. B-defensin 126 has been shown to extensively coat macaque sperm. The sperm
glycocalyx plays a pivotal role in the coating of DEFB126 in humans (Tollner et al., 2011b)
and macaques (Tollner et al., 2008b, Tollner et al., 2011b). This coating as well as the high
negative charge of DEFB126 has been found to be critical for the movement of sperm through
macaque cervical mucus (Tollner et al., 2008b), while the removal of DEFB126 from the
sperm surface is essential for the completion of capacitation in the female reproductive tract
of macaques (Tollner et al., 2009, Yudin et al., 2003), which is essential for the biochemical
events leading to the recognition and subsequent fertilisation of the oocyte in macaques
(Tollner et al., 2004). Following treatment of macaque sperm with anti- DEFB126 antibodies
Tollner et al., 2008 (Tollner et al., 2008b), demonstrated that sperm had significantly reduced
ability to penetrate cervical mucus (Tollner et al., 2008b), while upon add back of DEFB126,
penetration ability was restored. Furthermore, humans that are homozygous for the DEFB126
gene (del/del) have been shown to have reduced fertility; more specifically this mutation
causes reduced mucus penetration ability in sperm (Tollner et al., 2011b).In this study,
eBD126 had relatively homogenous expression across the stallion genital tract, with the
exception of the corpus epididymis, which was more varied, suggesting that it has a similar
role in sperm maturation as that described in other species (Tollner et al., 2008a, Yudin et al.,
2005a, Zhou et al., 2004, Tollner et al., 2008b). eBD117 was found to have the overall highest
expression across all reproductive tissue samples. In the cow, the expression of the β-defensin
gene cluster is limited to the reproductive tract, with the exception of eBD117 (Narciandi et
al., 2011).
The cluster of 13 novel β-defensins were found to have differential expression along the male
reproductive tract, with stallions having highest expression in the caput epididymis, and
lowest expression in the vas deferens. Stallion two showed lower expression in the vas
deferens and caput epididymis for genes eBD115, eBD119, eBD122a, eBD123, eBD124,
eBD125, eBD127, and eBD129, while there was also lower expression of eBD116 in the
testicle sample. The high expression in the caput epididymis could suggest that there is a
higher level of β-defensin transcription being carried out in this section of the male

Discussion
53
reproductive tract. An up-regulation of these genes in the caput epididymis suggests that the
sperm become coated by β-defensins in this region. There is evidence to suggest that some
stallions induce PPBEM in mares more than others (Maischberger et al., 2008). Even though
sperm can survive in an inflamed uterine environment, their motility is progressively reduced
due to their aggregation with polymorphonuclear neutrophils (PMNs), resulting in a reduction
in the number of viable spermatozoa reaching the uterine tube for fertilisation (Alghamdi et
al., 2001). The induction of β-defensins on the surface of the sperm may do one of two things,
induce PPBEM, or protect the sperm from the inflammatory in the uterus.
Based on their location in the testis and epididymis, and in consideration of recent and
associated studies (Tollner et al., 2008a, Tollner et al., 2009), β-defensins could potentially
mediate the binding of the sperm to the equine female oviductal epithelia. In addition,
defensins could be important for sperm maturation in the male tract: this process is known to
occur by the attachment of multiple proteins (DEFB126, cAMP(Yudin et al., 2003, Yudin et
al., 2005b) ) to the sperm surface during its transit through the epididymis (Narciandi et al.,
2011, Yudin et al., 2003, Acott and Hoskins, 1981). Alternatively the regional distribution of
the β-defensins could be explained by the various groups targeting specific pathogens only
present in that region, or to prevent infection in the female reproductive tract following
mating (Sorensen et al., 2003), however, the lack of inflammation or infection suggests a role
outside that of solely defence.
This study is the first comprehensive genetic analysis of the β-defensin 13-gene cluster on
chromosome 22 in the horses, and also the first to demonstrate β-defensin gene expression
across both the male and female reproductive tract in the horse. The findings strongly point to
a potential reproductive, as well as an immunological role for these defensin molecules in the
horse. This study has demonstrated genetic variation in the expression of these genes between
the stallion and the mare. The ever expanding negative association between performance traits
and fertility in horses has created economic and welfare issues for the equine industry as a
result of intensive selection for high performance sport animals. This has generated an
immense interest in developing breeding strategies to overcome the limitations of poor
fertility including (Peddinti et al., 2008); genome-wide association studies, and other methods
for the identification of fertility biomarkers (Hoglund et al., 2009, Huang et al., 2010, Sahana
et al., 2010). Moreover, the reproductive tissue expression profile of this novel cluster of β-

Discussion
54
defensin genes indicates that these genes could become an important tool as markers for
fertility, which could be incorporated into future breeding programs.

Conclusion
56
5.0 Conclusion
In conclusion, this study is the first to reveal the presence and location of a cluster of thirteen
novel β-defensin genes in the equine genome. The evoltionary orthologs of these genes have
been shown to play a pivotal reproductive-immunobiological role across a range of species
including in mice, macapques and in men. These genes can now be targeted for population
genetic analysis, to identify functional polymorphisms that may contribute to higher fertility
in individual horses, and between horse breeds. This could help generate new assisted
reproductive technologies, as well as the development of alternative treatments, for conditions
such as endometritis, which is one of the largest causes of infertility in mares. These genes
can also potentially be used in genome-wide association studies and other methods for the
identification of fertility biomarkers (Hoglund et al., 2009, Huang et al., 2010, Sahana et al.,
2010).

References
58
References
Acott, T. S. & Hoskins, D. D. (1981). Bovine sperm forward motility protein: binding to
epididymal spermatozoa. Biol Reprod, 24, 234-40.
Alghamdi, A., Troedsson, M. H., Laschkewitsch, T. & Xue, J. L. (2001). Uterine secretion
from mares with post-breeding endometritis alters sperm motion characteristics in
vitro. Theriogenology, 55, 1019-28.
Altschul, S. F., Gish, W., Miller, W., Myers, E. W. & Lipman, D. J. (1990). Basic local
alignment search tool. J Mol Biol, 215, 403-10.
Blanchard, T., Thompson, J., Brinsko, S., Varner, D., Love, C., Ramsey, J., & O’meara, A.
(2010). Some factors associated with fertility in thoroughbred stallions. Journal of
Equine Veterinary Science, 30, 407-418.
Bruhn, O., Cauchard, J., Schlusselhuber, M., Gelhaus, C., Podschun, R., Thaller, G., Laugier,
C., Leippe, M. & Grotzinger, J. (2009a). Antimicrobial properties of the equine alpha-
defensin DEFA1 against bacterial horse pathogens. Vet Immunol Immunopathol, 130,
102-6.
Bruhn, O., Grotzinger, J., Cascorbi, I. & Jung, S. (2011). Antimicrobial peptides and proteins
of the horse - insights into a well-armed organism. Vet Res, 42, 98.
Bruhn, O., Paul, S., Tetens, J. & Thaller, G. (2009b). The repertoire of equine intestinal alpha-
defensins. BMC Genomics, 10, 631.
Bruhn, O., Regenhard, P., Michalek, M., Paul, S., Gelhaus, C., Jung, S., Thaller, G.,
Podschun, R., Leippe, M., Grotzinger, J. & Kalm, E. (2007). A novel horse alpha-
defensin: gene transcription, recombinant expression and characterization of the
structure and function. The Biochemical journal, 407, 267-76.
Choi, M. K., Le, M. T., Nguyen, D. T., Choi, H., Kim, W., Kim, J. H., Chun, J., Hyeon, J.,
Seo, K. & Park, C. (2012). Genome-level identification, gene expression, and
comparative analysis of porcine ss-defensin genes. BMC Genet, 13, 98.
Com, E., Bourgeon, F., Evrard, B., Ganz, T., Colleu, D., Jegou, B. & Pineau, C. (2003).
Expression of antimicrobial defensins in the male reproductive tract of rats, mice, and
humans. Biol Reprod, 68, 95-104.
Cooper, T. G. (2007). Sperm maturation in the epididymis: a new look at an old problem.
Asian J Androl, 9, 533-9.

References
59
Daher, K. A., Selsted, M. E. & Lehrer, R. I. (1986). Direct inactivation of viruses by human
granulocyte defensins. J Virol, 60, 1068-74.
Davis, E. G., Sang, Y. & Blecha, F. (2004). Equine beta-defensin-1: full-length cDNA
sequence and tissue expression. Vet Immunol Immunopathol, 99, 127-32.
Drost, M., Thomas, P. G. A., Sequin, B. & Treodsson, H. H. T. (2009). Diseases of the
reproductive system. Large Animal Internal Medicine, 1304-1306.
Dukes, A. (2009). Analysis of the economic impact of the Irish Thoroughbred Horse Industry.
Irish Thoroughbred Breeders Association.
Edwards, J. F. (2008). Pathologic conditions of the stallion reproductive tract. Anim Reprod
Sci, 107, 197-207.
Ellington, J. E., Samper, J. C., Jones, A. E., Oliver, S. A., Burnett, K. M. & Wright, R. W.
(1999). In vitro interactions of cryopreserved stallion spermatozoa and oviduct
(uterine tube) epithelial cells or their secretory products. Anim Reprod Sci, 56, 51-65.
Fahey, A. (2012). Economic Contribution of the Sport Horse Industry to the Irish Economy.
School of Agriculture and Food Science. University College Dublin, Ireland. .
Fjell, C. D., Jenssen, H., Fries, P., Aich, P., Griebel, P., Hilpert, K., Hancock, R. E. &
Cherkasov, A. (2008). Identification of novel host defense peptides and the absence of
alpha-defensins in the bovine genome. Proteins, 73, 420-30.
Flesch, F. M. & Gadella, B. M. (2000). Dynamics of the mammalian sperm plasma membrane
in the process of fertilization. Biochim Biophys Acta, 1469, 197-235.
Flesch, F. M., Wijnand, E., Van De Lest, C. H., Colenbrander, B., Van Golde, L. M. &
Gadella, B. M. (2001). Capacitation dependent activation of tyrosine phosphorylation
generates two sperm head plasma membrane proteins with high primary binding
affinity for the zona pellucida. Mol Reprod Dev, 60, 107-15.
Fouchecourt, S., Metayer, S., Locatelli, A., Dacheux, F. & Dacheux, J. L. (2000). Stallion
epididymal fluid proteome: qualitative and quantitative characterization; secretion and
dynamic changes of major proteins. Biol Reprod, 62, 1790-803.
Gadella, B. M., Rathi, R., Brouwers, J. F., Stout, T. A. & Colenbrander, B. (2001).
Capacitation and the acrosome reaction in equine sperm. Anim Reprod Sci, 68, 249-65.
Ganz, T. (2003). Defensins: antimicrobial peptides of innate immunity. Nature Reviews.
Immunology, 3, 710-20.
Ganz, T. (2004). Defensins: antimicrobial peptides of vertebrates. C R Biol, 327, 539-49.

References
60
Gatti, J. L., Metayer, S., Belghazi, M., Dacheux, F. & Dacheux, J. L. (2005). Identification,
proteomic profiling, and origin of ram epididymal fluid exosome-like vesicles. Biol
Reprod, 72, 1452-65.
Giesecke, K., Sieme, H. & Distl, O. (2010). Infertility and candidate gene markers for fertility
in stallions: a review. Vet J, 185, 265-71.
Gupta, G. (2005). Proteomics of Spermatogenesis. Sperm maturation in the epididymis,
Springer.
Hall, T. A. (1999). BioEdit. Nucleic Acids Symposium, 41, 95-98.
Harty, D. (2011). Irish Sport Horse Industry. Horse Sport Ireland. Kildare, Ireland.
Hennessy, K., & Quinn, K. (2008). The future of the Irish Sport Horse Industry. University
College Dublin.
Hinrichs, K., & Loux, S. (2012). Hyperactivated Sperm Motility: Are Equine Sperm
Different? . Journal of Equine Veterinary Science, 32, 441-444.
Hoglund, J. K., Guldbrandtsen, B., Su, G., Thomsen, B. & Lund, M. S. (2009). Genome scan
detects quantitative trait loci affecting female fertility traits in Danish and Swedish
Holstein cattle. J Dairy Sci, 92, 2136-43.
Huang, W., Kirkpatrick, B. W., Rosa, G. J. & Khatib, H. (2010). A genome-wide association
study using selective DNA pooling identifies candidate markers for fertility in
Holstein cattle. Anim Genet, 41, 570-8.
Hunter, R. H. (1981). Sperm transport and reservoirs in the pig oviduct in relation to the time
of ovulation. J Reprod Fertil, 63, 109-17.
Jelinsky, S. A., Turner, T. T., Bang, H. J., Finger, J. N., Solarz, M. K., Wilson, E., Brown, E.
L., Kopf, G. S. & Johnston, D. S. (2007). The rat epididymal transcriptome:
comparison of segmental gene expression in the rat and mouse epididymides. Biology
of Reproduction, 76, 561-70.
Johnson, L., Blanchard, T. L., Varner, D. D. & Scrutchfield, W. L. (1997). Factors affecting
spermatogenesis in the stallion. Theriogenology, 48, 1199-216.
Johnson, L., Thompson, D. L., Jr. & Varner, D. D. (2008). Role of Sertoli cell number and
function on regulation of spermatogenesis. Anim Reprod Sci, 105, 23-51.
Julenius, K., Molgaard, A., Gupta, R. & Brunak, S. (2005). Prediction, conservation analysis,
and structural characterization of mammalian mucin-type O-glycosylation sites.
Glycobiology, 15, 153-64.

References
61
Krawetz, S. A. (2005). Paternal contribution: new insights and future challenges. Nat Rev
Genet, 6, 633-42.
Kyte, J. & Doolittle, R. F. (1982). A simple method for displaying the hydropathic character
of a protein. J Mol Biol, 157, 105-32.
Leblanc, M. M. (2010). Advances in the diagnosis and treatment of chronic infectious and
post-mating-induced endometritis in the mare. Reprod Domest Anim, 45 Suppl 2, 21-
7.
Liu, H., Yu, H., Gu, Y., Xin, A., Zhang, Y., Diao, H. & Lin, D. (2013). Human beta-defensin
DEFB126 is capable of inhibiting LPS-mediated inflammation. Appl Microbiol
Biotechnol, 97, 3395-408.
Maischberger, E., Irwin, J., Carrington, S. & Duggan, V. (2008). Equine post-breeding
endometritis: A review. Ir Vet J, 61, 163-8.
Melia, G., Narciandi, F., Lloyd, A., & O’farrelly, C. (2013). A novel defensin cluster in
Equus caballus and other mammals.: Trinity College Dublin
Meyers, S. (1996). New methods for diagnosing subfertility in stallions. Journal of Equine
Veterinary Science, 16, 103-105.
Narciandi, F., Lloyd, A., Meade, K. G. & O'farrelly, C. (2013). A novel subclass of bovine ?-
defensins links reproduction and immunology. Reprod Fertil Dev.
Narciandi, F., Lloyd, A. T., Chapwanya, A., C, O. F. & Meade, K. G. (2011). Reproductive
tissue-specific expression profiling and genetic variation across a 19 gene bovine beta-
defensin cluster. Immunogenetics, 63, 641-51.
Neild, D. N., Gadella, B. M., Aguero, A., Stout, T. A. & Colenbrander, B. (2005).
Capacitation, acrosome function and chromatin structure in stallion sperm. Anim
Reprod Sci, 89, 47-56.
Peddinti, D., Nanduri, B., Kaya, A., Feugang, J. M., Burgess, S. C. & Memili, E. (2008).
Comprehensive proteomic analysis of bovine spermatozoa of varying fertility rates
and identification of biomarkers associated with fertility. BMC Syst Biol, 2, 19.
Quayle, A. J., Porter, E. M., Nussbaum, A. A., Wang, Y. M., Brabec, C., Yip, K. P. & Mok,
S. C. (1998). Gene expression, immunolocalization, and secretion of human defensin-
5 in human female reproductive tract. Am J Pathol, 152, 1247-58.

References
62
Sahana, G., Guldbrandtsen, B., Bendixen, C. & Lund, M. S. (2010). Genome-wide association
mapping for female fertility traits in Danish and Swedish Holstein cattle. Anim Genet,
41, 579-88.
Schneider, J. J., Unholzer, A., Schaller, M., Schafer-Korting, M. & Korting, H. C. (2005).
Human defensins. J Mol Med (Berl), 83, 587-95.
Schöniger, S., Gräfe, H. & Schoon, H. A. (2013). Expression of β-defensin in the equine
endometrium. Reproductive Biology, 13, Supplement 2, 47.
Semple, C. A., Rolfe, M. & Dorin, J. R. (2003). Duplication and selection in the evolution of
primate beta-defensin genes. Genome Biol, 4, R31.
Sorensen, O. E., Gram, L., Johnsen, A. H., Andersson, E., Bangsboll, S., Tjabringa, G. S.,
Hiemstra, P. S., Malm, J., Egesten, A. & Borregaard, N. (2003). Processing of seminal
plasma hCAP-18 to ALL-38 by gastricsin: a novel mechanism of generating
antimicrobial peptides in vagina. J Biol Chem, 278, 28540-6.
Taylor, U., Rath, D., Zerbe, H. & Schuberth, H. J. (2008). Interaction of intact porcine
spermatozoa with epithelial cells and neutrophilic granulocytes during uterine passage.
Reprod Domest Anim, 43, 166-75.
Thomas, P. G., Ball, B. A. & Brinsko, S. P. (1994). Interaction of equine spermatozoa with
oviduct epithelial cell explants is affected by estrous cycle and anatomic origin of
explant. Biol Reprod, 51, 222-8.
Tollner, T. L., Vandevoort, C. A., Yudin, A. I., Treece, C. A., Overstreet, J. W. & Cherr, G.
N. (2009). Release of DEFB126 from macaque sperm and completion of capacitation
are triggered by conditions that simulate periovulatory oviductal fluid. Mol Reprod
Dev, 76, 431-43.
Tollner, T. L., Venners, S. A., Hollox, E. J., Yudin, A. I., Liu, X., Tang, G., Xing, H., Kays,
R. J., Lau, T., Overstreet, J. W., Xu, X., Bevins, C. L. & Cherr, G. N. (2011a). A
Common Mutation in the Defensin DEFB126 Causes Impaired Sperm Function and
Subfertility. Science Translational Medicine, 3, 92ra65.
Tollner, T. L., Venners, S. A., Hollox, E. J., Yudin, A. I., Liu, X., Tang, G., Xing, H., Kays,
R. J., Lau, T., Overstreet, J. W., Xu, X., Bevins, C. L. & Cherr, G. N. (2011b). A
common mutation in the defensin DEFB126 causes impaired sperm function and
subfertility. Sci Transl Med, 3, 92ra65.

Comparative Genomic Identification and Characterisation of A Novel B-Defensin Gene Cluster in the Equine Genome

Comparative Genomic Identification and Characterisation of A Novel B-Defensin Gene Cluster in the Equine Genome

Recommended

Recommended

More Related Content

What's hot

What's hot (20)

Similar to Comparative Genomic Identification and Characterisation of A Novel B-Defensin Gene Cluster in the Equine Genome

Similar to Comparative Genomic Identification and Characterisation of A Novel B-Defensin Gene Cluster in the Equine Genome (20)

Comparative Genomic Identification and Characterisation of A Novel B-Defensin Gene Cluster in the Equine Genome