1. J Mycol Pl Pathol, Vol. 38, No. 1, 2008 33
PR Verma M Sc Thesis Award
Cloning and Characterization of Master Regulator of Systemic Acquired
Resistance in Plants
Akhilesh Rawat, Sumangala Bhat, Ramesh Bhat and M. S. Kuruvinashetti
Department of Biotechnology, University of Agriculture Sciences Dharwad- 580005, Karnataka, India.
Email:smangala67@rediffmail.com, akhileshrawat@cancerinstitutewia.in
Abstract
The over-expression of non-expresser of PR proteins (NPR1) gene has proved effective in providing resistance to a
broad spectrum of pathogens in different plant species, indicating its functionality across a wide taxonomic range. In
this study, npr1 gene was cloned from mustard (Brassica napus) using PCR strategy and sequenced. Cloned npr1
gene had 98 per cent homology with reported npr1 gene of mustard at both nucleotide and protein level. It has four
exons with three stretches of internal introns. The NPR1 protein of mustard has an ankyrin repeat and a BTB/POZ
(broad-complex, tramtrack, and bric-a-brac/pox virus and zinc finger) domain and codes for 579 amino acids.
Further, cloned gene was transferred to tobacco through Agrobacterium mediated transformation and the putative
transgenics were confirmed by gene specific PCR.
Key words: Agrobacterium, Brassica napus, ankyrin repeat, npr1
Citation: Rawat A, Bhat S, Bhat R and Kuruvinashetti MS. 2008. Cloning and characterization of master regulator
of systemic acquired resistance in plants. J Mycol Pl Pathol 38(1):33-38.
Genetic engineering of
disease-resistance through
transfer of plant defense-related
genes or genes of
pathogen origin into crops
is valuable in terms of
cost, efficacy and
reduction of pesticide
usage (Shah 1997;
Salmeron and Vernooij
1998; Rommens and
Kishore 2000; Stuiver and Custers 2001). Among the
strategies used for the genetic engineering of disease-resistance,
the deployment of systemic acquired
resistance (SAR) is of special interest. SAR is long
lasting and often associated with local and systemic
accumulation of salicylic acid (SA) (Malamy et al 1990;
Metraux et al 1990; Rasmussen et al 1991) and induced
expression of a number of genes, including a group of
pathogenesis-related (PR) genes (Ward et al 1991;
Ryals et al 1996). Over expression of some PR genes in
transgenic plants confers modest protection against
pathogens (Broglie et al 1991; Alexander et al 1993; Liu
et al 1994; Zhu et al 1994; Jach et al 1995). However,
the protection provided by a single, specific PR gene is
usually very limited in its spectrum, degree and duration
compared to that of a native SAR response (Jach et al.
1995; Jongedijk et al 1995). Therefore, to address this
problem, there is a need to develop alternative strategies
that protect the plants from a broad-spectrum of
bacterial and fungal diseases. This can be achieved by
developing transgenic crops with genes that are
responsible for the expression of various defense genes
existing in the plant. Broad-spectrum resistance can be
achieved through manipulation of defense signaling
components that act downstream of pathogen
recognition. Each component of the signaling network
represents a potential switch for activating the defense
arsenal. This approach could provide broad spectrum of
resistance, if based on master regulators that activate the
entire arsenal of defense responses. This approach is
likely to be durable because a gain-of-function mutation
(e.g. a suppressor of downstream signals) in the
pathogen would probably be required to subvert a
multicomponent resistance (John et al 2003). In this
direction, the non-expresser of PR genes (NPR 1) also
known as NIM1 and SAI1 gene has emerged as a good
candidate to provide broad-spectrum resistance (John et
al 2003). It is a key regulator of SA-mediated SAR in
plants. NPR1 is a regulatory protein with ankyrin
repeats that activates expression of PR protein genes
(Cao et al 1997; Ryals et al 1997). Upon induction of
SAR, NPR1 is translocated into the nucleus and binds to
the transcription factor of members of the TGA family
(Kinkema et al 2000), which are implicated in the
activation of SA-responsive PR genes like chitinase and
glucanase. It also participates in the jasmonate and
ethylene-regulated, SA-independent induced systemic

2. 34 J Mycol Pl Pathol, Vol. 38, No. 1, 2008
resistance (ISR) (Pieterse et al 2001). Studies have
demonstrated that enhanced resistance to diverse
pathogens is provided by over expression of npr1
indicating functionality across a wide taxonomic range.
Therefore, the main aim of this study was to clone npr1,
a master regulator of plant host defense gene from
mustard and transfer of this gene to tobacco for
verification of its utility.
Materials and Methods
DNA isolation and purification. Total DNA was
isolated from a disease resistant variety of mustard (B.
napus), following CTAB protocol of Murry and
Thompson (1980), with following minor modifications.
About 4-5 g of leaf sample was ground with liquid
nitrogen in a pre-chilled mortar and pestle. The ground
tissue was transferred to a centrifuge tube and to this 20
ml of hot (65C) 2X CTAB extraction buffer was added.
Contents were mixed gently by inversion and incubated
in water bath at 65 C for 30 min. After cooling to room
temp, equal vol of chloroform: isoamyl alcohol (24:1)
was added and mixed gently for 5 min by inverting the
tubes. It was centrifuged at 8000 rpm for 10 min at 4C.
Supernatant from the top aqueous phase was taken into
a new centrifuge tube and lower chloroform phase was
discarded. Another chloroform-iso-amylalcohol
extraction was performed. To the supernatant collected,
two volumes of cold isopropanol was added and kept at
–20 C for 1h. It was then centrifuged for 10 min at
10,000 rpm at 4 C. The supernatant was decanted and
DNA pellet was washed twice with 70% alcohol and
air-dried and re-suspended in 300 μl of T10 E1 (10 mM
Tris HCl and 1 mM EDTA, pH 8.0).
Cloning and sequencing. npr 1 gene specific primers
(5' primer 5'-
GCTCTAGACCATCGGATCTCTGTGACCTTTG-3'
and 3' primer 5'
GGATCCGCGGAATACACAGGATGCAAAAT 3')
were designed using the nucleotide sequence (for B.
napus and for B. juncea) available in the NCBI
database. Using proofreading polymerase about 2.5kb
DNA fragment from B. napus was amplified. Slight
modification was done in routinely used PCR condition
(given below), as proofreading polymerase requires
extra time for proofreading activity. Amplification
conditions for PCR were 95 C, 5 min; then 94 C, 1 min;
62.5 C, 1 min; 72 C, 5 min for 15 cycles, then 94 C, 1
min; 62.5 C, 1 min; 72 C, 5 (increase of 10 sec/cycle)
min for 25 cycles, and a final extension of 72°C, 45
min, followed by a 4 C hold. Purified DNA fragment
was ligated to pTZ57R/T according to the
manufacturer’s (MBI, Fermentas, USA) protocol. This
ligated product was transferred to E. coli DH 5α using
calcium chloride method with some modification
(Sambrook et al 2001). The recombinants were selected
on the LA plate containing ampicillin X-gal and IPTG.
White colonies were selected and sub cultured. The
presence of the gene was confirmed by restriction and
PCR amplification. A putative clone of npr1 gene was
sequenced at Bengalore Genei by primer walking.
In silico confirmation. Confirmation of npr1 gene was
done using the NCBI BLAST and conserved domains
and motifs were identified using conserved domain
search in NCBI and SWISSPROT. For in silico
translation Genscan software was used and conserved
amino acid residues among different NPR1 proteins
were identified by multiple alignments using Bioedit
software. Molecular weight and theoretical pI was
determined by SWISSPROT service.
Phylogenetic analysis. For phylogenetic analysis NPR1
sequences from different plant spp available at NCBI
database were used. Multiple alignments were done
using Clustal W algorithm of Bioedit software with gap
opening penalty of 10 and gap extension penalty of 1.
The phylogenetic tree was constructed using Neighbor-joining
algorithm of MEGA 3.1 (Kumar et al 2004).
Tobacco transformation. For tobacco transformation
the npr1 gene from B. napus was subcloned into a plant
transformation vector pHS100 and transferred to E. coli
DH 5α using calcium chloride method with some
modification (Sambrook et al 2001) The recombinants
were selected on the LA plate containing kanamycin 50
mg/l. Recombinant colonies were selected and sub
cultured. The presence of the gene was confirmed by
restriction and PCR amplification and mobilized into
Agrobacterium tumefaciens strain LBA4404 by
triparental mating using E. coli containing pRK2013
vector as helper strain. Further, Agrobacterium
containing recombinant plasmid pHSAM was used for
tobacco transformation by using protocol mentioned in
Hooykaas and Schilperoort (1992) with some
modifications. Kanamycin at 50 mg/l in culture medium
was used to select transformants and putative
transformants were confirmed by PCR.
Results
Cloning of npr1 gene. Amplification of template DNA
of B. napus with npr1 specific primers gave an
amplicon of ~2.5kb and it was sub-cloned into
pTZ57R/T. The recombinant vector was transferred to
E coli DH5 α.
Confirmation of clones. The transformed cells were
picked up, streaked on Luria agar ampicillin (100 ppm)
medium containing X-GAL and isopropyl-β-D-thiogalactosidase
(IPTG) for clone selection.
Recombinant cells were selected based on blue/white
colony assay. The clones were named pSAM: out of 21
colonies, 11 were white and all of them showed the
presence of ~2.5kb insert in PCR and restriction
analysis (with XbaI and Bam HI enzymes).

3. J Mycol Pl Pathol, Vol. 38, No. 1, 2008 35
Sequencing and in silico analysis of the clones. The
full length cloned gene in pSAM was sequenced using
M13 primers employing primer walking technique.
The nucleotide sequence of the clone in pSAM was
analyzed after removing vector sequence through GENE
TOOL and VecScreen service of the NCBI. The clone
in pSAM has a length 2482 bp. The available sequence
information from cloned fragment was subjected to
analysis using BLAST algorithm available at
http://www.ncbi.nlm.nih.gov. It showed homology with
the proteins with ankyrin repeat and BTB domain. It
has four exons and codes for 579 amino acids and
showed 98 per cent similarity with reported npr1 gene
of B. juncea and B. napus (AY667498, AF527176) at
both nucleotide and amino acid levels. The amino acid
sequence analyzed using ScanProsite software showed
one conserved protein-protein interaction motifs one
BTB/POZ motif (amino acid 66-192) and three ankyrin
repeats (263-291, 292-322, 326-355) The protein has a
calculated molecular mass of 64551.6Da and theoretical
pI of 6.00. Analysis using LOCtree software indicated
that this protein is not secreted, nuclear localized and
not DNA-binding type with reliability index of 5, 9, and
1, respectively.
Figure 1. a = PCR amplification of npr1 gene from mustard at different temperature, lane M- double digest
marker, 1- 58 C, 2- 60 C, 3- 61 C, 4- 62.5 C; b = PCR confirmation in pTZ57R/T, lane M- double digest
marker, 1- pSAM clone 1, 2- pSAM clone 2, 3- pSAM clone 3, 4- negative control (blue colony); c = restriction
confirmation with XbaI and Bam HI enzymes, lane M- double digest marker, 1- pSAM clone 1, 2- negative
control (blue colony), 3- linear pTZ57R/T.
Phylogenetic analysis of the npr1 gene from different
plant species. The phylogenetic analysis of NPR1
proteins available in database, using MEGA 3.1
software (UPGMA method) is presented in Fig. 2. The
NPR1 proteins formed two major clusters. The first
cluster comprised of sequences from Cruciferaceae
family (Arabidopsis and Brassica spp.), while the
second cluster is formed by Solanaceae and Graminae
family. Crops of the same genus formed single
subcluster. The cloned sequence showed more similarity
with Brassica napus, followed by Arabidopsis and less
similarity with chilli, tobacco and rice.
Tobacco transformation and confirmation. The npr1
gene in plant trsnsformation vector pHS100 was
confirmed by PCR and restriction analysis using XbaI
and BamHI enzymes (Fig. 3a and b, respectively) and
named as pHSAM clones.
Figure 2. Phylogenetic analyses of npr1 gene based
on deduce amino acid sequence from different plant
species. Numbers in node region indicate the
bootstrap value. Out group is used to generate root
for phylogenetic tree

4. 36 J Mycol Pl Pathol, Vol. 38, No. 1, 2008
a b
Figure 3. a = PCR confirmation in pHS100, lane M- double digest marker, 1- pHSAM clone 1, 2- pHSAM
clone 2, 3- pHSAM clone 3, C- negative control; b = restriction confirmation with XbaI and Bam HI enzymes,
lane M- 1000 bp marker, 1- pHSAM clone 1, 2- pHSAM clone 2, M- 1000 bp marker
The confirmed pHSAM clones were transferred to
Agrobacterium tumefaciens LBA4404 via tri-parental
mating. The recombinant A. tumefaciens were
confirmed through PCR amplification of the plasmids
obtained from recombinant A. tumefaciens .
Further the leaf discs co-cultivated with
recombinant A. tumefaciens (Fig 4a) for 48 h on MS
medium and transferred on to the MS medium with
napthalene acetic acid (NAA) (0.5 mg/l),
benzylaminopurine (BAP) (1 mg/l) and cephotaxime
(200 mg/l). Explants produced calli and direct shoots
within three wks (Fig. 4b). The shoots and calli were
excised and transferred to hormone-free MS medium
with 200 mg/l cefotaxime and 200 mg/l kanamycin.
Approximately 75 per cent of the total cultured leaf disc
turned albino on both callus induction and shoot
regeneration medium. Surviving green shoots were
transferred to rooting medium with kanamycin 200 mg/l
after about 4 wks. About 50 plants with well-developed
root system (Fig. 4c) were transferred to sterilized peat
and shifted to green house (Fig. 4d).
DNA was isolated from 15 putative
transformants and checked for the presence of insert
(2.5 kb) through PCR using B. napus npr1 gene specific
primers. Five of the fifteen plants were PCR positive for
the B. napus npr1 gene (Fig. 5). And as the used primers
were highly specific to B. napus npr1 gene, the primers
have not amplified the native npr1 gene of tobacco.
Figure 4. Left to right: Leaf disc co-cultivated in MS medium; induction of shoot initials in MS medium with
kanamycin (100 mg/l); rooting of shoots in medium with kanamycin (200 mg/l); and transgenic tobacco plants
with npr1 gene

5. J Mycol Pl Pathol, Vol. 38, No. 1, 2008 37
Figure 5. PCR confirmation of presence of npr1
gene in tobacco. Lane M- 1000 bp marker, 1- PCR
positive plant-1, 2- PCR negative plant-2, 3- PCR
negative plant-3, 4- PCR negative plant-4, 5- PCR
positive plant-5, C- PCR positive control
Discussion
The cloned npr1 gene showed maximum 98% identities
with reported npr1 gene for B.juncea and B.napus
(AY667498, AF527176) at both nucleotide and amino
acid levels. The deduced amino acid of npr1 gene
includes one conserved protein-protein interaction
motif, BTB/POZ motif (amino acid 66-192) (Aravind
and Koonin 1999) and three ankyrin repeats (263-291,
292-322, 326-355) (Sedgwick and Smerdon 1999).
Nuclear localization of NPR1 protein is essential for its
function (Kinkema, et al. 2000). The deduced protein is
thought to be nuclear localized and its primary structure
predicted neither a DNA binding domain nor a
transcriptional activation domain as reported earlier
(Cao et al 1997). A change in amino acid was observed
at 11 positions with B. napus. Such differences in amino
acids were observed in many of the genes cloned so far
(Chern et al 2005). The putative alignment using bioedit
software showed that the deduced NPR1 protein
contains the highly conserved; 10 Cys residues at
positions 83, 148, 153, 158, 210, 214, 221, 304, 391,
497) which are capable of forming inter- or intra-molecular
disulfide bonds. It is shown that a mutation
in one of these Cys residues resulted in a mutant npr1
phenotype in Arabidopsis (Corne et al., 2004). Among
all the conserved Cys residues, two are known to be
crucial for NPR1 oligomer formation. Mutation in these
two Cys residues (83, 214) led to constitutive
monomerization and nuclear localization of NPR1, and
to constitutive expression of the PR-1 protein in
Arabidopsis (Zhonglin et al., 2003). The histidine
residues at 298 and 332 in deduced protein are found to
be highly conserved in all NPR1 proteins. They are
involved in the formation of hydrogen bonds, which are
crucial in stabilizing the three-dimensional structure of
the ankyrin-repeat domain (Gorina et al., 1996).
In tobacco transformation the plants were
selected on MS medium with kanamycin (200 mg/l).
Surviving plants were transferred to plastic cups
containing sterilized peat and further checked for the
presence of npr1 gene using specific primers. More than
30 per cent of the tested plants were positive for the
gene. These positive plants need to be analyzed further
through southern hybridization and for the expression of
transferred npr1 gene through RT-PCR or bioassays
with important pathogens. Further, this gene can be
transferred to economically import crops to impart
resistance against broad-spectrum of pathogens.
Reference
Alexander D, Goodman RM, Gut-Rella M, Glascock
C, Weymann K, Friedrich L, Maddox D, Ahl-
Goy P, Luntz T, Ward E and Ryals J. 1993.
Increased tolerance to two oomycete pathogens in
transgenic tobacco expressing pathogenesis-related
protein. Proc Natl Acad Sci USA 90: 7327–7331.
Aravind L, and Koonin EV. 1999. Fold prediction and
evolutionary analysis of the POZ domain: structural
and evolutionary relationship with the potassium
channel tetramerization domain. J Mole Biol
285:1353-1361.
Broglie K, Chet I, Holliday M, Cressman R, Biddle
P, Knowlton S, Mauvais CJ and Broglie R. 1991.
Transgenic plants with enhanced resistance to the
fungal pathogen. Rhizoctonia solani. Science
254:1194–1197.
Cao H, Glazebrook J, Clarke JD, Volko S, and Dong
X. 1997. The Arabidopsis NPR1 gene that controls
systemic acquired resistance encodes a novel
protein containing ankyrin repeats. Cell 88:57–63.
Cao H, Xin Li, and Dong X. 1998. Generation of
broad-spectrum disease resistance by
overexpression of an essential regulatory gene in
systemic acquired resistance. Proc Natl Acad Sci
USA 95:6531–6536.
Chern MS, Fitzgerald HA, Canlas PE, Navarre DA
and Ronald PC. 2005. Over-expression of a rice
NPR1 homolog leads to constitutive activation of
defense response and hypersensitivity to light.
MPMI 18:511–520.
Corne, Pieterse, MJ and Van Loon LC. 2004. NPR1:
the spider in the web of induced resistance
signaling pathways. Curr Opin Plant Biol 7:456–
464.
Gorina S and Pavletich NP. 1996. Structure of the p53
tumor suppressor bound to the ankyrin and SH3
Domains of 53BP2. Science 274:1001–1005.

6. 38 J Mycol Pl Pathol, Vol. 38, No. 1, 2008
Hooykaas PJJ and Schilperoort. 1992. Agrobacterium
and plant genetic engineering. Plant Mol Biol
19:15-38.
Jach G, Gornhardt B, Mundy J, Logemann J,
Pinsdorf E, Leah R, Schell J and Maas C. 1995.
Enhanced quantitative resistance against fungal
disease by combinatorial expression of different
barley antifungal proteins in transgenic tobacco.
Plant J 8:97–109.
John MM and Woffenden JB. 2003. Plant disease
resistance genes: recent insights and potential
applications. Trends Biotechnol 21:178-183.
Jongedijk E, Tigelaar H, van Roekel JS, Bres-
Vloemans SA, Dekker I, van den Elzen PJ,
Cornelissen BJ and Melchers LS. 1995.
Synergistic activity of chitinases and b-1,3-
glucanases enhances fungal resistance in transgenic
tomato plants. Euphytica 85:173–180.
Kinkema M., Fan W, Dong X. 2000. Nuclear
localization of NPR1 is required for activation of
PR gene expression. Plant Cell 12:2339-2350.
Kumar S, Koichiro T and Masatoshi N. 2004.
MEGA3: Integrated software for molecular
evolutionary genetics analysis and sequence
alignment. Brief. Bioinform 5(2):150-163.
Liu D, Raghothama KG, Hasegawa PM and Bressan
RA, 1994. Osmotin overexpression in potato delays
development of disease symptoms. Proc Natl Acad
Sci USA 91:1888–1892.
Malamy J, Carr JP, Klessig DF and Raskin I. 1990.
Salicylic acid: a likely endogenous signal in the
resistance response of tobacco to viral infection.
Science 250: 1002–1004.
Metraux JP, Signer H, Ryals J, Ward E, Wyss-Benz
M, Gaudin J, Raschdorf K, Schmid E, Blum W
and Inverardi Inverardi B. 1990. Increase in
salicylic acid at the onset of systemic acquired
resistance in cucumber. Science 250:1004–1006.
Pieterse CMJ, Ton J, Van Loon LC. 2001. Cross-talk
between plant defence signalling pathways: boost
or burden? AgBiotechNet 3: ABN 068.
Rommens CM and Kishore GM, 2000. Exploiting the
full potential of disease-resistance genes for
agricultural use. Curr Opin Biotechnol 11:120–125.
Ryals JA, Neuenschwander UH, Willits MG, Molina
A, Steiner HY and Hunt MD. 1996. Systemic
acquired resistance. Plant Cell 8:1809–1819.
Ryals J, Weymann K, Lawton K, Friedrich Ll, Ellis
D, Steiner HY, Johnson J, Delaney TP, Jesse T,
Vos P and Uknes S. 1997. The Arabidopsis NIM1
protein shows homology to the mammalian
transcription factor inhibitor IkB. Plant Cell 9:425–
439.
Salmeron JM and Vernooij B. 1998. Transgenic
approaches to microbial disease resistance in crop
plants. Curr Opin Plant Biol 1: 347–352.
Sambrook J and Russel DW. 2001. Molecular
Cloning: A Laboratory Manual. Cold Spring
Harbour Laboratory, New York. pp. A8, 52-55.
Sedwick SG and Smerdon S J. 1999. The ankyrin
repeat: A diversity of interactions on a common
structural framework. Trends Biochem Sci 24:311-
316.
Shah DM. 1997, Genetic engineering for fungal and
bacterial disease. Curr Opin Biotechnol 8: 208–
214.
Stuiver MH and Custers JH. 2001. Engineering
disease resistance in plants. Nature 411: 865–868.
Ward ER, Uknes SJ, Williams SC, Dincher SS,
Wiederhold DL, Alexander DC, Ahl-Goy P,
Metraux JP and Ryals JA. 1991. Coordinate gene
activity in response to agents that induce systemic
acquired resistance. Plant Cell 3: 1085– 1094.
Zhonglin Mou, Weihua Fan and Dong X, 2003.
Inducers of plant systemic acquired resistance
regulate NPR1 Function through Redox changes.
Cell 113: 935–944.
Zhu Q, Maher EA, Masoud S, Dixon RA and Lamb
C. 1994. Enhanced protection against fungal attack
by constitutive co-expression of chitinase and
glucanase genes in transgenic tobacco.
Bio/Technology 12: 807–812.
Accepted: Mar 14, 2008.