Gorripati2021

J Basic Microbiol. 2021;61:315–329. www.jbm-journal.com © 2021 Wiley‐VCH GmbH | 315
Received: 29 December 2020 | Revised: 21 January 2021 | Accepted: 2 February 2021
DOI: 10.1002/jobm.202000725
R E S E A R C H P A P E R
Overexpression of the ascorbate peroxidase through
enhancer‐trappedpSB111barvectorforalleviatingdrought
stress in rice
Srinivas Gorripati1
| Rajasekhar Konka2
| Shravana Kumar Panditi1,3
|
Kavitha Velagapudi1,4
| Naveena Lavanya Latha Jeevigunta1
1
Department of Biotechnology, Krishna
University, Machilipatnam,
Andhra Pradesh, India
2
Department of Biochemistry, Chaitanya
Postgraduate College, Waranagal,
Telangana, India
3
Department of Zoology, Vikrama
Simhapuri University, Nellore,
4
Department of Biotechnology, Andhra
Loyola College, Vijayawada,
Correspondence
Naveena Lavanya Latha Jeevigunta,
Department of Biotechnology,
Krishna University, Machilipatnam,
Andhra Pradesh 521003, India.
Email: jnlavanyalatha@yahoo.co.in
Abstract
Rice (Oryza sativa L.) plant growth and productivity is adversely affected by
various stress factors. Overexpression of drought tolerance‐related genes is one
of the best approaches for developing drought‐resistant transgenics.
Agrobacterium tumefaciens has been widely used in generating transgenic
plants through plasmid vector to obtain desired characteristics and to know
the specific expression profiles of genes in the plant. The enhancer trap
method was developed to know the specific expression of genes at different
stages of growth by entrapping the genes of an organism. In the present study,
we designed a vector molecule with a feature of promoting the expression of a
specific gene more than four times than its normal expression and it is useful
for efficient transformation to higher plants by utilizing the trans configura-
tion of vir genes of the plasmid A. tumefaciens, to transfer right and left
sequence bordered of transferred DNA (T‐DNA) into the nuclear genome of
plants. We developed a binary vector consisting of 1.8‐kb green fluorescent
protein (GFP) cassette as a reporter gene and 1.4‐kb tetramer of CaMv35S
enhancer (4XEn) were cloned at HindIII site of pSB11 bar intermediate vector
to tag and know the genes and their expression profiles, then mobilized into
A. tumefaciens to produce a super‐binary vector pSB111‐bar‐4XEn‐GFP. The
resultant construct was confirmed by polymerase chain reaction and restric-
tion digestion methods. Finally, we discuss the role of overexpressed ascorbate
peroxidase in drought stress.
K E Y W O R D S
4X CaMV35S enhancer, Agrobacterium tumefaciens, antioxidant, ascorbate peroxidase,
enhancer trapping, GFP cassette, Oryza sativa L, pSB11 bar vector, stress
1 | INTRODUCTION
Rice is the principal food crop for more than half of the
world's population. Rice, as a staple food, supports more
than three billion people and comprises 50%–80% of their
daily calorie intake [1]. Adverse environmental factors
such as excessive cold, heat, drought, and salinity stresses
result in a considerable yield loss of crop plants all over
the world. Plant adaptations to environmental stresses
depend on the activation of cascades of molecular

networks involved in signal transduction, stress percep-
tion, and expressions of stress‐related genes. These
abiotic stresses elicit complex cellular responses in the
plant system, resulting in the production of excessive
reactive oxygen species (ROS) such as hydrogen peroxide
(H2O2), hydroxyperoxyl (HO2·), superoxide (O2
−
), and
singlet oxygen (1
O2) radicals. To protect themselves from
adverse conditions, plants have evolved a number of
cellular defense mechanisms including antioxidants such
as ascorbate, glutathione, and tocopherols as well as
ROS‐detoxifying enzymes such as superoxide dismutases
(SODs), peroxidases, and catalases (CATs) [2,3].
Transgenic engineering approaches in plants have
opened the door for the development of new cultivars with
improved drought tolerance [4]. The advancement in the
genetic engineering technology leads to the transformation
of required genes with suitable vectors for the development
of various transgenic plants viz., BT cotton, Golden Rice,
etc. The basic advantage of the production of transgenic
lines is to study the expression of genes at various stages of
growth of organisms, identification of genes, and promote
specific characters in the host organism which is beneficial
for agronomic traits or for human welfare.
Genome sequencing of various organisms, different
types of gene trap methods were developed like enhancer
trap, promoter trap, poly A trap etc. Campisi et al. [5]
generated more than 11,000 enhancer trap lines in
Arabidopsis by an enhancer trap vector pD991 to char-
acterize the genes responsible for inflorescence and also
isolated genes involved in the early stages of flower de-
velopment. The hypothesis of the present study is to in-
troduce the 4X enhancer into rice genome by transferred
DNA (T‐DNA) insertion and to activate the genes in the
rice genome four times its normal expression. This high
expression results in the change of phenotypic expression
of a rice plant depending upon where the 4X enhancer is
tagged into the genome, which can be an advantage to
the crop in enhancing the yield of the crop as well as
beneficial for the rice to tolerate the various abiotic stress
caused by environmental factors.
Hence, in the present report, we aimed to develop a
binary vector that enhances the expression of neighbor-
ing genes and to find out the gene expression profiles of
genes by 4XCaMV enhancer. The 4X CaMV35S enhancer
and green fluorescent protein (GFP) reporter gene are
cloned into a unique restriction site of pSB11 bar vector
by HindIII digestion and replicate this plasmid in
Escherichia coli DH5α cells and the plasmids were
transformed into Agrobacterium by triparental mating.
Second, we report the identification and characterization
of novel ascorbate peroxidase in one of the identified
drought‐tolerant overexpression line that has been
shown to impart drought tolerance in rice.
2 | MATERIALS AND METHODS
2.1 | Preparation of pSB11 bar vector
wThe super‐binary vector pSB11 used for plant transfor-
mation contains 6323 bp having spectinomycin‐resistant
gene (Figure 1). The 1.4‐kb fragment of 4X CaMV35S
(4XEn) was excised from AcREH construct [6] by HindIII
digestion and 1.8‐kb GFP cassette such as CaMV35S‐
GFP‐NOS is released from pPUR vector by SacI digestion.
Both the fragments are ligated by using T4 DNA ligase at
16°C for overnight incubation to generate a 3.2‐kb DNA
fragment; pSB11 bar vector was linearized with HindIII
digestion. The 3.2‐kb DNA fragment (CaMV35S‐GFP‐
NOS‐4XCaMV35S) was ligated with linearized pSB11 bar
vector by the enzyme T4 DNA ligase at 16°C overnight to
generate recombinant pSB11 bar vector.
2.2 | Transformation
Dh5α cells are used for amplifying and maintaining the
recombinant pSB11 bar vector harboring CaMV35S‐
GFP‐NOS‐4X enhancer by using the calcium phosphate
transformation method [7]. Transformed cells were
screened by using spectinomycin antibiotic (50 mg·L−1
).
2.3 | Confirmation of vector map
The plasmid was isolated from the transformed DH5α
cells by alkaline‐lysis method to confirm the presence of
GFP, bar gene, and 4X enhancer by polymerase chain
reaction (PCR) using different primers by using PCR
technique. The PCR was performed to extract plasmid
DNA by using primers for enhancer, GFP, NOS, and BAR
genes; here, we have used a different strategy to make
five different reaction mixtures. The first reaction con-
tains both forward and reverse primers for enhancer
(Table 1); in the second reaction, both forward and re-
verse primers for GFP was used; in the third reaction,
GFP forward and NOS reverse primers were used; in the
fourth reaction, Bar forward reverse primers were used;
and for the last reaction, Bar forward and NOS reverse
primers were used and the final products were run on
1% agarose gel and electrophoresed [8].
2.4 | Preparation of Agrobacterium
strain and confirmation of vector map
Recombinant pSB11 bar vector was mobilized into
Agrobacterium strain EHA105 through triparental
316 | GORRIPATI ET AL.

mating by using pRK helper plasmid. Transformed
EHA105 cells are identified by using tetracycline
10 mg·L−1
, rifampicin 10 mg·L−1
, and spectinomycin
50 mg·L−1
in yeast extract peptone (YEP) medium.
From the selected colonies, the plasmid was isolated by
alkaline digestion method and subjected to restriction
digestion with HindIII, SacI, and XhoI restriction en-
zymes. The resultant products were electrophoresed by
using 1% agarose gel electrophoresis to confirm the re-
striction map T‐DNA construct.
2.5 | Plasmid construction and
transformation into rice seeds
The 4X enhancer along with GFP cassette was cloned
in the intermediate vector pSB11 bar (Figure 1). The
binary vector contains bar (CaMV35S‐bar‐nos) gene as
a plant selectable marker. The recombinant vector,
pSB11‐bar‐4X enhancer‐CaMV35S‐GFP‐nos is mobi-
lized into Agrobacterium tumefaciens strain EHA105
through the triparental method. Seeds of the indica
rice cultivar, Samba Mahsuri (BPT5204) were used for
genetic transformation experiments. Calli derived from
the scutellum of mature embryos were infected with
the Agrobacterium harboring GFP cassette‐4X
enhancer and bar cassette. Putatively transformed
calli were selected on the Murashige and Skoog (MS)
[9] medium containing 5.0–6.0 mg·L−1
phosphino-
thricin (PPT). Later, the actively growing calli were
transferred onto the regeneration medium containing
BAP (4 mg·L−1
) and NAA (0.1–0.5 mg·L−1
) [10].
Regenerated shoots were transferred onto the MS
rooting medium, and rooted plants were transferred to
the pots and grown to maturity in the glasshouse.
FIGURE 1 pSB II vector having 6323 bp and showing its restriction sites such as HindIII, XhoI, SacI, EcoRI, SalI
TABLE 1 Shows both forward and reverse primers for
enhancer, GFP, BAR, and NOS genes
Enhancer forward 5ʹ‐CAAAGGGTAATATCGGGAAACC‐3ʹ
Enhancer reverse 5ʹ‐TCACATCAATCCACTTGCTT‐3ʹ
GFP forward 5ʹ‐TGGTGTTCAATGCTTTTCAA‐3ʹ
GFP reverse 5ʹ‐CAGGTAATGGTTGTCTGGTA‐3ʹ
Bar forward 5ʹ‐AACGACGCCCGGCCGACA‐3ʹ
BAR reverse 5ʹ‐GGTGACGGGCAGGACCGGAC‐3ʹ
NOS reverse 5ʹ‐ACATAGATGACACCGCGCGC‐3ʹ
GORRIPATI ET AL. | 317

Putative transgenic plants along with control plants
were tested for their tolerance to the herbicide Basta as
described [11]. PCR analysis was carried out using the
primers corresponding to the expression cassettes
(Table 2). DNA from the untransformed control plants
was used as a negative control and the plasmid was
used as a positive control [12].
2.6 | Southern blot analysis of
transgenic plants
For Southern blot analysis, about 15–20 µg of genomic
DNA was digested overnight with HindIII and was
resolved on 1% agarose gel. After denaturation and
neutralization steps, the DNA was transferred onto a
Hybond‐N membrane (Amersham Pharmacia), and
then cross‐linking was done by exposing it to UV
(1200 lJ for 60 s) as described by Sambrook et al [7].
The membranes were hybridized with the bar‐coding
regions as probes and later exposed to X‐ray film. DNA
probe preparation, hybridization, and membrane
washing were performed according to the manu-
facturer's instructions (AlkPhos Direct Labeling
System, Cat. No. RPN3680; GE Healthcare).
2.7 | Thermal asymmetric interlaced
polymerase chain reaction (TAIL‐PCR)
Genomic DNA of transgenic rice plants was used for
TAIL‐PCR analysis. Arbitrary primers (AD1, AD2, and
AD3) and bar primers (bar1, bar2, and bar3) were em-
ployed to determine the integration site of T‐DNA in the
genomic DNA of transgenic rice plants. Three rounds of
TAIL‐PCR were performed using bar1, bar2, and bar3
along with AD1 primers. The final TAIL‐PCR product is
excised from the gel and DNA is eluted from it. Purified
DNA is then utilized for sequence analysis. The genes
that flank upto 10 kb upstream and downstream of the
integration site were analyzed for overexpression studies.
2.8 | Quantitative real‐time polymerase
chain reaction (qRT‐PCR) analysis for
selection of homozygous transgenic lines
The total RNAs were isolated from the control and trans-
genic plant leaves by TRIzol reagent, and the first‐strand
synthesis of the complementary DNAs was carried out by
Prime Script™ RT Reagent Kit with DNA eraser (Takara)
according to the manufacturer's instructions. Primers for
ascorbate peroxidase were designed using Primer 5.0
(Premier Biosoft International), and the primers used in the
qRT‐PCR analysis are listed in Table 2. The reference gene
actin was selected for use based on previous research.
qRT‐PCR was carried out using an SYBR Green Master
ROX (Roche). Samples were technically duplicated and all
experiments were performed with three biological re-
plicates. The thermal cycle used was as follows: 95°C for
10 min; 40 cycles of 95°C for 15 s, 58°C for 10 s, and 72°C
for 15 s. The relative expression levels of the selected genes,
normalized to the reference gene, were calculated using the
∆
2 C
− t method [13]. Homozygous transgenic rice lines car-
rying bar cassette‐4X enhancer‐GFP cassette were identified
by germinating selfed seed collected from T1 progenies on
MS basal medium containing PPT (4 mg·L−1
).
2.9 | Physiological parameters of
overexpressed rice cell line for drought
stress treatment
2.9.1 | Effect of drought stress at seed
germination and seedling stage
Seeds were surface sterilized with 70% (v/v) ethanol for
1 min followed by 0.1% (w/v) mercuric chloride (HgCl2)
TABLE 2 Primers used for selected genes
Gene name Primer sequence (5ʹ→3ʹ)
GFP‐F CAAGACACGTGCTGAAGTCAA
GFP‐R CAAGACACGTGCTGAAGTCAAA
bar‐F GCACCATCGTCAACCACTAC
bar‐R GACTTCAGCCTGCCGGTT
Nos R AACAAAATATAGCGCGCAAAC
4X enhancer‐R TCACATCAATCCACTTGCTT
4X enhancer‐F CAAAGGGTAATATCGGGAAACC
Tail pcr bar1 ACGCCCGGCCGACATCCGCC
Tail pcr bar2 ACCTCGTCCGTCTGCGGGAG
Tail pcr bar3 CCAGCGGACGGGACTGGGCT
Tail AD‐1 NGTCGASWGANAWGAA
Tail AD‐2 TGWGNAGSANCASAGA
Tail AD‐3 AGWGNAGWANCAWAGG
Actin‐F GAGTATGATGAGTCGGGTCAG
Actin‐R ACACCAACAATCTCAAACAGAG
Acp‐F ATCAGCTTGCTGGAGTGGTT
Acp‐R AAATCAGATGGTTCAACGGC

for 4 min followed by three washes with sterile water.
Sterilized seeds were blot‐dried on sterile filter papers
and inoculated on MS basal medium supplemented with
mannitol (200 mM) for drought stress response; after
10 days, seed germination rates were recorded. For stress
treatment at the seedlings stage, seeds were grown in
Hoagland solution at 30°C for 2 weeks and were treated
with mannitol (200 mM) for 7 days. After 7 days of
recovery, data on biomass, shoot length, root length, and
survival rate of seedlings were recorded.
2.9.2 | Effect of drought stress at the
reproductive stage
Plants were grown in pots under normal conditions until
the inflorescence meristem started to appear. Drought
(withholding water) stress treatment was applied at the
reproductive stage for 10 days at 30°C. After treatments,
plants were transferred to normal conditions. Data on the
number of filled grains per panicle were recorded. In
each treatment, five plants were used and all the ex-
periments were repeated three times.
2.10 | Abiotic stress tolerance assay
Fifteen‐day‐old over expressed (OE) transgenics along with
control plants were subjected to drought stress by germi-
nation on a medium containing mannitol (200 mM) for
3 days, and were used for assaying the enzyme activities.
We also determined the total chlorophyll content [14],
proline content [15,16], reducing sugars [17], SOD activity
[18], CAT activity [19], malondialdehyde (MDA) [20], and
relative water content (RWC) measurement [21].
2.10.1 | Total chlorophyll content
Total chlorophyll content was estimated and calculated
according to Lichtenthaler and Wellburn. Twenty‐five
milligrams of fresh leaf sample (200 mM mannitol‐
treated) were incubated in 10 ml of 80% acetone and kept
in the dark for 48 h. The absorbance was measured at 663
and 647 nm for chl a and chl b, respectively [14].
2.10.2 | Estimation of proline content
The proline estimation was carried according to Bates
et al. [15] One gram of fresh leaf material was ground
with 20 ml of 3% sulfosalicylic acid (w/v) and the
homogenate was centrifuged at 10,000 rpm for 10 min.
The supernatant was used for the estimation of free
proline. The reaction mixture comprised 2.0 ml of glacial
acetic acid, 2.0 ml ninhydrin reagent, and 2.0 ml of su-
pernatant. The whole reaction mixture was boiled for 1 h
at 110°C. After cooling the liquid to room temperature,
4 ml of toluene was added and mixed vigorously for 30 s
on a cyclomixer. The chromophore (toluene) aspirated
from the aqueous phase was taken and its absorbance
was measured at 520 nm. Proline concentration in the
samples was determined from the standard curve and
expressed in terms of microgram proline per one gram
fresh weight [15,16].
2.10.3 | Estimation of reducing sugars
Leaf tissues of 100 mg were collected from the transgenic
and control plants, and were frozen with liquid nitrogen
and ground to powder. Reducing sugars were extracted
from the powder twice with 80% ethanol at 95°C. The
supernatant collected was bulked and was reduced by
dryness at 80°C for 2 h. The residue was dissolved in
10 ml of distilled water. The reducing sugar contents
were estimated according to Miller [17].
2.10.4 | Extraction and estimation of
antioxidant enzymes
The extraction procedure for SOD and CAT was similar.
Freshly weighed (100 mg) leaf samples were frozen in
liquid nitrogen to prevent proteolytic activity. The frozen
tissues were ground using 5 ml of extraction buffer con-
taining 100 mM phosphate buffer (pH 7.5) and 0.5 mM
EDTA. The extract was centrifuged for 15 min at
12,000 rpm at 4°C and the supernatant was used in the
enzyme analyses.
2.10.5 | SOD activity
The SOD activity was assayed by monitoring the inhibi-
tion of photochemical reduction of nitroblue tetrazolium
(NBT). The enzyme activity was estimated by adding
100 μl of enzyme extract to 3 ml of reaction mixture
containing 50 mM potassium phosphate buffer (pH 7.8),
13 mM methionine, 75 μM NBT, 2 μM riboflavin, and
0.1 mM EDTA. The reaction mixture was illuminated at a
light intensity of 5000 lx for 15 min. The absorbance of
samples was measured at 560 nm using a spectro-
photometer. One unit of SOD activity was defined as the
amount of enzyme required to cause 50% inhibition of
the reduction of NBT [18].

2.10.6 | CAT activity
Leaf samples collected from the stressed plants were
homogenized in 50 mM phosphate buffer (pH 7.0). The
homogenate was centrifuged at 8000g for 20 min at 4°C.
Enzyme extract was added to hydrogen peroxide–phosphate
buffer (pH 7.0), and the time required for the decrease in the
absorbance at 240 nm from 0.45 to 0.40 was noted. Enzyme
solution containing hydrogen peroxide‐free phosphate buf-
fer was used as control. CAT activity was determined ac-
cording to Shin et al. [19]. The protein estimation was done
using the Bradford reagent [20].
2.10.7 | MDA content
Leaf tissues were homogenized in 5 ml of 0.1%
trichloroacetic acid (TCA). The homogenate was
centrifuged at 5000g for 10 min. The supernatant was
collected and 500 µl of it was added to 4 ml of 20% TCA
containing thiobarbituric acid (0.5%). The mixture was
heated at 95°C for 30 min, quickly cooled on ice, cen-
trifuged at 5000g for 15 min, and the absorbance of the
supernatant was read at 532 and 600 nm. After sub-
tracting the nonspecific absorbance at 600 nm, MDA
concentration was calculated using an extinction coeffi-
cient of 155 mM−1
·cm−1
[21].
2.10.8 | RWC measurement
RWCs of the 2‐week‐old transgenic plants and the con-
trol plants were measured [22]. Fresh weight loss was
calculated relative to the initial plant weight. Plants were
weighed and left at room temperature until there was no
further loss in weight (desiccated weight). Later, plants
were dried for 24 h at 70°C and dry weights were re-
corded. The RWC of the samples was measured using the
formula:
‐2ΔCt
2.11 | Statistical analysis
All the recorded data were analyzed using Student's t test
for statistical significance. **p < .01 and *p < .05
represent significant differences at 1% and 5% level,
respectively, compared with the wild‐type control.
Note that, unless indicated, all the experiments were
repeated 3–5 times and representative data are shown.
A variation <15% was observed between separate
experiments.
3 | RESULTS
The vector plays a crucial role in the production of
transgenic lines either by creating new characteristics or
by revealing the characters or functions of the unknown
gene. Enhancer trapping is the best tool for gene iden-
tification. Here, we have developed a vector by cloning a
1.4‐kb fragment containing tetramer of CaMv35S (4X En)
enhancer and 1.8‐kb GFP cassette into the pSb11 bar
vector at HindIII site of pSB11‐bar vector. The vector was
mobilized into E. coli DH5α cells through calcium
phosphate‐mediated transformation method for the am-
plification of plasmid vector. After transformation into
DH5 α cells, the presence of the gene containing vector
was confirmed by PCR analysis followed by plasmid
isolation. In PCR, different primers were used to amplify
vector components such as 4X enhancer, Bar gene, Gfp
gene, Gfp gene along with NOS gene, and Bar gene along
with NOS gene. From Figure 1 it was confirmed that the
pSB11 bar plasmid vector was transformed into the E. coli
DH5α cells.
The recombinant clone harboring different expres-
sion units of T‐DNA construct was then transformed into
the Agrobacterium EHA105 cells by triparental mating
and the resultant super‐binary vector is named
pSB111‐Bar‐4XEn‐GFP. The transformed Agrobacterium
colonies are selected against by using antibiotics on YEP
medium. Figure 2 shows the recombinant Agrobacterium
colonies on YEP medium. Transformed EHA105 cells are
identified by using tetracycline 10 mg·L−1
, rifampicin
10 mg·L−1
, and spectinomycin 50 mg·L−1
in YEP med-
ium. The transformed cells which were selected against
antibiotic resistance genes were picked up for plasmid
isolation by the alkaline lysis method. The obtained
plasmid was subjected to restriction digestion by en-
zymes such as SacI, HindIII, and XhoI. The SacI enzyme
FIGURE 2 Transformed colonies of Agrobacterium EHA105
cells. The bacterium contains transferred DNA (T‐DNA) construct
pSB111‐Bar‐4XEn‐GFP vector

digests the pSB111‐bar‐4XEn‐GFP plasmid and produces
1.8‐kb fragment of GFP cassette. The enzyme HindIII
cleaves the 1.4‐kb fragment of 4XEn of the plasmid
pSB111‐bar‐4XEn‐GFP (Figure 3). XhoI enzyme cleaves
pSB111‐bar‐4XEn‐GFP at bar gene which is approxi-
mately 560 bp in size. By the above digestion methods,
we confirmed the restriction map of T‐DNA construct of
pSB111‐Bar‐4XE‐GFP plasmid. Figure 4 represents the
restriction map of pSB111‐Bar‐4XEn‐GPF plasmid.
3.1 | Cloning of enhancer gene for plant
expression cassette
The 4X CaMV35S enhancer was released as a 1.4‐kb HindIII
fragment from the AcREH construct [6]. CaMV35S‐
GFP‐nos was released as 1.8‐kb HindIII fragment from
pPUR vector. Two ligation reactions were performed for
introducing GFP and 4X enhancer into pSB11‐bar vector.
Both 4X enhancer and GFP cassette were ligated at 16°C
overnight. The ligation mixture was gel electrophoresed and
a 3.2‐kb gel band was excised and purified from the gel.
pSB11‐bar vector was linearized with HindIII restriction
enzyme. A 3.2‐kb DNA fragment (CaMV35S‐GFP‐nos‐4X
enhancer) was ligated with linearized pSB11‐bar vector at
16°C overnight. Recombinant pSB11‐bar vector harboring
CaMV35S‐GFP‐nos‐4X enhancer was transferred into DH5α
cells using calcium phosphate‐mediated gene transfer and
confirmed with XhoI digestion 560 bp representing the bar
gene (Figure 5). Transformed cells were screened using
50 mg·L−1
spectinomycin. Recombinant pSB11‐bar vector
was mobilized into Agrobacterium strain EHA105 through
triparental mating. Transformed EHA105 cells were identi-
fied by using tetracycline 10 mg·L−1
, rifampicin 10 mg·L−1
,
and spectinomycin 50 mg·L−1
in YEP medium.
3.2 | Genetic transformation and
production of transgenic rice plants
Transgenic rice plants of Samba Mahsuri were regenerated
from PPT‐resistant calli obtained after cocultivation with
the Agrobacterium strain EHA105 harboring the super‐
binary vector carrying 4X enhancer and bar genes
(Figure 6). Eight selected calli were obtained from 1063 calli
infected with the above construct and three were positive
for GFP (Figure 7). Three transgenic lines were selected for
further analyses based on GFP fluorescence and their
high‐level tolerance to herbicide (0.25%) Basta.
3.3 | Molecular analysis of T0 transgenic
plants
DNA was isolated from transgenic plants along with
control using the cetyltrimethylammonium bromide
method. PCR analysis of these transformants revealed
the presence of ~650 bp and four variable size fragments,
corresponding to the bar‐nos and 4X enhancer regions,
respectively. Southern blot analysis was carried out using
Basta‐positive and GFP‐positive plants (Figures 7 and 8).
FIGURE 3 Lane M: 1‐kb ladder; lane 1: digestion with XhoI
(560 bp) indicates Bar gene; lane 2: digestion with HindIII (1.4 kb)
indicates 4XEn; lane 3: digestion with SacI (1.8 kb) indicates green
fluorescent protein cassette
FIGURE 4 Transferred DNA (T‐DNA) construct harboring
different expression units (named as pSB111‐Bar‐4XEn‐GFP vector)
showing the restriction map of HindIII, SacI, and XhoI restriction
enzymes
FIGURE 5 Restriction analysis: 4X enhancer with green
fluorescent protein (GFP) clone: lane M: 1‐kB ladder; lane 1:
digestion with XhoI presence of bar gene; lane 2: digestion with
HindIII; lane 3: digestion with SacI/HindIII

DNA of transgenic and control plants was digested with
HindIII and probed with gene‐coding sequence, and it
showed a hybrid band of ~1.4 kb. The band corresponds
to the expression units of enhancer elements introduced
into the transgenic rice plants. Conversely, the un-
transformed control plants failed to show any hybrid
band with this probe.
3.4 | TAIL‐PCR analysis
TAIL is a series of reactions that are intended to map
where a T‐DNA has integrated within the genome. The
main components of the three reactions are the arbitrary
degenerate (AD) primers, border primers, and DNA from
the T‐DNA lines that are to be mapped. Each 25 μl pri-
mary TAIL‐PCR contained 2.5 μl PCR buffer, 200 μM
each of dNTPs, 0.3 μM AC1, and RB‐1a (or RB‐1b), 0.6 U
Ex Taq, and 1 μl 40‐fold diluted pre‐amplified product.
Each secondary 25 μl TAIL‐PCRs contained 2.5 μl PCR
buffer, 200 μM each of dNTPs, 0.3 μM AC1 and RB‐2a (or
RB‐2b), 0.5 U Ex Taq, and 1 μl 10‐fold diluted primary
TAIL‐PCR product (Figure 9).
3.5 | Sequencing
A total of three different transgenic lines were generated
and their site of integration was determined using the
TAIL‐PCR protocol according to Tsugeki et al. [23]
The different sequences obtained were compared
with public databases for similarity to known genomic
sequences. For each line, the TAIL‐PCR sequence is
presented along with the best BLAST hit to the rice
genome assembly to visualize the location of insertion.
FIGURE 6 Tissue culture process using Agrobacterium‐mediated method. (a) Embryonic callus used for infection; (b) callus selection
was performed in a phosphinothricin‐containing medium; (c) selected calli showing green fluorescent protein (GFP) fluorescence; (d)
regeneration; (e) rooting medium; (f) putative transformed plants established in pots
FIGURE 7 Polymerase chain reaction (PCR) analysis: primary
transformants confirmed with PCR. Lane M: 1‐kB ladder; lane 1:
enhancer primers (forward and reverse); lane 2: green fluorescent
protein (GFP) primers (forward and reverse); lane 3: GFP (forward)
and Nos (reverse) primers; lane 4: bar primers (forward and
reverse); lane 5: bar (forward) and Nos (reverse) primers

The TAIL‐PCR product is eluted from the gel using a
standard protocol of the Sigma Gel Elution Kit. The
eluted DNA is sequenced and analyzed to identify the
site of integration of T‐DNA in the plant genome.
Sequence analysis of three different overexpression lines
OE line‐1, OE line‐2, and OE line‐3 showed the sites of
integration at LOC_Os09g36750, LOC_Os12g19350, and
LOC_Os03g23120, respectively. Locus LOC_Os09g36750
corresponds to the gene ascorbate peroxidase and we
focused on OE line‐1 for further analysis.
3.6 | Expression analysis of
stress‐responsive genes in tagged line
Reverse‐transcription polymerase chain reaction analysis
was carried out to analyze the messenger RNA expres-
sion levels of ascorbate peroxidase under stress and
unstressed conditions. Under similar stress conditions,
the expression levels of the ascorbate peroxidase gene
were found higher in the transgenic plants as compared
with the control plants (Figure 10).
3.7 | Evaluation of overexpression
transgenic rice line‐1 (ascorbate
peroxidase) for drought stress tolerance at
different developmental stages
3.7.1 | Seed germination and seedling stage
Under drought stress condition, seeds of transgenic lines
exhibited higher seed germination rates as compared
with the control seeds. Seeds of OE transgenic rice line
when germinated on mannitol (200 mM) showed higher
germination rates (88%) compared with the control
(42.66%) seeds (Figure 11a–c). Fifteen days OE transgenic
rice lines grown under stress conditions exhibited in-
creased shoot (6.64 cm) and root length (6.94 cm), and
enhanced plant biomass (96.68 mg) when compared with
the control (48.62 mg) plants (Figure 12b–d). The trans-
genic rice lines subjected to mannitol (200 mM) stress
showed a higher plant survival rate (86.66%) in com-
parison with the control plants (23.33%).
3.7.2 | Reproductive stage
To evaluate stress tolerance at the reproductive stage,
drought (water withholding) stress was imposed for
15 days on transgenic and control plants. OE transgenic rice
line showed a higher number of filled grains per panicle
FIGURE 8 Southern blot analysis for putative transgenic and
control plants. Lane P: positive control; lane UC: untransformed
control; lanes 1–3: transgenic plants
FIGURE 9 Thermal asymmetric interlaced polymerase chain
reaction (TAIL‐PCR) analysis: arbitrary primers (AD1, AD2, and
AD3) and bar primers (bar1, bar2, and bar3) were employed to
determine the integration site of transferred DNA (T‐DNA) in the
genomic DNA of three transgenic rice plants (line‐1, line‐2, and line‐3)
FIGURE 10 Analysis of expression levels of ascorbic
peroxidase gene by real‐time polymerase chain reaction under
drought stress

FIGURE 11 Evaluation of overexpressed transgenic line in drought stress: (a) OE transgenic and control seeds were germinated on
Murashige and Skoog's medium supplemented with mannitol (200 mM); (b) seed germination rate; (c) survival rate
FIGURE 12 Stress treatment at seedlings stage. (a) Seeds grown in Hoagland solution at 30°C for 2 weeks were treated with mannitol
(200 mM) for 7 days. After 7 more days of recovery, data on (b) shoot length, (c) root length, (d) biomass of seedlings were recorded

both under normal (98.66) and drought stress (78.33) when
compared with the control plants (Figure 13a–c).
3.7.3 | Chlorophyll content
Under normal conditions, no significant differences were
observed in chlorophyll contents between control and
transgenic plants. However, under stress conditions, the
chlorophyll content of control plants was significantly
lesser than that of transgenic plants. The mean chlor-
ophyll content of OE transgenic rice line (1.44 mg·g−1
fresh weight [FW]) was found to be higher under
drought stress conditions compared with the control
(0.95 mg·g−1
FW) plants (Figure 14A).
3.7.4 | Analysis of antioxidant enzyme
activity
Antioxidant enzymes such as SOD, lipid peroxidase (MDA),
and CAT are involved in scavenging ROS and protecting the
cells from oxidative damage, eventually leading to enhanced
stress tolerance. The present study clearly indicates that in
over expressed transgenic plants, the activities of antioxidant
enzymes, SOD, CAT etc were increased significantly even in
drought stress conditions compated to control. MDA con-
tent in OE transgenic plants subjected to drought stress
significantly lowers (19.7 nmol·g−1
FW) as compared with
the control (28.6 nmol·g−1
FW) plants. However, under
normal conditions, no significant differences were observed
in the MDA levels between transgenics and control plants
(Figure 14b–d).
3.7.5 | Estimation of proline and reducing
sugars
Under normal conditions, no significant differences were
observed in proline and reducing sugar levels of OE
transgenic and control plants. When 15‐day‐old OE
transgenic rice line was subjected to mannitol (200 mM)
stress, higher accumulation of proline (775.4 µg·g−1
FW) and reducing sugars (1.763 mg·g−1
FW) were ob-
served. Whereas, under similar stress conditions, control
plants showed lower levels of proline (375 µg·g−1
FW)
and reducing sugars (0.716 mg·g−1
FW; Figure 14b,c).
Similarly, transgenic plants showed higher RWC com-
pared with the control plants (Figure 14e,f).
3.7.6 | Estimation of RWC
Higher RWCs were observed in OE transgenic line
(83.2%) as compared with the control (44.8%) plant. In
normal conditions, no significant differences were ob-
served in the RWC content between transgenic and
control plants (Figure 14G).
FIGURE 13 Drought stress at the reproductive stage: Drought stress treatment was applied at the reproductive stage for 10 days at 30°C.
After treatment, plants were transferred to normal conditions. Data represented the number of filled grains per panicle. (a) OE transgenic
and control plants without stress; (b) OE transgenic and control plants drought stress; (c) OE transgenic and control plants showing a higher
number of grains. In each treatment, five plants were used and all the experiments were repeated three times

4 | DISCUSSION
Many tools were designed to exploit the function of genes
in the genome such as mutagenesis, transposons tagging,
and deletion mutagenesis, among which enhancer
trapping is most appropriate for the identification and
characterization of genes in the genome of species.
The enhancer trap vector is responsible for activating the
genes up to 7 kb away from the site of insertion. The
enhancer trap vector is the best tool for the identification
of novel genes that are nonexpressive or those genes
which are expressed in a particular period of life span or
rudimentary genes. It promotes the gain of function of
genes instead of loss of function of genes, it causes
overexpression of genes or ectopic expression of en-
dogenous genes.
In the present study, we succeeded in developing the
plasmid pSB11 Bar vector having 4XEn gene activator
and GFP selectable markers which were transformed
into the Agrobacterium EHA105 and these cells were
resistant to tetracycline, rifampicin, and spectinomycin.
The 4XEn works as an activator for genes that activates
four times more than its normal expression. The gene
expression mainly depends as to where 4XEn insertion
takes place. Many genes were known to no expression,
less expression or timely expression of specific genes
through enhancer tapping method. Many crops have
been found to face problems with various stress factors
like biotic and abiotic stress such as humidity, tempera-
ture, salt stress, and various infections caused by bac-
terial, fungal, and viruses. To effectively face these
problems, plants themselves develop resistance to the
stress by modifying the genes. Using this vector, there is a
chance to resist the stress by expressing the genes which
are effective against both biotic and abiotic stress. The
developed vector may also enhance the yield of the crops.
In summary, Agrobacterium is being used widely in
plant genetic engineering to develop transgenic plants.
This bacterium with binary plasmid pSB111 bar vector is
a suitable option for effective transformation in to plants.
Since the past decades, the Agrobacterium transformation
technique has been used to generate transgenic crops by
FIGURE 14 Abiotic stress enzyme assays 15‐day‐old transgenics along with control plants were subjected to drought stress by
germination on medium containing mannitol (200 mM) for 3 days and were used for assaying the enzyme activities, namely, (a) chlorophyll
content, (b) catalase, (c) superoxide dismutase (SOD), (d) malondialdehyde (MDA), (e) proline, (f) reducing sugars, (g) relative water
content. All the data were analyzed using Student's t test for statistical significance. **p < .01 and *p < .05 represent significant differences at
1% and 5% level, respectively, compared with the wild‐type control

efficiently transferring the genes in several agronomically
important plant species such as maize, rice, and soya-
bean johar.
Plants in nature are continuously exposed to chan-
ging environment, biotic, and abiotic stresses. In abiotic
stresses, drought stress is one of the most critical factors
of plant growth and productivity and is also considered a
severe threat to sustainable crops in changing climate.
Drought triggers a wide variety of plant responses, ran-
ging from cellular metabolism to changes in growth rates
and crop yields. Water deficiency affects differently at
different stages of rice growth. At vegetative stages, water
stress causes reduced plant height, tillering, and an
overall reduction in plant biomass significantly. The de-
ficiency at reproductive stages results in the reduction of
fertile panicle formation, percent grain filling, and
thereby a greater reduction in grain yield [24–26].
In the present study, we developed 4X enhancer co-
integrated super‐binary vector pSB111‐bar which has
been used for Agrobacterium transformation in rice. PCR
analysis of transgenics along with control showed the
presence of ~650 bp indicates the bar expression cassette
and four variable size fragments corresponding to the
bar‐nos and 4X enhancer regions, respectively. Southern
blot analysis with 4x enhancer showed a hybridized band
of ~1.4 kB corresponding to the enhancer elements,
which indicates its successful integration into rice gen-
ome. TAIL‐PCR studies were performed to identify the
site of T‐DNA integration in the rice genome using the
arbitrary and bar primers. Previous reports suggested
that one or two genes can be activated at a time by the
multiple CaMV35S enhancers in different overexpression
lines [27,28]. We analyzed the overexpression level of the
ascorbate peroxidase gene that was upregulated during
abiotic stress condition, particularly in drought stress.
For each line, the TAIL‐PCR sequence is presented along
with the best BLAST hit to the rice genome assembly to
visualize the site of insertion. RT‐PCR analysis revealed
higher levels of ascorbate peroxidase gene transcripts in
the transgenic rice plants.
The overexpression line (LOC_Os01g08790) encodes
for an enzyme ascorbate peroxidase (APX). It catalyzes
the conversion of H2O2 to H2O, employing ascorbate as
an electron donor. The expression of APX is differentially
regulated in response to environmental stresses and
during normal plant growth and development as well.
APX gene expression has been reported to increase on
exposure to drought, salt, cold, heat, pathogen infection,
wound stress, and other biotic or abiotic stresses. APX
has an important role in drought stress tolerance and
recovery of plants. APX transcripts are fairly increased
under drought in transgenic soybean and tobacco which
overexpressed P5CS gene. In the case of woody plants,
APX and other ASC‐GSH pathway enzymes were upre-
gulated after drought in Prunus spp. and declined during
the recovery phase. Glycine betaine is also reported to
increase APX during drought [29–31]. The cAPX (APX1)
overexpression also alleviates drought symptoms and the
transgenic tobacco fared better than nontransgenic
plants.
We selected the homozygous over expressed trans-
genic plants to study the tolerance capacity towards
drought stress at various stages of the plant's life cycle.
Under drought stress, transgenic overexpression line had
a higher percentage of seed germination, better root and
shoot development, more biomass compared with control
plants. Ectopic expression of Pennisetum glaucum va-
cuolar Na+
/H+
antiporter in rice resulted in higher seed
germination than wild‐type plants [32]. Transgenic OE
line showed a higher survival rate than control plants
under drought stress. These results suggested that OE
plants had improved tolerance to drought stress during
seed germination and post‐germinative growth periods.
In rice, overexpression of the stress‐related OsiSAP8
protein was found to promote increased seed germina-
tion rate and improved seedling growth under salt,
drought, and cold stresses [33].
Overexpression transgenic line exhibited more num-
ber of filled grains compared with the control plants
under drought stress conditions. Reproductive stages,
that is, flowering as well as seed development, are
especially sensitive to drought stress [34–37]. Water
deficit during the reproductive stage, especially at meio-
sis, reduced the seed set by 35%–75% in various cultivars
of bread wheat [38,39]. The transgenic plants
OsCc1:AP37 also showed significantly enhanced drought
tolerance at the reproductive stage, as evidenced by the
increase in grain yield by 16%–57% over controls under
severe field drought conditions. Higher levels of chlor-
ophyll content were observed in overexpression trans-
genic lines when subjected to drought stress than in
control plants. Chlorophyll is one of the major chlor-
oplast components for photosynthesis and relative
chlorophyll content has a positive relationship with
photosynthetic rate. The chlorophyll content was higher
in MoHrip1 and MoHrip2 rice compared with the control
rice after drought treatment [40]. During abiotic stress
condition, plants should maintain a low level of ROS to
minimize the cellular damage caused by osmotic stress.
The plant defense system possesses ROS‐detoxification
antioxidant enzymes like SOD, CAT, and guaiacol per-
oxidase (POX) for scavenging ROS and reduced oxidative
damage.
Proline is one of the essential amino acids for the
primary metabolism in plants and also maintains pH of
cytosolic redox of the cell and as an antioxidant or singlet

oxygen quencher [41,42]. Karthikeyan et al. [43] ob-
served a high accumulation of proline in drought‐
tolerant transgenic rice plants. Overexpression of P5CS
also increased stress tolerance of transgenic potato, rice,
and wheat as a result of the increased proline content.
Previous studies have found that plants may enhance
stress tolerance by accumulating osmolytes, such as so-
luble sugars and free proline to adjust the osmotic po-
tential and protect cell structures [43,44]. Our results
showed that the contents of free proline and soluble su-
gars in the transgenic lines were higher than that of
control plants under drought stress, suggesting that
overexpression lines can regulate free proline and soluble
sugar biosynthesis.
High water‐retention ability allows plants to stay
green to maintain the crop canopy and help crops endure
drought conditions [45]. The transgenic overexpression
line showed higher levels of water content presence
compared with the control plants. In the present study,
we have checked the antioxidant enzyme activities in the
overexpression line, which showed higher levels of SOD,
CAT, and lower levels of peroxidase in transgenics
compared with control under drought stress condition.
Overall, with the results from above, it is amply clear that
ascorbate peroxidase constitutes one of the most im-
portant components of the cellular antioxidant defense,
and plays a crucial role in regulating the levels of ROS in
plants when exposed to a variety of environmental
stresses. The fact that APX constitutes the first line of
defense against ROS is signified by the fact that H2O2 at
low levels is beneficial to the plant system, as it acts as a
secondary messenger in initiating cellular defense
pathways.
CONFLICT OF INTERESTS
The authors declare that there are no conflict of interests.
DATA AVAILABILITY STATEMENT
The data sets generated during and/or analyzed during
the current study are available from the corresponding
author on reasonable request.
ORCID
Naveena Lavanya Latha Jeevigunta http://orcid.org/
0000-0002-7174-9436
REFERENCES
[1] Khush GS. What it will take to feed 5.0 billion rice consumers
in 2030. Plant Mol Biol. 2005;59:1–6.
[2] Inzé D, van Montagu M. Oxidative stress in plants. Curr Opin
Biotechnol. 1995;6:153–8.
[3] Noctor G, Foyer CH. Ascorbate and glutathione: keeping active
oxygen under control. Ann Rev Plant Biol. 1998;49:249–79.
[4] Todaka D, Shinozaki K, Yamaguchi‐Shinozaki K. Recent
advances in the dissection of drought‐stress regulatory net-
works and strategies for development of drought‐tolerant
transgenic rice plants. Front Plant Sci. 2015;6:84.
[5] Campisi L, Yang Y, Yi Y, Heilig E, Herman B, Cassista AJ,
et al. Generation of enhancer trap lines in Arabidopsis and
characterization of expression patterns in the inflorescence.
Plant J. 1999;17:699–707.
[6] Suzuki Y, Uemura S, Saito Y, Murofushi N, Schmitz G,
Theres K, et al. A 488 novel transposon tagging element
for obtaining gain‐of‐function mutants based on a 489
self‐stabilizing Ac derivative. Plant Mol Biol. 2001;45:
123–31.
[7] Sambrook J, Fritsch EM, Maniatis T. Molecular cloning: a
laboratory manual. 2nd ed. Cold Spring Harbor, NY: Cold
Spring Harbor Laboratory Press; 1989.
[8] Lee PY, Costumbrado J, Hsu CY, Kim YH. Agarose gel
electrophoresis for the separation of DNA fragments. J Vis
Exp. 2012;62:3923. https://doi.org/10.3791/3923
[9] Murashige T, Skoog F. A revised medium for rapid growth
and bio assays with tobacco tissue cultures. Physiol Plant.
1962;15:473–97.
[10] Ramesh S, Nagadhara D, Reddy VD, Rao KV. Production of
transgenic indica rice resistant to yellow stem borer and sap‐
sucking insects, using super‐binary vectors of Agrobacterium
tumefaciens. Plant Sci. 2004;166:1077–85.
[11] Nagadhara D, Ramesh S, Pasalu IC, Rao YK, Krishnaiah NV,
Sarma NP, et al. Transgenic indica rice resistant to sap‐
sucking insects. Plant Biotechnol J. 2003;1:231–40.
[12] McCouch SR, Kochert G, Yu ZH, Wang ZY, Khush GS,
Coffman WR, et al. Molecular mapping of rice chromosomes.
Theor Appl Genet. 1999;76:815–29.
[13] Livak KJ, Schmittgen TD. Analysis of relative gene expres-
sion data using real‐time quantitative PCR and the 2−ΔΔCT
method. Methods. 2001;25:402–8.
[14] Wellburn AR. The spectral determination of chlorophyll a
and chlorophyll b, as well as total carotenoids, using various
solvents with spectrophotometers of different resolution.
J Plant Physiol. 1994;144:307–13.
[15] Bates LS, Waldren RP, Teare ID. Rapid determination of free
proline for water‐stress studies. Plant Soil. 1973;39:205–7.
[16] Szabados L, Savoure A. Proline: a multifunctional amino
acid. Trends Plant Sci. 2010;15:89–97.
[17] Miller GL. Use of dinitrosalicylic acid reagent for determi-
nation of reducing sugar. Anal Chem. 1959;31:426–8.
[18] Zhang J, Chen R, Yu Z, Xue L. Superoxide dismutase
(SOD) and catalase (CAT) activity assay protocols for
Caenorhabditis elegans. Bio‐protocol. 2017;7:e2505.
[19] Shin LJ, Lo JC, Yeh KC. Copper chaperone antioxidant
protein1 is essential for copper homeostasis. Plant Physiol.
2012;159:1099–110.
[20] He F. Bradford protein assay. Bio‐101. 2011;1:e45. https://doi.
org/10.21769/BioProtoc.45
[21] Angirekula S, Atti L, Atti S. Estimation of serum MDA
(malondialdehyde) in various morphological types and clin-
ical stages of age related (senile cataract). Int J Adv Med.
2018;5:674–80.
[22] Jin X, Shi C, Yu CY, Yamada T, Sacks EJ. Determination of
leaf water content by visible and near‐infrared spectrometry

and multivariate calibration in Miscanthus. Front Plant Sci.
2017;8:721.
[23] Tsugeki R, Kochieva EZ, Fedoroff NV. A transposon inser-
tion in the Arabidopsis SSR16 gene causes an embryo‐
defective lethal mutation. Plant J. 1997;10:479–89.
[24] Munns R, Weir R. Contribution of sugars to osmotic adjust-
ment in elongating and expanded zones of wheat leaves
during moderate water deficits at two light levels. Aust
J Plant Physiol. 1981;8:93–105.
[25] Biswas AK, Choudhuri MA. Effect of water stress at different
developmental stages of field‐grown rice. Biol Plant. 1984;26:
263–6.
[26] Blum A. Plant breeding for stress environments. Taylor and
Francis Publishers: CRC Press; 2018.
[27] Moin M, Bakshi A, Saha A, Udaya Kumar M, Reddy AR,
Rao KV, et al. Activation tagging in indica rice identifies
ribosomal proteins as potential targets for manipulation of
water‐use efficiency and abiotic stress tolerance in plants.
Plant Cell Environ. 2016;39:2440–59.
[28] Qu S, Desai A, Wing R, Sundaresan V. A versatile
transposon‐based activation tag vector system for functional
genomics in cereals and other monocot plants. Plant Physiol.
2008;146:189–99.
[29] Sofo A, Tuzio AC, Dichio B, Xiloyannis C. Influence of water
deficit and rewatering on the components of the
ascorbate–glutathione cycle in four interspecific Prunus hy-
brids. Plant Sci. 2005;169:403–12.
[30] Kausar R, Hossain Z, Makino T, Komatsu S. Characterization
of ascorbate peroxidase in soybean under flooding and
drought stresses. Mol Biol Rep. 2012;39:10573–9.
[31] Cruz FJR, Castro GLS, Silva Júnior DD, Festucci‐Buselli RA,
Pinheiro HA. Exogenous glycine betaine modulates ascorbate
peroxidase and catalase activities and prevent lipid perox-
idation in mild water‐stressed Carapa guianensis plants.
Photosynthetica. 2013;51:102–8.
[32] Verma D, Singla‐Pareek SL, Rajagopal D, Reddy MK,
Sopory SK. Functional validation of a novel isoform of Na+
/
H+
antiporter from Pennisetum glaucum for enhancing sali-
nity tolerance in rice. J Biosci. 2007;32:621–8.
[33] Kanneganti V, Gupta AK. Overexpression of OsiSAP8, a
member of stress associated protein (SAP) gene family of rice
confers tolerance to salt, drought and cold stress in trans-
genic tobacco and rice. Plant Mol Biol. 2008;66:445–62.
[34] Samarah NH, Alqudah AM, Amayreh JA, McAndrews GM.
The effect of late‐terminal drought stress on yield components
of four barley cultivars. J Agron Crop Sci. 2009;195:427–41.
[35] Samarah NH, Haddad N, Alqudah AM. Yield potential eva-
luation in chickpea genotypes under late terminal drought in
relation to the length of reproductive stage. Ital J Agron.
2009;4:111–7.
[36] Samarah NH, Mullen RE, Anderson I. Soluble sugar con-
tents, germination, and vigor of soybean seeds in response to
drought stress. J New Seeds. 2009;10:63–73.
[37] Samarah N, Alqudah A. Effects of late‐terminal drought
stress on seed germination and vigor of barley (Hordeum
vulgare L.). Arch Agron Soil Sci. 2001;57:27–32.
[38] Saini HS, Aspinall D. Effect of water deficit on sporogenesis
in wheat (Triticum aestivum L.). Ann Bot. 1981;48:623–33.
[39] Sheoran IS, Saini HS. Drought‐induced male sterility in rice:
changes in carbohydrate levels and enzyme activities asso-
ciated with the inhibition of starch accumulation in pollen.
Sex Plant Reprod. 1996;9:161–9.
[40] Wang W, Vinocur B, Altman A. Plant responses to drought,
salinity and extreme temperatures: towards genetic en-
gineering for stress tolerance. Planta. 2003;218:1–14.
[41] Greenway H, Munns R. Mechanisms of salt tolerance in
nonhalophytes. Ann Rev Plant Physiol. 1980;31:149–90.
[42] Matysik J, Alia, Bhalu B, Mohanty P. Molecular mechanisms
of quenching of reactive oxygen species by proline under
stress in plants. Curr Sci. 2002;82:525–32.
[43] Karthikeyan A, Pandian SK, Ramesh M. Transgenic indica
rice cv. ADT 43 expressing a Δ1‐pyrroline‐5‐carboxylate
synthetase (P5CS) gene from Vigna aconitifolia demonstrates
salt tolerance. Plant Cell Tissue Organ Cul. 2011;107:383–95.
[44] Cui M, Zhang W, Zhang Q, Xu Z, Zhu Z, Duan F, et al. In-
duced over‐expression of the transcription factor OsDREB2A
improves drought tolerance in rice. Plant Physiol Biochem.
2011;49:1384–91.
[45] Long SP, Ort DR. More than taking the heat: crops and global
change. Curr Opin Plant Biol. 2010;13:240–7.
How to cite this article: Gorripati S, Konka R,
Panditi SK, Velagapudi K, Jeevigunta NLL.
Overexpression of the ascorbate peroxidase through
enhancer‐trapped pSB111 bar vector for alleviating
drought stress in rice. J Basic Microbiol. 2021;61:
315–329. https://doi.org/10.1002/jobm.202000725

Gorripati2021

Recommended

Recommended

More Related Content

What's hot

What's hot (20)

Similar to Gorripati2021

Similar to Gorripati2021 (20)

Recently uploaded

Recently uploaded (20)

Gorripati2021