International Journal of Molecular SciencesArticle

International Journal of
Molecular Sciences
Article
Identification of Novel Therapeutic Targets for Polyglutamine
Diseases That Target Mitochondrial Fragmentation
Annika Traa 1,2,3, †, Emily Machiela 4, †, Paige D. Rudich
1,2,3, Sonja K. Soo 1,2,3, Megan M. Senchuk 4
and Jeremy M. Van Raamsdonk 1,2,3,4,5,6,*
��
��
Citation: Traa, A.; Machiela, E.;
Rudich, P.D.; Soo, S.K.; Senchuk,
M.M.; Van Raamsdonk, J.M.
Identification of Novel Therapeutic
Targets for Polyglutamine Diseases
That Target Mitochondrial
Fragmentation. Int. J. Mol. Sci. 2021,
22, 13447. https://doi.org/10.3390/

ijms222413447
Academic Editors: Luis M. Valor and
Antonio Campos-Caro
Received: 27 October 2021
Accepted: 9 December 2021
Published: 14 December 2021
Publisher’s Note: MDPI stays neutral
with regard to jurisdictional claims in
published maps and institutional affil-
iations.
Copyright: © 2021 by the authors.
Licensee MDPI, Basel, Switzerland.
This article is an open access article
distributed under the terms and
conditions of the Creative Commons
Attribution (CC BY) license (https://
creativecommons.org/licenses/by/
4.0/).

1 Department of Neurology and Neurosurgery, McGill
University, Montreal, QC H3A 2B4, Canada;
[email protected] (A.T.); [email protected] (P.D.R.);
[email protected] (S.K.S.)
2 Metabolic Disorders and Complications Program, Research
Institute of the McGill University Health Centre,
Montreal, QC H4A 3J1, Canada
3 Brain Repair and Integrative Neuroscience Program, Research
Institute of the McGill University Health
Centre, Montreal, QC H4A 3J1, Canada
4 Laboratory of Aging and Neurodegenerative Disease, Center
for Neurodegenerative Science,
Van Andel Research Institute, Grand Rapids, MI 49503, USA;
[email protected] (E.M.);
[email protected] (M.M.S.)
5 Division of Experimental Medicine, Department of Medicine,
McGill University,
Montreal, QC H4A 3J1, Canada
6 Department of Genetics, Harvard Medical School, Boston, MA
02115, USA
* Correspondence: [email protected]
† There authors contributed equally to this work.
Abstract: Huntington’s disease (HD) is one of at least nine
polyglutamine diseases caused by a
trinucleotide CAG repeat expansion, all of which lead to age-
onset neurodegeneration. Mitochon-
drial dynamics and function are disrupted in HD and other
polyglutamine diseases. While multiple
studies have found beneficial effects from decreasing

mitochondrial fragmentation in HD models
by disrupting the mitochondrial fission protein DRP1,
disrupting DRP1 can also have detrimental
consequences in wild-type animals and HD models. In this
work, we examine the effect of decreasing
mitochondrial fragmentation in a neuronal C. elegans model of
polyglutamine toxicity called Neur-
67Q. We find that Neur-67Q worms exhibit mitochondrial
fragmentation in GABAergic neurons
and decreased mitochondrial function. Disruption of drp-1
eliminates differences in mitochondrial
morphology and rescues deficits in both movement and
longevity in Neur-67Q worms. In testing
twenty-four RNA interference (RNAi) clones that decrease
mitochondrial fragmentation, we identi-
fied eleven clones—each targeting a different gene—that
increase movement and extend lifespan
in Neur-67Q worms. Overall, we show that decreasing
mitochondrial fragmentation may be an
effective approach to treating polyglutamine diseases and we
identify multiple novel genetic targets
that circumvent the potential negative side effects of disrupting
the primary mitochondrial fission
gene drp-1.
Keywords: Huntington’s disease; mitochondria; mitochondrial
dynamics; polyglutamine diseases;
C. elegans; genetics; DRP1
1. Introduction
Huntington’s disease (HD) is an adult-onset neurodegenerative
disease caused by
a trinucleotide CAG repeat expansion in the first exon of the
HTT gene. The resulting
expansion of the polyglutamine tract in the huntingtin protein

causes a toxic gain of
function that contributes to disease pathogenesis. HD is the
most common of at least nine
polyglutamine (polyQ) diseases, including spinal and bulbar
muscular atrophy (SBMA),
dentatorubral–pallidoluysian atrophy (DRPLA), and
spinocerebellar ataxia types 1, 2, 3, 6,
7, and 17 (SCA1, SCA2, SCA3, SCA6, SCA7, and SCA17)
[1,2]. Each disease occurs due to
an expansion of a CAG repeat above a specific threshold
number of repeats. The minimum
Int. J. Mol. Sci. 2021, 22, 13447.
https://doi.org/10.3390/ijms222413447
https://www.mdpi.com/journal/ijms
https://www.mdpi.com
https://orcid.org/0000-0001-8376-9605
https://creativecommons.org/
https://creativecommons.org/licenses/by/4.0/
https://www.mdpi.com/article/10.3390/ijms222413447?type=che
ck_update&version=2
Int. J. Mol. Sci. 2021, 22, 13447 2 of 19
number of disease-causing CAG repeats range from 21 CAG
repeats (SCA6) to 55 CAG
repeats (SCA3). These disorders are all unique
neurodegenerative diseases that typically

present in mid-life but can present earlier in life with larger
CAG repeat expansions [3,4].
The genes responsible for these disorders appear to be
unrelated, except for the presence
of the CAG repeat sequence, indicating that CAG repeat
expansion, independent of the
genetic context, is likely sufficient to cause disease.
Multiple lines of evidence suggest a role for mitochondrial
dysfunction in the patho-
genesis of polyQ diseases [5–9]. Both HD patients and animal
models of the disease display
several signs of mitochondrial dysfunction, including decreased
activity in the complexes
of the mitochondrial electron transport chain [10], increased
lactate production in the
brain [11], decreased levels of ATP production [12], lowered
mitochondrial membrane
potentials [13], and impaired mitochondrial trafficking [14].
While less well studied than
HD, other polyQ diseases also have evidence of mitochondrial
deficits [15–18].
Mitochondrial fragmentation is a consistent feature of HD as it
occurs in HD cell
lines, HD worm models, HD mouse models, and cells derived
from HD patients [19–27].
Mitochondrial fragmentation has also been observed in models
of other polyQ diseases,
including SCA3, SCA7, and SBMA [28–30]. This suggests that
CAG repeat expansion may
be sufficient to cause mitochondrial fragmentation.
In order to decrease HD-associated mitochondrial
fragmentation, multiple groups
have targeted the mitochondrial fission protein DRP1 in models

of HD. While genetic or
pharmacologic treatments that either directly or indirectly
inhibit DRP1 activity typically
exhibit beneficial effects in HD models [19,20,22,31–33], the
disruption of DRP1 has also
been found to exacerbate disease phenotypes [26]. The
difference in effect may be due
to the level of DRP1 disruption, as deletion of drp-1 was
detrimental in an HD model,
while RNAi knockdown of drp-1 in the same model had mixed
effects [26]. Decreasing
DRP1 levels can also be detrimental in a wild-type background
[26,34–39]. Thus, reducing
mitochondrial fragmentation through other genetic targets may
be a more ideal therapeutic
strategy for HD and other polyQ diseases than disrupting DRP1.
In this work, we show that CAG repeat expansion is sufficient
to disrupt mitochondrial
morphology and function in a neuronal model of polyQ toxicity.
The neuronal model of
polyQ toxicity also displays deficits in movement and lifespan,
which are ameliorated
by the deletion of drp-1. Using this model, we performed a
targeted RNAi screen and
identified eleven novel genetic targets that improve movement
and increase lifespan.
Overall, this work demonstrates that decreasing mitochondrial
fragmentation may be an
effective therapeutic strategy for polyQ diseases and identifies
multiple potential genetic
therapeutic targets for these disorders.
2. Results
2.1. Mitochondrial Morphology Is Disrupted in a Neuronal
Model of Polyglutamine Toxicity

In order to study the effect of polyQ toxicity on mitochondrial
dynamics in neurons,
we utilized a model that expresses a polyQ protein containing
67 glutamines tagged with
YFP under the pan-neuronal rgef-1 promoter [40]. Henceforth,
these worms will be referred
to as Neur-67Q worms. While this model has been studied
previously, mitochondrial
morphology and function in these worms have not been
characterized. To visualize
mitochondrial morphology in GABAergic neurons, we generated
a new strain expressing
mScarlet fused with the N-terminus of TOMM-20 (translocase
of outer mitochondrial
membrane 20), thus targeting the red fluorescent protein
mScarlet to the mitochondria.
In the rest of the paper, these worms (rab-3p::tomm-
20::mScarlet) are referred to as mito-
mScarlet worms. After crossing Neur-67Q worms to mito-
mScarlet worms, we examined
mitochondrial morphology in the dorsal nerve cord in day 1
adult worms.
We found that day 1 adult Neur-67Q worms exhibit
mitochondrial fragmentation
(Figure 1A). Compared to mito-mScarlet control worms, Neur-
67Q; mito-mScarlet worms
have a decreased number of mitochondria (Figure 1B). Although
the mitochondrial area is
not significantly affected by CAG repeat expansion at day 1 of
adulthood (Figure 1C), Neur-
Int. J. Mol. Sci. 2021, 22, 13447 3 of 19

67Q worms exhibit a decreased axonal mitochondrial load
(Figure 1D), which is calculated
as mitochondria area per length of the axon. In addition, the
shape of the mitochondria is
affected as Neur-67Q; mito-mScarlet worms have more circular
mitochondria (Figure 1E)
and a decreased maximum Feret’s diameter of the mitochondria
(Figure 1F), which is the
maximum distance between two parallel tangents to the
mitochondria.
Figure 1. CAG repeat expansion disrupts mitochondrial
morphology in neurons. Representative images of mitochondria
(red) in the dorsal nerve cord in control and Neur-67Q worms at
day 1 and day 7 of adulthood demonstrate that Neur-
67Q worms exhibit mitochondrial fragmentation and decreased
numbers of mitochondria in neurons (A). Mitochondrial
morphology was visualized by fusing the red fluorescent protein
mScarlet to the mitochondrially-targeted protein TOMM-20
in order to target mScarlet to the mitochondria. Yellow
fluorescence is bleed-through from the 67Q::YFP protein. Scale
bar indicates 10 µM. Quantification of mitochondrial
morphology at day 1 of adulthood reveals that Neur-67Q worms
have a decreased number of mitochondria compared to control
worms (B). While mitochondrial area is not significantly
affected in Neur-67Q worms at day 1 of adulthood (C), these
worms have a significant decrease in axonal mitochondrial
load (D) compared to control worms. The mitochondria of day 1
adult Neur-67Q worms have increased circularity
(E) and a decreased Feret’s diameter (F) compared to the
mitochondria of control worms. Similarly, Neur-67Q worms
at day 7 of adulthood have a significantly decreased number of
mitochondria compared to control worms (G). Day 7
adult Neur-67Q worms also exhibit decreased mitochondrial
area (H), decreased axonal mitochondrial load (I), increased

mitochondrial circularity (J), and a decreased mitochondrial
Feret’s diameter (K) compared to control worms. Control
worms are rab-3p::tomm-20::mScarlet. For panels (B–K), Neur-
67Q refers to Neur-67Q worms expressing mitochondrially
targeted mScarlet (Neur-67Q; rab-3p::tomm-20::mScarlet
worms). Three biological replicates were performed. Statistical
significance was assessed using a t-test. Error bars indicate
SEM. * p < 0.05, *** p < 0.001.
Int. J. Mol. Sci. 2021, 22, 13447 4 of 19
2.2. Differences in Mitochondrial Morphology in Neuronal
Model of Polyglutamine Toxicity Are
Exacerbated with Increasing Age
To determine the effect of age on mitochondrial dynamics in
Neur-67Q worms, we
imaged and quantified mitochondrial morphology in worms at
day 7 of adulthood. As in
young adult worms, adult day 7 Neur-67Q worms exhibit
mitochondrial fragmentation
and a decrease in axonal mitochondria, which is much greater
than observed in day 1 adult
worms (Figure 1A). Quantification of mitochondrial
morphology revealed that day 7 Neur-
67Q worms have a decreased mitochondrial number (Figure
1G), decreased mitochondrial
area (Figure 1H), decreased axonal mitochondrial load (Figure
1I), increased mitochondrial
circularity (Figure 1J), and decreased Feret’s diameter of the
mitochondria (Figure 1K).
These results indicate that aged Neur-67Q worms have a highly
disconnected mitochondrial
network morphology. Furthermore, the percentage decreases in

mitochondrial number
(−27% day 1 versus −64% day 7), mitochondrial area (−10%
day 1 versus −22% day 7),
and axonal mitochondrial load (−35% day 1 versus −70% day 7)
are all much greater at
day 7 than at day 1, indicating that the deficits in mitochondrial
morphology in Neur-67Q
worms worsen with age (Figure S1, see Supplementary
Materials).
2.3. Neuronal Model of Polyglutamine Toxicity Exhibits
Altered Mitochondrial Function
To determine if the differences in mitochondrial morphology
that we observed af-
fect mitochondrial function, we measured the rate of oxidative
phosphorylation (oxygen
consumption) and energy production (ATP levels) in day 1 adult
worms. We found that
Neur-67Q worms have increased oxygen consumption (Figure
2A) but decreased levels of
ATP (Figure 2B). This suggests that the mitochondria in Neur-
67Q are less efficient than
in wild-type worms, possibly due to mitochondrial uncoupling.
Combined, these results
show that the presence of a disease-length CAG repeat
expansion is sufficient to disrupt
mitochondrial morphology and function.
Figure 2. CAG repeat expansion in neurons disrupts
mitochondrial function. Mitochondrial function in Neur-67Q
worms
was assessed by quantifying oxygen consumption and ATP
levels in whole worms at day 1 of adulthood. Day 1 adult
Neur-67Q worms have increased oxygen consumption (A) and
decreased ATP levels (B) compared to wild-type worms. A

minimum of three biological replicates were performed.
Statistical significance was assessed using a one-way ANOVA
with
Bonferroni’s multiple comparison test. Error bars indicate SEM.
* p < 0.05, ** p < 0.01, *** p < 0.001.
2.4. Disruption of Mitochondrial Fission Is Beneficial in a
Neuronal Model of
Polyglutamine Toxicity
As disruption of drp-1 has been shown to ameliorate phenotypic
deficits in various
models of HD, we examined whether disruption of drp-1 would
be beneficial in Neur-67Q
worms. We found that deletion of drp-1 significantly improved
mobility (Figure 3A) and
Int. J. Mol. Sci. 2021, 22, 13447 5 of 19
increased lifespan (Figure 3B) in Neur-67Q worms. While the
drp-1 deletion decreased
fertility (Figure 3C) and slowed development (Figure 3D) in
wild-type worms, it did not
affect either of these phenotypes in Neur-67Q worms. This may
be because mitochondrial
morphology is already different than wild-type in Neur-67Q
worms, while disruption of
drp-1 in wild-type worms results in hyperfused mitochondria.
Figure 3. Inhibition of mitochondrial fission is beneficial in a
neuronal model of polyglutamine toxicity. To examine the
effect of disrupting mitochondrial fission in a neuronal model of
polyglutamine toxicity, Neur-67Q worms were crossed to
drp-1 deletion mutants. Deletion of drp-1 partially ameliorated

phenotypic deficits in Neur-67Q worms. Neur-67Q;drp-1
worms showed significantly increased movement (A) and
lifespan (B) compared to Neur-67Q worms. Unlike wild-type
worms, deletion of drp-1 did not decrease fertility (C) or
development time (D) in Neur-67Q worms. Combined, this
indicates that inhibiting mitochondrial fission is beneficial in a
neuronal model of polyglutamine toxicity. Neur-67Q worms
have increased oxygen consumption compared to wild-type
worms, and a mutation in drp-1 decreases oxygen consumption
in these worms (E). Deletion of drp-1 causes a decrease in ATP
levels in both wild-type and Neur-67Q worms (F). Control
data for wild-type and drp-1 worms was previously published in
Machiela et al., 2021, as experiments for both papers
were performed simultaneously using the same controls. For
panels (A,C,E,F), “Control” refers to worms in a wild-type
background with a normal expression of drp-1 (either wild-type
or Neur-67Q worms). A minimum of three biological
replicates were performed. Statistical significance was assessed
using a two-way ANOVA with Bonferroni posttest (panels
(A,C,E,F)), the log-rank test (panel (B)), or a repeated measures
ANOVA (panel (D)). Error bars indicate SEM. * p < 0.05,
*** p < 0.001.
Finally, we examined the effect of drp-1 deletion on
mitochondrial function in Neur-
67Q worms. We found that the increased oxygen consumption
observed in Neur-67Q
worms is significantly decreased by disruption of drp-1 (Figure
3E). However, the drp-1
deletion was unable to increase the low ATP levels in Neur -67Q
worms and decreased ATP
levels in wild-type worms (Figure 3F). Although the effects of
drp-1 deletion in Neur-67Q
worms are primarily beneficial, the loss of drp-1 increased
expression of the disease-length
polyQ mRNA (Figure S2), as we and others have previously

observed [19,26], which would
be predicted to cause increased toxicity.
To ensure that the beneficial effects of the drp-1 deletion in
Neur-67Q worms are
caused by the disruption of drp-1, we examined the effect of
drp-1 RNAi in Neur-67Q
worms. Because most C. elegans neurons are resistant to RNAi
knockdown [41], we first
crossed Neur-67Q worms to a worm strain that exhibits
enhanced RNAi knockdown
Int. J. Mol. Sci. 2021, 22, 13447 6 of 19
specifically in the neurons but is resistant to RNAi in other
tissues [42]. In the resulting
strain (Neur-67Q;sid-1;unc-119p::sid-1), RNAi is only active in
the nervous system.
As with the drp-1 deletion, knocking down drp-1 expression
throughout life increased
the rate of movement (Figure S3A) and increased lifespan
(Figure S3B) in Neur-67Q worms,
while having no effect on fertility in Neur-67Q worms (Figure
S3C). As with the drp-1
deletion, drp-1 RNAi decreased both oxygen consumption and
ATP levels in Neur-67Q
worms (Figure S3D,E).
2.5. Disruption of Mitochondrial Fission Decreases
Mitochondrial Fragmentation in Neurons
Having shown that drp-1 deletion ameliorates phenotypic
deficits in Neur-67Q worms,

we wondered whether the alterations in mitochondrial
morphology were also corrected.
Accordingly, we imaged and quantified mitochondrial
morphology in Neur-67Q; drp-1
worms at day 1 (Figure S4) and day 7 (Figure 4) of adulthood.
On day 1 of adulthood,
disruption of drp-1 markedly elongated the neuronal
mitochondria, leading to decreased
mitochondrial fragmentation in both Neur-67Q worms and wild-
type worms (Figure S4A).
Quantification of these differences revealed that deletion of
drp-1 results in significantly
decreased numbers of mitochondria (Figure S4B), significantly
increased mitochondrial
area (Figure S4C), significantly increased axonal mitochondrial
load (Figure S4D), signifi-
cantly decreased mitochondrial circularity (Figure S4E), and
significantly increased Feret’s
diameter (Figure S4F).
The beneficial effects of drp-1 disruption on mitochondrial
morphology in Neur-67Q
worms are also observed at day 7 of adulthood (Figure 4A). In
day 7 adult Neur-67Q
worms, disruption of drp-1 increases mitochondrial number
(Figure 4B), mitochondrial area
(Figure 4C), and axonal mitochondrial load (Figure 4D), while
decreasing mitochondrial
circularity (Figure 4E) and increasing the Feret’s diameter of
the mitochondria (Figure 4F).
Similar changes are observed in wild-type worms with the
exception of mitochondrial
number, which is significantly decreased by drp-1 disruption
(Figure 4B).
Combined, these results indicate that drp-1 has a beneficial

effect on mitochondrial
morphology in Neur-67Q worms. Interestingly, CAG repeat
expansion in Neur-67Q worms
has no effect on mitochondrial morphology in the drp-1 mutant
background (Figure S5).
2.6. Targeting Genes That Affect Mitochondrial Fragmentation
Improves Thrashing Rate and
Lifespan in a Neuronal Model of Polyglutamine Toxicity
While our results show that decreasing levels of drp-1 are
beneficial in a neuronal
worm model of polyQ toxicity, this treatment had a detrimental
effect in a C. elegans model
of HD in which exon 1 of mutant huntingtin is expressed in the
body wall muscle [26].
Moreover, a number of studies have found that disruption of
DRP1 can be detrimental in
organisms ranging from worms to humans [34–39].
To circumvent potential detrimental effects of disrupting drp-1,
we targeted other
genes that have been previously found to decrease
mitochondrial fragmentation [43]. In the
previous study, a targeted RNAi screen identified 24
mitochondria-related RNAi clones that
decrease mitochondrial fragmentation in the body wall muscle
of C. elegans. We examined
the effect of these 24 RNAi clones in neuron-specific RNAi
Neur-67Q worms (Neur-67Q;
sid-1; unc-119p::sid-1). Treatment with RNAi was begun at the
L4 stage of the parental gen-
eration, and the rate of movement was assessed in the progeny
(experimental generation).
We found that 16 of the 24 RNAi clones that decrease

mitochondrial fragmenta-
tion significantly increased the rate of movement in the neuron-
specific RNAi Neur-67Q
model (Figure 5A). To ensure that the improved movement in
Neur-67Q worms did not
result from a general effect of these RNAi clones on the rate of
movement, we treated
sid-1;unc-119p::sid-1 control worms with the same panel of 24
RNAi clones and examined
movement. Unlike the Neur-67Q worms, we found that only
four of the RNAi clones
improved movement in the control neuron-specific RNAi strain
(Figure 5B). This indicates
that, for the majority of the RNAi clones that show a benefit,
the improvement in movement
is specific to the neuronal model of polyQ toxicity.
Int. J. Mol. Sci. 2021, 22, 13447 7 of 19
We next examined whether the genes that improved motility in
neuron-specific RNAi
Neur-67Q worms also improved longevity. We found that 11 of
the 16 RNAi clones that
increased the rate of movement also increased lifespan in
neuron-specific RNAi Neur-
67Q worms (Figure 6). In contrast, only three of these RNAi
clones increased lifespan in
the neuron-specific RNAi control strain (Figure S6). Overall,
RNAi clones that decrease
mitochondrial fragmentation in body wall muscle are beneficial
in a neuronal model of
polyQ toxicity.
Figure 4. Disruption of drp-1 rescues deficits in mitochondrial

morphology caused by CAG repeat expansion. Deletion
of drp-1 decreased mitochondrial fragmentation in Neur-67Q
and control worms at day 7 of adulthood. Representative
images of Neur-67Q worms and control worms in wild-type and
drp-1 deletion background (A). Scale bar indicates
10 µM. Disruption of drp-1 in Neur-67Q worms increased
mitochondrial number (B), increased mitochondrial area (C),
increased axonal mitochondrial load (D), decreased
mitochondrial circularity (E), and increased the Feret’s diameter
of the
mitochondria (F). Control worms are rab-3p::tomm-
20::mScarlet. For panels (B–F), “Control” refers to worms in a
wild-type
background with normal expression of drp-1 (either wild-type or
Neur-67Q worms). Control data is from Figure 1 and is
shown to facilitate a direct comparison of the effects of drp-1
deletion. Three biological replicates were performed. Statistical
significance was assessed using a two-way ANOVA with
Bonferroni post-test. Error bars indicate SEM. *** p < 0.001.
Int. J. Mol. Sci. 2021, 22, 13447 8 of 19
Figure 5. Decreasing mitochondrial fragmentation improves rate
of movement in a neuronal model of polyglutamine
toxicity. Neur-67Q worms in which RNAi is only effective in
neurons (Neur-67Q;sid-1;unc-119p::sid-1 worms) and
a neuron-specific RNAi control strain (sid-1;unc-119p::sid-1
worms) were treated with RNAi clones that decrease
mitochondrial fragmentation in body wall muscle. RNAi against
16 of the 24 genes tested improved the rate of
movement in Neur-67Q worms (A). RNAi against four of these
genes also increased movement in the neuron specific
RNAi strain (B). Green indicates a significant increase in
movement, while red indicates a significant decrease in

movement. The positive control drp-1 is indicated with blue.
“Neur-67Q” refers to Neur-67Q;sid-1;unc-119p::sid-1 worms
(panel (A)), while “Control” refers to sid-1;unc-119p::sid-1
worms (panel (B)). Three biological replicates were performed.
Statistical significance was assessed using a one-way ANOVA
with Dunnett’s multiple comparison test. Error bars
indicate SEM. * p < 0.05, ** p < 0.01, *** p < 0.001.
Int. J. Mol. Sci. 2021, 22, 13447 9 of 19
Figure 6. RNAi clones previously shown to decrease
mitochondrial fragmentation in body wall muscle rescue
shortened
lifespan in neuronal model of polyglutamine toxicity. Neur-67Q
worms in which RNAi is only effective in neurons (Neur-
67Q;sid-1;unc-119p::sid-1 worms) were treated with RNAi
clones that decrease mitochondrial fragmentation in body wall
muscle and that we found to increase movement in Neur-67Q
worms (Figure 5). Eleven of the sixteen RNAi clones that
improved movement in Neur-67Q worms also resulted in
increased lifespan. Each of these RNAi clones targets a
different
gene. Three biological replicates were performed. Statistical
significance was assessed using the log-rank test.
3. Discussion
Since the discovery of the genes responsible for HD and other
polyQ diseases [44,45],
multiple animal models of these disorders have been generated
to gain insight into disease
pathogenesis [46,47]. This includes C. elegans models of HD
and polyQ toxicity [40,48–50].
C. elegans offers a number of advantages for studying

neurodegenerative diseases, in-
cluding being able to perform large-scale screens for disease
modifiers rapidly and cost-
effectively [51,52]. In addition, the interconnections of all of
the neurons in C. elegans have
been mapped. In terms of studying mitochondrial dynamics, the
transparent nature of
C. elegans facilitates imaging mitochondrial morphology in a
live organism, which can then
be correlated with whole-organism phenotypes.
3.1. CAG Repeat Expansion Disrupts Mitochondrial
Morphology and Function in Neurons
HD and other polyQ diseases are neurodegenerative diseases in
which the most severe
pathology occurs in neurons. We previously examined
mitochondrial fragmentation in a
muscle model of HD as it is more experimentally accessible
[26]. However, to gain greater
physiological relevance, in this study, we generated novel
strains to examine mitochondrial
morphology in neurons. We found that CAG repeat expansion in
Neur-67Q worms is
sufficient to cause mitochondrial fragmentation neurons, as well
as a progressive decrease
in the abundance of mitochondria in the axons of the dorsal
nerve cord. The differences in
mitochondrial number, axonal load, size, circularity, and length
(Feret’s diameter) in the
neuronal model of polyQ toxicity are quantifiable and highly
significant.
Int. J. Mol. Sci. 2021, 22, 13447 10 of 19

In these experiments, we used wild-type worms as a control
rather than worms
expressing a CAG repeat tract within the unaffected range. As a
result, we can’t exclude
the possibility that mitochondrial fragmentation might also be
caused by the expression
of short CAG repeat sequences. However, we think that this is
unlikely as we have
previously found that expression of CAG repeat expansions of
24–28 does not lead to
mitochondrial fragmentation in the body wall muscle [26].
Similarly, others have only
observed mitochondrial fragmentation with disease length CAG
repeat sequences [22].
Importantly, Neur-67Q worms also exhibited changes in
mitochondrial function,
including a significant increase in oxygen consumption and a
significant decrease in ATP
levels. These differences are particularly striking given that
oxygen consumption and
ATP levels were measured in whole worms while the expanded
polyQ transgene is only
expressed in neurons, which make up 302 of the worm’s 959
cells. Given the magnitude of
the differences observed, it is possible that changes occurring in
the neurons are having
cell-non-autonomous effects on mitochondrial function in other
tissues.
Although the yield of ATP from oxidative phosphorylation is
variable [53], oxygen
consumption and ATP production normally correlate under
basal conditions due to the
high dependence of ATP production on the electron transport

chain in C. elegans [54,55]. The
opposing changes in ATP and oxygen consumption suggest that
the mitochondria in Neur-
67Q worms are inefficient or damaged, leading to a marked
decrease in the ATP produced
per amount of oxygen consumed. We observed a similar pattern
in a mitophagy-defective
worm model of Parkinson’s disease in which there is a deletion
of pdr-1/PRKN [56].
It is interesting to note that drp-1 deletion was still able to
improve movement in
Neur-67Q worms despite further decreasing the levels of ATP.
Similarly, drp-1 deletion
decreased ATP levels in wild-type worms but did not decrease
their movement. These
findings suggest that the movement deficit in Neur-67Q worms
is not simply a result of
decreased levels of ATP but more likely due to a disruption of
neuronal function.
3.2. Tissue-Specific Effects of Disrupting Mitochondrial Fission
One of the most surprising findings of our current study is that
deletion of drp-1 has
different effects in neuronal and body wall muscle models of
polyQ toxicity (see Table S1
for comparison). In the neuronal model, deletion of drp-1
increases movement and lifespan
and has no detrimental effect on development or fertility. In
contrast, disruption of drp-1
in the body wall muscle model decreases movement, lifespan,
fertility, and the rate of
development [26]. The opposing effects of reducing drp-1 on
polyQ toxicity in neurons
compared to body wall muscle suggest that the optimal balance

between mitochondrial
fission and fusion may differ between tissues. Alternatively, it
is possible that the loss of
mitochondrial fission is better tolerated in neurons than in body
wall muscle, even though
both tissues are post-mitotic in C. elegans. Finally, it could be
that decreasing drp-1 levels is
beneficial in neurons because it is more effective at correcting
disruptions in mitochondrial
networks in that tissue (Figure 4) than in body wall muscle,
where drp-1 deletion had little
or no effect on mitochondrial morphology [26].
It should be noted that the neuronal model of polyQ toxicity
used in this study and
the HD muscle model that we utilized previously cannot be
directly compared due to
differences between these strains beyond the tissue of
expression (Table S1). Notably, BW-
Htt-74Q worms have a small fragment of the huntingtin protein
linked to the expanded
polyQ tract, while Neur-67Q only have the expanded polyQ
tract. The size of the polyQ
tract is different between these two strains, and BW-Htt-74Q
worms have the polyQ tagged
with GFP, while the polyQ is tagged with YFP in Neur-67Q
worms. Thus, while our results
do not rule out other factors contributing to the differences
between the neuronal strain
and the muscle strain, they clearly show that decreasing drp-1
levels can be beneficial in
worms expressing an expanded polyQ tract in neurons, and that
decreasing drp-1 levels
can be detrimental in worms expressing an expanded polyQ
tract in muscle cells.

Int. J. Mol. Sci. 2021, 22, 13447 11 of 19
3.3. Decreasing Mitochondrial Fragmentation as a Therapeutic
Strategy for
Polyglutamine Diseases
Due to the many roles drp-1 plays in promoting proper cellular
function through
control of the mitochondria and the previously observed
detrimental effects of decreasing
drp-1 in a body wall muscle model [26], decreasing levels or
activity of DRP-1 may be a
non-ideal therapeutic target for HD or other polyQ diseases.
Accordingly, we explored
other possible genetic targets that decrease mitochondrial
fragmentation. We performed a
targeted RNAi screen using 24 RNAi clones previously found to
decrease mitochondrial
fragmentation in the body wall muscle [43]. A high percentage
of these RNAi clones
increased movement (16 of 24 RNAi clones that decrease
fragmentation) and lifespan
(11 of 16 RNAi clones that improve movement) in Neur-67Q
worms.
As we obtained numerous positive hits, we did not confirm
knockdown by qPCR or
confirm a decrease in mitochondrial fragmentation. Thus, we
can’t exclude the possibility
that the remaining eight genes that failed to show a beneficial
effect may have had either
insufficient genetic knockdown or did not exhibit the predicted
effect on mitochondrial
morphology. Nonetheless, a high proportion of RNAi clones

previously found to decrease
mitochondrial fragmentation increased movement in the
neuronal HD model indicating
that multiple genetic approaches to decreasing mitochondrial
fragmentation are beneficial
in worm models of polyQ toxicity.
In order to prioritize therapeutic targets for further
characterization and validation,
we analyzed the results from the current study with our previous
study of these RNAi
clones in a body wall muscle model of HD [26] (Table 1). The
genes were ranked by
giving one point for improving either: thrashing rate in Neur-
67Q worms; lifespan in
Neur-67Q worms; the crawling rate in BW-Htt74Q worms; or
thrashing rate in BW-Htt74Q
worms. Of the 24 RNAi clones tested in both models, 21 clones
exhibited a beneficial
effect on at least one phenotype. This indicates that multiple
approaches to decreasing
mitochondrial fragmentation can ameliorate deficits caused by
CAG repeat expansion. The
top-ranked therapeutic targets were alh-12 and pgp-3, which
resulted in improvement of
all four assessments, and gpd-4, immt-2, sdha-2 and wht-1,
which resulted in improvement
in three of the assessments (Table 1). As the RNAi clones
targeting alh-12 and pgp-3 were
the top-ranked hits, we confirmed that these RNAi clones
successfully knocked down the
expression of alh-12 and pgp-3, respectively (Figure 7).
Interestingly, knockdown of alh-12
or pgp-3 has detrimental effects on lifespan or movement in
control strains, indicating that
their beneficial effect is specific to animals with disease-length

CAG repeats.
Table 1. Effect of RNAi clones that decrease mitochondrial
fragmentation in neuronal and body wall muscle models of
polyglutamine toxicity. “ND” indicates not done. “=” indicates
no change. Data from BW-Htt74Q worms and BW-Htt28Q
worms is from Machiela et al. 2021, Aging and Disease, PMID:
34631219).
Target
Gene
Drosophila
Homolog
Mammalian
Homolog
Effect on
Thrashing in
Neur-67Q
Worms
Effect on
Lifespan in
Neur-67Q
Worms
Effect on
Crawling in
BW-Htt74Q
Worms

Effect on
Thrashing in
BW-Htt74Q
Worms
Effect on
Thrashing in
Neuron
Specific
RNAi Strain
Effect on
Lifespan in
Neuron
Specific
RNAi Strain
Effect of
Crawling in
BW-Htt28Q
Worms
Effect of
Thrashing
in
BW-Htt28Q
Worms
alh-12 Aldh ALDH9A1 Increased Increased Increased Increased

No effect Decreased No effect Decreased
pgp-3 Mdr49 ABCB4 Increased Increased Increased Increased
Decreased Increased No effect Decreased
gpd-4 Gapdh2 GAPDH Increased Increased Increased No effect
Increased No effect No effect Decreased
immt-2 Mitofilin IMMT Increased Increased No effect Increased
Decreased Increased No effect No effect
sdha-2 SdhA SdhA Increased Increased Increased No effect No
effect Increased Increased Decreased
wht-1 w ABCG1 Increased Increased Increased No effect
Decreased Decreased No effect No effect
C34B2.8 ND-B16.6 NDUFA13 Increased Increased Increased
Decreased Increased No effect No effect No effect
drp-1 Drp1 DNM1L Increased Increased No effect No effect No
effect No effect No effect No effect
F25B5.6 Fpgs FPGS No effect ND Increased Increased
Decreased ND No effect No effect
his-12 His2A HIS2H2AB Increased Increased No effect No
effect = Decreased Decreased Decreased
sfxn-1.4 Sfxn1-3 SFXN1/3 Increased Increased No effect No
effect = Decreased No effect No effect
abhd-11.1 CG2059 ABHD11 Increased = No effect No effect
Decreased = No effect No effect
acs-1 Acsf2 ACSF2 Increased = No effect No effect Decreased
= Decreased No effect
crls-1 CLS CRLS1 Increased = No effect No effect Increased =
No effect No effect
cyp-35A1 Cyp18a1 CYP2C8 Increased Increased Decreased No
effect Decreased = No effect No effect

Int. J. Mol. Sci. 2021, 22, 13447 12 of 19
Table 1. Cont.
Target Gene DrosophilaHomolog
Mammalian
Homolog
Effect on
Thrashing in
Neur-67Q
Worms
Effect on
Lifespan in
Neur-67Q
Worms
Effect on
Crawling in
BW-Htt74Q
Worms
Effect on
Thrashing in
BW-Htt74Q
Worms
Effect on

Thrashing in
Neuron
Specific
RNAi Strain
Effect on
Lifespan in
Neuron
Specific
RNAi Strain
Effect of
Crawling in
BW-Htt28Q
Worms
Effect of
Thrashing
in BW-
Htt28Q
Worms
D2023.6 Adck1 ADCK1 Increased Increased Decreased No
effect = = Decreased No effect
dlat-2 muc DLAT No effect ND Increased No effect No effect
ND Decreased Decreased
gpx-1 PHGPx GPX4 No effect ND No effect Increased No
effect ND No effect No effect
timm-17B.1 Tim17b TIMM17A/B Increased = No effect No

effect Increased = No effect Decreased
oatr-1 Oat OAT No effect ND Increased No effect No effect ND
Increased No effect
R10H10.6 CG2846 RFK No effect ND Increased No effect
Decreased ND No effect No effect
alh-12 iso B Aldh ALDH9A1 = ND Decreased No effect = ND
No effect No effect
C33A12.1 ND-13B NDUFA5 = ND No effect No effect = ND
No effect No effect
K02F3.2 aralar1 SLC25A12 Increased = Decreased No effect =
= No effect Decreased
T10F2.2 CG1628 SLC25A15 = ND No effect No effect = ND No
effect No effect
Figure 7. Decreasing the levels of alh-12 and pgp-3 mRNA
using RNA interference. Wild-type and
Neur-67Q worms were treated with RNAi bacteria targeting alh-
12 (A) or pgp-3 (B) beginning at the
L4 stage of the parental generation. mRNA levels were
measured when the progeny reached the
young adult stage using quantitative RT-PCR. In both wild-type
and Neur-67Q worms, there was
a significant decrease in alh-12 and pgp-3 mRNA levels when
treated with RNAi bacteria targeting
alh-12 or pgp-3, respectively. The level of knockdown was
highly significant for both genes, but the
magnitude of knockdown was greater for alh-12. Bars indicate
the mean value of three biological
replicates. Statistical significance was assessed using a two-way
ANOVA with Bonferroni post-test.
Error bars indicate SEM. *** p < 0.001.
The alh-12 gene encodes a cytoplasmic aldehyde dehydrogenase
that is expressed
in the intestine, body wall muscle, and specific neurons. It is

involved in multiple
metabolic pathways, including arginine metabolism,
glycerolipid metabolism, glycol-
ysis/gluconeogenesis, and tryptophan degradation. As very little
is known about the
functions of ALH-12, it is hard to speculate how disrupting alh-
12 may be acting to improve
movement and lifespan in the worm models of polyQ toxicity.
The human homolog of ALH-
12, ALDH9A1 can be inhibited by diethylaminobenzaldehyde
[57], which can potentially
be used to validate the neuroprotective effects of ALH-12
inhibition in mammalian models.
The pgp-3 gene encodes a p-glycoprotein related protein. It is a
transmembrane
protein that transports molecules out of the cytoplasm. PGP-3 is
primarily expressed
in the intestine [58], but has also been reported in other tissues.
Disruption of pgp-3
sensitizes worms to P. aeruginosa in a toxin-based fast kill
assay [59], as well as exposure
to colchicine and chloroquinone [60], presumably by disrupting
the active removal of
the toxic compounds from cells. While it seems counterintuitive
that loss of a protective
function against toxins and xenobiotics is protective against
polyQ toxicity, knockdown
of pgp-3 may be acting through hormesis, the process by which
exposure to mild stress
activates protective pathways that can increase resistance to
subsequent stresses and extend
longevity. Exposing worms to mild stress (e.g., heat stress)
increases both stress resistance
and lifespan [61]. Thus, it is possible that preventing the
transport of specific molecules

out of the cytoplasm through disruption of pgp-3 induces mild
stress, which leads to
Int. J. Mol. Sci. 2021, 22, 13447 13 of 19
activation of protective stress response pathways. Alternatively,
it could be that retention
of specific molecules in the cytoplasm somehow protects
against the toxic effects of the
CAG repeat expansion.
As relatively little is known about alh-12 and pgp-3, it will be
important to further
characterize their biological functions in order to gain insi ght
into mechanisms of neuro-
protection. As both genes have homologs in mice and humans, it
will also be important to
validate these genes in mammalian models to determine if their
ability to protect against
polyQ disease is conserved across species. Demonstrating a
protective effect in mammalian
models would provide strong support for these genes as
potential therapeutic targets in
polyQ diseases.
4. Materials and Methods
4.1. Strains
N2 (WT)
AM102 rmIs111[rgef-1p::40Q:YFP] referred to as Neur-40Q
AM717 rmIs284[rgef-1p::67Q:YFP] referred to as Neur-67Q
JVR258 drp-1(tm1108);rmIs284[rgef-1p::67Q:YFP]
JVRV438 rmIs284[rgef-1p::67Q:YFP]; sid-1(pk3321); uIs69
[pCFJ90 (myo-2p::mCherry) +

unc-119p::sid-1]
JVR443 rmIs284[rgef-1p::67Q:YFP]; uIs69 [pCFJ90 (myo-
2p::mCherry) + unc-119p::sid-1]
PHX3820 sybIs3820[rab-3p::tomm-20::mScarlet] referred to as
mito-mScarlet
JVR611 rmIs284[rgef-1p::67Q:YFP];drp-1(tm1108);
sybIs3820[rab-3p::tomm-20::mScarlet]
referred to as Neur-67Q;drp-1;mito-mScarlet
JVR612 rmIs284[rgef-1p::67Q:YFP]; sybIs3820[rab-3p::tomm-
20::mScarlet] referred to as
Neur-67Q;mito-mScarlet
JVRV613 drp-1(tm1108); sybIs3820[rab-3p::tomm-
20::mScarlet] referred to as drp-1;mito-
mScarlet
MQ17V53 drp-1 (tm1108)
TU3401 sid-1(pk3321); uIs69 [pCFJ90 (myo-2p::mCherry) +
unc-119p::sid-1]
Strains were maintained at 20 ◦C on NGM plates seeded with
OP50 bacteria. The Neur-
67Q model of HD is an integrated line that has been well
characterized previously [40]. All
crosses were confirmed by genotyping using PCR for deletion
mutations, sequencing for
point mutations, and confirmation of fluorescence for
fluorescent transgenes.
4.2. Generation of Strains to Monitor Mitochondrial
Morphology in GABA Neurons
The rab-3p::tomm-20::mScarlet strain was generated by
SunyBiotech Co., Ltd., Fujian,
China, The 1208 bp rab-3 promoter sequence (Addgene Plasmid
#110880) was inserted
directly upstream of the N-terminal TOMM-20 coding region.
The first 47 amino acids of

TOMM-20 were connected through a flexible linker
(3xGGGGS) to the N-terminal of wrm-
Scarlet [62]. The strain was generated through microinjection of
rab-3p::tomm-20::mScarlet
in the pS1190 plasmid (20 ng/µL) into wild-type N2 worms. The
transgenic strain was
integrated by γ-irradiation and the outcrossed 5X to remove
background mutations.
4.3. Confocal Imaging and Quantification
Mitochondrial morphology was imaged and quantified using
worms that express
mitochondrially-targeted mScarlet specifically in neurons (rab-
3p::tomm-20::mScarlet). Worms
at day 1 or day 7 of adulthood were mounted on 2% agar pads
and immobilized using 10 µM
levamisole. Worms were imaged under a 63× objective lens on a
Zeiss LSM 780 confocal
microscope. All conditions were kept the same for all images.
Single plane images were
collected for a total of twenty-five young adult worms over
three biological replicates for
each strain. Quantification of mitochondrial morphology was
performed using ImageJ.
Segmentation analysis was carried out using the SQUASSH
(segmentation and quantifi-
cation of subcellular shapes) plugin. Particle analysis was then
used to quantify number
of mitochondria, mitochondrial area, axonal mitochondrial load,
mitochondrial circularity,
Int. J. Mol. Sci. 2021, 22, 13447 14 of 19

and maximum Feret’s diameter (an indicator of particle length).
Axonal load was calculated
as the total mitochondrial area (µm2) in a region of interest
(ROI), per length (µm) of axon
in the ROI. For representative images, mScarlet and YFP
channels were merged. We ob-
served some bleed-through of YFP into the red channel for
strains expressing the 67Q-YFP
transgene. Particles that showed up in the mScarlet images as a
result of YFP bleed-through
were manually excluded from morphology quantification based
on the numbered particle
mask output from the ImageJ particle analyzer.
4.4. Oxygen Consumption
To measure basal oxygen consumption, a Seahorse XFe96
analyzer (Seahorse bio-
science Inc., North Billerica, MA, USA) [57] was used. Adult
day 1 worms were washed in
M9 buffer (22 mM KH2PO4, 34 mM NA2HPO4, 86 mM NaCl, 1
mM MgSO4) and pipetted
in calibrant (~50 worms per well) into a Seahorse 96-well plate.
Oxygen consumption rate
was measured six times. One day before the assay, well probes
were hydrated in 175 µL
of Seahorse calibrant solution overnight. The heating incubator
was turned off to allow
the Seahorse machine to reach room temperature before placing
worms inside. Rates of
respiration were normalized to the number of worms per well.
Plate readings were within
20 min of introducing the worms into the well and normalized
relative to the number of
worms per well.

4.5. ATP Production
To measure ATP production, a luminescence-based ATP kit was
used [63]. Approx-
imately 200 age-synchronized worms were collected in
deionized water before being
washed and freeze-thawed three times. A Bioruptor (Diagenode)
was used to sonicate the
worm pellet for 30 cycles of alternating 30 s on and 30 s off.
The pellet was boiled for 15 min
to release ATP and then centrifuged at 11,000× g for 10 min at
4 ◦C before the resulting
supernatant was collected. A Molecular Probes ATP
determination Kit (Life Technologies)
was used to measure ATP. Luminescence was normalized to
protein levels determined by
a Pierce BCA protein determination kit (Thermo Scientific,
Waltham, MA, USA).
4.6. Rate of Movement
To measure rate of movement, thrashing rate in liquid was
assessed using video-
tracking and computer analysis [64]. Approximately 50 day 1
adult worms were placed in
M9 buffer on an unseeded NGM plate. An Allied Vision Tech
Stingray F-145 B Firewire
Camera (Allied Vision, Exton, PA, USA) was used to capture
videos at 1024 × 768 resolution
and 8-bit using the MATLAB image acquisition toolbox. The
wrMTrck plugin for ImageJ
(http://www.phage.dk/plugins) was used to analyze rate of
movement.
4.7. Lifespan

To measure lifespan, worms were placed on nematode growth
media (NGM) agar
plates containing 25 µM 5-fluoro-2′-deoxyuridine (FUdR).
FUdR was used to reduce
progeny development. At a 25 µM concentration of FUdR,
progeny development into
adulthood is not completely prevented in the first generation so
animals were transferred
to fresh plates after 4 days [65]. Worms were moved to fresh
plates weekly and survival
was observed by gentle prodding every 2 days. Lifespan
experiments were conducted with
three replicates of 30 worms each.
4.8. Brood Size
To determine brood size, individual young adult worms were
placed onto agar plates
and transferred every day to new plates until progeny
production stopped. Plates of result-
ing progeny were quantified when adulthood was reached.
Experiments were conducted
with three replicates of five worms each.
http://www.phage.dk/plugins
Int. J. Mol. Sci. 2021, 22, 13447 15 of 19
4.9. Post-Embryonic Development
To measure post-embryonic development (PED), eggs were
moved to agar plates
and left to hatch for 3 h. L1 worms that were newly hatched
were transferred to a new
plate. The PED time was considered the total time from

hatching to the young adult stage.
Experiments were conducted with three replicates of 20 animals
each.
4.10. Quantitative Reverse-Transcription PCR (qPCR)
To quantify mRNA levels, pre-fertile young adult worms were
harvested in Trizol as
previously described [66]. Three biological replicates for N2,
BW-40Q, and BW-Htt74Q
worms were collected to quantify gene expression. A High-
Capacity cDNA Reverse
Transcription kit (Life Technologies/Invitrogen) was used to
convert mRNA to cDNA. A
FastStart Universal SYBR Green kit (Roche) in an AP
Biosystems real-time PCR machine
was used to perform qPCR [67,68]. Primer sequences used:
yfp (L-GACGACGGCAACTACAAGAC, R-
TCCTTGAAGTCGATGCCCTT);
pgp-3 (L-CTGTCTGGTGGACAGAAGCA, R-
AAGAGCTGACGTGGCTTCAT);
alh-12 (L-GCCTTCAAGCTGGAACTGTTT, R-
TTGCCTTTGTCTGAGTATGAGC).
4.11. RNAi
To knockdown gene expression, sequence-verified RNAi clones
from the Ahringer
RNAi library were grown approximately 12 h in LB with 50
µg/mL carbenicillin. Bacteria
cultures were 5× concentrated and seeded onto NGM plates
containing 5 mM IPTG and
50 µg/mL carbenicillin. Plates were incubated at room
temperature for 2 days to induce
RNAi. For the L4 parental paradigm, in which RNAi knockdown

began in the parental
generation, L4 worms were plated on RNAi plates for one day
and then transferred to
a new plate as gravid adults. After 24 h, the worms were
removed from the plates. The
resulting progeny from these worms were analyzed. RNAi
experiments were conducted
at 20 ◦C.
4.12. Experimental Design and Statistical Analysis
All experiments were performed with experimenters blinded to
the genotype of the
worms. Worms used for experiments were randomly selected
from maintenance plates. A
minimum of three biological replicates, in which independent
populations of worms tested
on different days, were performed for each experiment.
Automated computer analysis was
performed in assays where possible to eliminate potential bias.
Power calculations were
not used to determine sample size for experiments, since the
sample size used in C. elegans
studies are typically larger than required for observing a
difference that is statistically
significant. Three biological replicates were used for
measurements of mitochondrial
morphology. At least six replicates of ~50 worms each were
used for measurements of
oxygen consumption. Three biological replicates of ~200 w orms
each were used for ATP
measurements. Three biological replicates of a 60 mm plate of
worms were used for
mRNA measurements. At least three biological replicates of ~40
worms each were used
for the thrashing assays. Three biological replicates of thirty

worms each were used for
lifespan assays. Six individual worms were used for measuring
brood size. Three biological
replicates of twenty-five worms each were used to measure
post-embryonic development
time. GraphPad Prism was used to perform statistical analysis.
One-way, two-way, or
repeated-measures ANOVA were used to determine statistically
significant differences
between groups with Dunnett’s or Bonferroni’s multiple
comparisons test. For analysis
of lifespan, Kaplan-Meier survival plots were graphed, and the
Log-rank test was used to
determine significant differences between the two groups. This
study has no pre-specified
primary endpoint. Sample size calculations were not performed.
5. Conclusions
In this study, we showed that a C. elegans neuronal model of
polyQ toxicity exhibits
deficits in mitochondrial morphology and function, which are
associated with decreased
Int. J. Mol. Sci. 2021, 22, 13447 16 of 19
movement and lifespan. Decreasing the levels of the
mitochondrial fission gene drp-1
through genetic deletion or RNAi increases both movement and
lifespan in Neur-67Q
worms. Similarly, treatment of Neur-67Q worms with RNAi
clones that decrease mito-
chondrial fragmentation results in increased movement and
lifespan. Overall, this work

suggests that decreasing mitochondrial fragmentation may be
beneficial in treating HD
and other polyQ diseases and identifies alternative genetic
targets that circumvent the
negative effects of disrupting DRP-1. Future studies will be
needed to further investigate
the mechanisms by which the genes we identified are beneficial
and to validate these
targets in other models of polyQ diseases.
Supplementary Materials: The following are available online at
https://www.mdpi.com/article/
10.3390/ijms222413447/s1.
Author Contributions: Conceptualization, A.T., E.M., P.D.R.
and J.M.V.R.; methodology, A.T., E.M.,
P.D.R., S.K.S. and J.M.V.R.; validation, A.T., E.M., P.D.R.,
S.K.S. and J.M.V.R.; formal analysis, A.T.,
E.M., P.D.R., S.K.S. and J.M.V.R.; investigation, A.T., E.M.,
P.D.R., S.K.S. and J.M.V.R.; writing—
original draft preparation, E.M. and J.M.V.R.; writing—review
and editing, A.T., E.M., P.D.R., S.K.S.,
M.M.S. and J.M.V.R.; visualization, A.T., E.M., P.D.R., S.K.S.
and J.M.V.R.; supervision, M.M.S. and
J.M.V.R. All authors have read and agreed to the published
version of the manuscript.
Funding: This work was supported by the Canadian Institutes of
Health Research (CIHR;
http://www.cihr- irsc.gc.ca/; (JVR), the Natural Sciences and
Engineering Research Council of
Canada (NSERC; https://www.nserc- crsng.gc.ca/index_eng.asp;
(JVR), the National Institute
of General Medical Sciences (NIGMS;
https://www.nigms.nih.gov/; (JVR) by grant number R01
GM121756 and the Van Andel Research Institute (VARI). JVR

is the recipient of a Senior Research
Scholar career award from the Fonds de Recherche du Québec
Santé (FRQS) and Parkinson
Quebec. AT received scholarships from NSERC and FRQS. SKS
received a scholarship from
FRQS. PDR received a fellowship award from FRQS. The
funders had no role in study design,
data collection and analysis, decision to publish, or preparation
of the manuscript.
Institutional Review Board Statement: Not applicable.
Informed Consent Statement: Not applicable.
Data Availability Statement: All data is available upon request.
Acknowledgments: Some strains were provided by the
Caenorhabditis Genetics Center (CGC), which
is funded by the National Institutes of Health (NIH) Office of
Research Infrastructure Programs (P40
OD010440). We would also like to acknowledge the C. elegans
knockout consortium and the National
Bioresource Project of Japan for providing strains used in this
research.
Conflicts of Interest: The authors declare no conflict of interest.
References
1. Zoghbi, H.Y.; Orr, H.T. Glutamine repeats and
neurodegeneration. Annu. Rev. Neurosci. 2000, 23, 217–247.
[CrossRef]
2. Lieberman, A.P.; Shakkottai, V.G.; Albin, R.L.
Polyglutamine repeats in neurodegenerative diseases. Annu.
Rev. Pathol. Mech. Dis.
2019, 14, 1–27. [CrossRef]

3. Lee, J.M.; Galkina, E.I.; Levantovsky, R.M.; Fossale, E.;
Anne Anderson, M.; Gillis, T.; Srinidhi Mysore, J.; Coser, K.R.;
Shioda, T.;
Zhang, B.; et al. Dominant effects of the huntington’s disease
htt cag repeat length are captured in gene-expression data sets
by a
continuous analysis mathematical modeling strategy. Hum. Mol.
Genet. 2013, 22, 3227–3238. [CrossRef] [PubMed]
4. Lee, J.M.; Ramos, E.M.; Lee, J.H.; Gillis, T.; Mysore, J.S.;
Hayden, M.R.; Warby, S.C.; Morrison, P.; Nance, M.; Ross,
C.A.; et al.
Cag repeat expansion in huntington disease determines age at
onset in a fully dominant fashion. Neurology 2012, 78, 690–
695.
[CrossRef] [PubMed]
5. Costa, V.; Scorrano, L. Shaping the role of mitochondria in
the pathogenesis of huntington’s disease. EMBO J. 2012, 31,
1853–1864.
[CrossRef] [PubMed]
6. Oliveira, J. Nature and cause of mitochondrial dysfunction in
Huntington’s disease: Focusing on huntingtin and the striatum.
J.
Neurochem. 2010, 114, 1–12. [CrossRef] [PubMed]
7. Cornelius, N.; Wardman, J.H.; Hargreaves, I.P.; Neergheen,
V.; Bie, A.S.; Tümer, Z.; Nielsen, J.E.; Nielsen, T.T. Evidence
of
oxidative stress and mitochondrial dysfunction in
spinocerebellar ataxia type 2 (SCA2) patient fibroblasts: Effect
of coenzyme
Q10 supplementation on these parameters. Mitochondrion 2017,
34, 103–114. [CrossRef] [PubMed]

https://www.mdpi.com/article/10.3390/ijms222413447/s1
https://www.mdpi.com/article/10.3390/ijms222413447/s1
http://www.cihr-irsc.gc.ca/
https://www.nserc-crsng.gc.ca/index_eng.asp
https://www.nigms.nih.gov/
http://doi.org/10.1146/annurev.neuro.23.1.217
http://doi.org/10.1146/annurev-pathmechdis-012418-012857
http://doi.org/10.1093/hmg/ddt176
http://www.ncbi.nlm.nih.gov/pubmed/23595883
http://doi.org/10.1212/WNL.0b013e318249f683
http://doi.org/10.1038/emboj.2012.65
http://doi.org/10.1111/j.1471-4159.2010.06741.x
http://doi.org/10.1016/j.mito.2017.03.001
Int. J. Mol. Sci. 2021, 22, 13447 17 of 19
8. Ranganathan, S.; Harmison, G.G.; Meyertholen, K.; Pennuto,
M.; Burnett, B.G.; Fischbeck, K.H. Mitochondrial abnormalities
in
spinal and bulbar muscular atrophy. Hum. Mol. Genet. 2009, 18,
27–42. [CrossRef]
9. Lodi, R.; Schapira, A.H.; Manners, D.; Styles, P.; Wood,
N.W.; Taylor, D.J.; Warner, T.T. Abnormal in vivo skeletal
muscle energy
metabolism in Huntington’s disease and
dentatorubropallidoluysian atrophy. Ann. Neurol. 2000, 48, 72–
76. [CrossRef]
10. Browne, S.E.; Bowling, A.C.; MacGarvey, U.; Baik, M.J.;

Berger, S.C.; Muqit, M.M.; Bird, E.D.; Beal, M.F. Oxidative
damage
and metabolic dysfunction in huntington’s disease: Selective
vulnerability of the basal ganglia. Ann. Neurol. 1997, 41, 646–
653.
[CrossRef]
11. Jenkins, B.G.; Koroshetz, W.J.; Beal, M.F.; Rosen, B.R.
Evidence for impairment of energy metabolism in vivo in
Huntington’s
disease using localized 1h nmr spectroscopy. Neurology 1993,
43, 2689–2695. [CrossRef]
12. Seong, I.S.; Ivanova, E.; Lee, J.M.; Choo, Y.S.; Fossale, E.;
Anderson, M.; Gusella, J.F.; Laramie, J.M.; Myers, R.; Lesort,
M.; et al.
HD CAG repeat implicates a dominant property of huntingtin in
mitochondrial energy metabolism. Hum. Mol. Genet. 2005,
13. Panov, A.V.; Gutekunst, C.A.; Leavitt, B.R.; Hayden, M.R.;
Burke, J.R.; Strittmatter, W.J.; Greenamyre, J.T. Early
mitochondrial
calcium defects in huntington’s disease are a direct effect of
polyglutamines. Nat. Neurosci. 2002, 5, 731–736. [CrossRef]
14. Trushina, E.; Dyer, R.B.; Badger, J.D., 2nd; Ure, D.; Eide,
L.; Tran, D.D.; Vrieze, B.T.; Legendre-Guillemin, V.;
McPherson, P.S.;
Mandavilli, B.S.; et al. Mutant huntingtin impairs axonal
trafficking in mammalian neurons in vivo and in vitro. Mol.
Cell. Biol.
2004, 24, 8195–8209. [CrossRef] [PubMed]
15. Ferro, A.; Carbone, E.; Zhang, J.; Marzouk, E.; Villegas,
M.; Siegel, A.; Nguyen, D.; Possidente, T.; Hartman, J.; Polley,

K.; et al.
Short-term succinic acid treatment mitigates cerebellar
mitochondrial OXPHOS dysfunction, neurodegeneration and
ataxia in a
Purkinje-specific spinocerebellar ataxia type 1 (SCA1) mouse
model. PLoS ONE 2017, 12, e0188425. [CrossRef]
16. Kazachkova, N.; Raposo, M.; Montiel, R.; Cymbron, T.;
Bettencourt, C.; Silva-Fernandes, A.; Duarte-Silva, S.; Maciel,
P.; Lima, M.
Patterns of mitochondrial DNA damage in blood and brain
tissues of a transgenic mouse model of Machado-Joseph disease.
Neurodegener. Dis. 2013, 11, 206–214. [CrossRef] [PubMed]
17. Giorgetti, E.; Yu, Z.; Chua, J.P.; Shimamura, R.; Zhao, L.;
Zhu, F.; Venneti, S.; Pennuto, M.; Guan, Y.; Hung, G.; et al.
Rescue of
metabolic alterations in AR113Q skeletal muscle by peripheral
androgen receptor gene silencing. Cell Rep. 2016, 17, 125–136.
[CrossRef]
18. Rocchi, A.; Milioto, C.; Parodi, S.; Armirotti, A.; Borgia,
D.; Pellegrini, M.; Urciuolo, A.; Molon, S.; Morbidoni, V.;
Marabita, M.;
et al. Glycolytic-to-oxidative fiber-type switch and mTOR
signaling activation are early-onset features of SBMA muscle
modified
by high-fat diet. Acta Neuropathol. 2016, 132, 127–144.
[CrossRef]
19. Wang, H.; Lim, P.J.; Karbowski, M.; Monteiro, M.J. Effects
of overexpression of Huntingtin proteins on mitochondrial
integrity.
Hum. Mol. Genet. 2009, 18, 737–752. [CrossRef]
20. Song, W.; Chen, J.; Petrilli, A.; Liot, G.; Klinglmayr, E.;

Zhou, Y.; Poquiz, P.; Tjong, J.; Pouladi, M.; Hayden, M.R.; et
al. Mutant
huntingtin binds the mitochondrial fission GTPase dynamin-
related protein-1 and increases its enzymatic activity. Nat. Med.
2011, 17, 377–382. [CrossRef]
21. Haun, F.; Nakamura, T.; Shiu, A.D.; Cho, D.H.; Tsunemi,
T.; Holland, E.A.; La Spada, A.R.; Lipton, S.A. S-nitrosylation
of dynamin-
related protein 1 mediates mutant huntingtin-induced
mitochondrial fragmentation and neuronal injury in
Huntington’s disease.
Antioxid. Redox Signal. 2013, 19, 1173–1184. [CrossRef]
[PubMed]
22. Guo, X.; Disatnik, M.H.; Monbureau, M.; Shamloo, M.;
Mochly-Rosen, D.; Qi, X. Inhibition of mitochondrial
fragmentation
diminishes Huntington’s disease–associated neurodegeneration.
J. Clin. Investig. 2013, 123, 5371–5388. [CrossRef] [PubMed]
23. Jin, Y.N.; Yu, Y.V.; Gundemir, S.; Jo, C.; Cui, M.; Tieu, K.;
Johnson, G.V. Impaired mitochondrial dynamics and Nrf2
signaling
contribute to compromised responses to oxidative stress in
striatal cells expressing full-length mutant Huntingtin. PLoS
ONE
2013, 8, e57932. [CrossRef]
24. Joshi, A.U.; Ebert, A.E.; Haileselassie, B.; Mochly-Rosen,
D. Drp1/fis1-mediated mitochondrial fragmentation leads to
lyso-somal
dysfunction in cardiac models of Huntington’s disease. J. Mol.
Cell. Cardiol. 2019, 127, 125–133. [CrossRef]
25. Costa, V.; Giacomello, M.; Hudec, R.; Lopreiato, R.;

Ermak, G.; Lim, D.; Malorni, W.; Davies, K.J.; Carafoli, E.;
Scorrano, L.
Mitochondrial fission and cristae disruption increase the
response of cell models of Huntington’s disease to apoptotic
stimuli.
EMBO Mol. Med. 2010, 2, 490–503. [CrossRef]
26. Machiela, E.; Rudich, P.D.; Traa, A.; Anglas, U.; Soo, S.K.;
Senchuk, M.M.; Van Raamsdonk, J.M. Targeting mitochondrial
network
disorganization is protective in C. elegans models of
Huntington’s disease. Aging Dis. 2021, 12, 1753–1772.
[CrossRef] [PubMed]
27. Cherubini, M.; Lopez-Molina, L.; Gines, S. Mitochondrial
fission in Huntington’s disease mouse striatum disrupts ER-
mitochondria contacts leading to disturbances in Ca2+ efflux
and Reactive Oxygen Species (ROS) homeostasis. Neurobiol.
Dis.
2020, 136, 104741. [CrossRef] [PubMed]
28. Borgia, D.; Malena, A.; Spinazzi, M.; Desbats, M.A.;
Salviati, L.; Russell, A.P.; Miotto, G.; Tosatto, L.; Pegoraro, E.;
Sorarù, G.; et al.
Increased mitophagy in the skeletal muscle of spinal and bulbar
muscular atrophy patients. Hum. Mol. Genet. 2017, 26, 1087–
1103.
[CrossRef]
29. Harmuth, T.; Prell-Schicker, C.; Weber, J.J.; Gellerich, F.;
Funke, C.; Driessen, S.; Magg, J.C.D.; Krebiehl, G.; Wolburg,
H.;
Hayer, S.N.; et al. Mitochondrial morphology, function and
homeostasis are impaired by expression of an N-terminal
calpain
cleavage fragment of ataxin-3. Front. Mol. Neurosci. 2018, 11,

368. [CrossRef]
http://doi.org/10.1093/hmg/ddn310
http://doi.org/10.1002/1531-8249(200007)48:1<72::AID-
ANA11>3.0.CO;2-I
http://doi.org/10.1002/ana.410410514
http://doi.org/10.1212/WNL.43.12.2689
http://doi.org/10.1093/hmg/ddi319
http://doi.org/10.1038/nn884
http://doi.org/10.1128/MCB.24.18.8195-8209.2004
http://doi.org/10.1371/journal.pone.0188425
http://doi.org/10.1159/000339207
http://doi.org/10.1016/j.celrep.2016.08.084
http://doi.org/10.1007/s00401-016-1550-4
http://doi.org/10.1093/hmg/ddn404
http://doi.org/10.1038/nm.2313
http://doi.org/10.1089/ars.2012.4928
http://doi.org/10.1172/JCI70911
http://doi.org/10.1371/journal.pone.0057932
http://doi.org/10.1016/j.yjmcc.2018.12.004
http://doi.org/10.1002/emmm.201000102
http://doi.org/10.14336/ AD.2021.0404
http://doi.org/10.1016/j.nbd.2020.104741
http://doi.org/10.1093/hmg/ddx019
http://doi.org/10.3389/fnmol.2018.00368
Int. J. Mol. Sci. 2021, 22, 13447 18 of 19

30. Ward, J.M.; Stoyas, C.A.; Switonski, P.M.; Ichou, F.; Fan,
W.; Collins, B.; Wall, C.E.; Adanyeguh, I.; Niu, C.; Sopher,
B.L.; et al.
Metabolic and organelle morphology defects in mice and human
patients define spinocerebellar ataxia type 7 as a mitochondrial
disease. Cell Rep. 2019, 26, 1189–1202. [CrossRef]
31. Zhao, Y.; Sun, X.; Qi, X. Inhibition of drp1 hyperactivation
reduces neuropathology and behavioral deficits in zq175 knock-
in
mouse model of huntington’s disease. Biochem. Biophys. Res.
Commun. 2018, 507, 319–323. [CrossRef] [PubMed]
32. Hu, D.; Sun, X.; Magpusao, A.; Fedorov, Y.; Thompson, M.;
Wang, B.; Lundberg, K.; Adams, D.J.; Qi, X. Small-molecule
sup-
pression of calpastatin degradation reduces neuropathology in
models of huntington’s disease. Nat. Commun. 2021, 12, 5305.
[CrossRef] [PubMed]
33. Naia, L.; Carmo, C.; Campesan, S.; Fao, L.; Cotton, V.E.;
Valero, J.; Lopes, C.; Rosenstock, T.R.; Giorgini, F.; Rego,
A.C. Mi-
tochondrial sirt3 confers neuroprotection in Huntington’s
disease by regulation of oxidative challenges and mitochondrial
dynamics. Free Radic. Biol. Med. 2021, 163, 163–179.
[CrossRef]
34. Ishihara, N.; Nomura, M.; Jofuku, A.; Kato, H.; Suzuki,
S.O.; Masuda, K.; Otera, H.; Nakanishi, Y.; Nonaka, I.; Goto,
Y.; et al.
Mitochondrial fission factor Drp1 is essential for embryonic
development and synapse formation in mice. Nat. Cell Biol.
2009,
11, 958–966. [CrossRef]

35. Waterham, H.R.; Koster, J.; van Roermund, C.W.; Mooyer,
P.A.; Wanders, R.J.; Leonard, J.V. A lethal defect of
mitochondrial and
peroxisomal fission. N. Engl. J. Med. 2007, 356, 1736–1741.
[CrossRef]
36. Wakabayashi, J.; Zhang, Z.; Wakabayashi, N.; Tamura, Y.;
Fukaya, M.; Kensler, T.W.; Iijima, M.; Sesaki, H. The dynamin-
related
GTPase Drp1 is required for embryonic and brain development
in mice. J. Cell Biol. 2009, 186, 805–816. [CrossRef] [PubMed]
37. Byrne, J.J.; Soh, M.S.; Chandhok, G.; Vijayaraghavan, T.;
Teoh, J.S.; Crawford, S.; Cobham, A.E.; Yapa, N.M.B.; Mirth,
C.K.;
Neumann, B. Disruption of mitochondrial dynamics affects
behaviour and lifespan in Caenorhabditis elegans. Cell. Mol.
Life Sci.
2019, 76, 1967–1985. [CrossRef]
38. Fahrner, J.A.; Liu, R.; Perry, M.S.; Klein, J.; Chan, D.C. A
novel de novo dominant negative mutation in dnm1l impairs mi-
tochondrial fission and presents as childhood epileptic
encephalopathy. Am. J. Med. Genet. A 2016, 170, 2002–2011.
[CrossRef]
[PubMed]
39. Machiela, E.; Liontis, T.; Dues, D.J.; Rudich, P.D.; Traa,
A.; Wyman, L.; Kaufman, C.; Cooper, J.F.; Lew, L.; Nadarajan,
S.; et al.
Disruption of mitochondrial dynamics increases stress
resistance through activation of multiple stress response
pathways. FASEB
J. 2020, 34, 8475–8492. [CrossRef]
40. Brignull, H.R.; Moore, F.E.; Tang, S.J.; Morimoto, R.I.

Polyglutamine proteins at the pathogenic threshold display
neuron-specific
aggregation in a pan-neuronal caenorhabditis elegans model. J.
Neurosci. 2006, 26, 7597–7606. [CrossRef]
41. Firnhaber, C.; Hammarlund, M. Neuron-specific feeding
RNAi in C. elegans and its use in a screen for essential genes
required for
GABA neuron function. PLoS Genet. 2013, 9, e1003921.
[CrossRef]
42. Calixto, A.; Chelur, D.; Topalidou, I.; Chen, X.; Chalfie, M.
Enhanced neuronal RNAi in C. elegans using SID-1. Nat.
Methods 2010,
7, 554–559. [CrossRef]
43. Ichishita, R.; Tanaka, K.; Sugiura, Y.; Sayano, T.; Mihara,
K.; Oka, T. An RNAi screen for mitochondrial proteins required
to
maintain the morphology of the organelle in Caenorhabditis
elegans. J. Biochem. 2008, 143, 449–454. [CrossRef]
44. Huntington’s Study Group. A novel gene containing a
trinucleotide repeat that is expanded and unstable on
Huntington’s
disease chromosomes. The huntington’s disease collaborative
research group. Cell 1993, 72, 971–983. [CrossRef]
45. Banfi, S.; Servadio, A.; Chung, M.Y.; Kwiatkowski, T.J.;
McCall, A.E.; Duvick, L.A.; Shen, Y.; Roth, E.J.; Orr, H.T.;
Zoghbi, H.
Identification and characterization of the gene causing type 1
spinocerebellar ataxia. Nat. Genet. 1994, 7, 513–520.
[CrossRef]
46. Slow, E.J.; van Raamsdonk, J.; Rogers, D.; Coleman, S.H.;

Graham, R.K.; Deng, Y.; Oh, R.; Bissada, N.; Hossain, S.M.;
Yang, Y.-Z.; et al. Selective striatal neuronal loss in a YAC128
mouse model of Huntington disease. Hum. Mol. Genet. 2003,
47. Mangiarini, L.; Sathasivam, K.; Seller, M.; Cozens, B.;
Harper, A.; Hetherington, C.; Lawton, M.; Trottier, Y.; Lehrach,
H.;
Davies, S.W.; et al. Exon 1 of the HD gene with an expanded
CAG repeat is sufficient to cause a progressive neurological
phenotype in transgenic mice. Cell 1996, 87, 493–506.
[CrossRef]
48. Morley, J.F.; Brignull, H.R.; Weyers, J.J.; Morimoto, R.I.
The threshold for polyglutamine-expansion protein aggregation
and
cellular toxicity is dynamic and influenced by aging in
Caenorhabditis elegans. Proc. Natl. Acad. Sci. USA 2002, 99,
10417–10422.
[CrossRef] [PubMed]
49. Wang, H.; Lim, P.J.; Yin, C.; Rieckher, M.; Vogel, B.E.;
Monteiro, M.J. Suppression of polyglutamine-induced toxicity
in cell and
animal models of huntington’s disease by ubiquilin. Hum. Mol.
50. Parker, A.; Connolly, J.B.; Wellington, C.; Hayden, M.;
Dausset, J.; Neri, C. Expanded polyglutamines in
Caenorhabditis elegans
cause axonal abnormalities and severe dysfunction of PLM
mechanosensory neurons without cell death. Proc. Natl. Acad.
Sci.
USA 2001, 98, 13318–13323. [CrossRef]
51. Nollen, E.A.; Garcia, S.M.; van Haaften, G.; Kim, S.;

Chavez, A.; Morimoto, R.I.; Plasterk, R.H. From the cover:
Genome-wide
RNA interference screen identifies previously undescribed
regulators of polyglutamine aggregation. Proc. Natl. Acad. Sci.
USA
2004, 101, 6403–6408. [CrossRef]
52. Lejeune, F.X.; Mesrob, L.; Parmentier, F.; Bicep, C.;
Vazquez-Manrique, R.P.; Parker, J.A.; Vert, J.P.; Tourette, C.;
Neri, C. Large-scale
functional RNAi screen in C. elegans identifies genes that
regulate the dysfunction of mutant polyglutamine neurons. BMC
Genom.
2012, 13, 91. [CrossRef] [PubMed]
http://doi.org/10.1016/j.celrep.2019.01.028
http://doi.org/10.1016/j.bbrc.2018.11.031
http://doi.org/10.1038/s41467-021-25651-y
http://doi.org/10.1016/j.freeradbiomed.2020.11.031
http://doi.org/10.1038/ncb1907
http://doi.org/10.1056/NEJMoa064436
http://doi.org/10.1083/jcb.200903065
http://doi.org/10.1007/s00018-019-03024-5
http://doi.org/10.1002/ajmg.a.37721
http://doi.org/10.1096/fj.201903235R
http://doi.org/10.1523/JNEUROSCI.0990-06.2006
http://doi.org/10.1371/journal.pgen.1003921
http://doi.org/10.1038/nmeth.1463
http://doi.org/10.1093/jb/mvm245
http://doi.org/10.1016/0092-8674(93)90585-E
http://doi.org/10.1038/ng0894-513
http://doi.org/10.1093/hmg/ddg169

http://doi.org/10.1016/S0092-8674(00)81369-0
http://doi.org/10.1073/pnas.152161099
http://doi.org/10.1093/hmg/ddl017
http://doi.org/10.1073/pnas.231476398
http://doi.org/10.1073/pnas.0307697101
http://doi.org/10.1186/1471-2164-13-91
Int. J. Mol. Sci. 2021, 22, 13447 19 of 19
53. Salin, K.; Auer, S.K.; Rey, B.; Selman, C.; Metcalfe, N.
Variation in the link between oxygen consumption and ATP
production,
and its relevance for animal performance. Proc. Biol. Sci. 2015,
282, 20151028. [CrossRef] [PubMed]
54. Bratic, I.; Trifunovic, A. Mitochondrial energy metabolism
and ageing. Biochim. Biophys. Acta BBA Bioenerg. 2010, 1797,
961–967.
[CrossRef]
55. Lemire, B.D.; Behrendt, M.; DeCorby, A.; Gaskova, D. C.
elegans longevity pathways converge to decrease mitochondrial
membrane potential. Mech. Ageing Dev. 2009, 130, 461–465.
[CrossRef] [PubMed]
56. Cooper, J.F.; Machiela, E.; Dues, D.J.; Spielbauer, K.K.;
Senchuk, M.M.; Van Raamsdonk, J.M. Activation of the
mitochondrial
unfolded protein response promotes longevity and dopamine
neuron survival in parkinson’s disease models. Sci. Rep. 2017,
7, 16441. [CrossRef] [PubMed]

57. Wyatt, J.W.; Korasick, D.A.; Qureshi, I.A.; Campbell, A.C.;
Gates, K.S.; Tanner, J.J. Inhibition, crystal structures, and in-
solution
oligomeric structure of aldehyde dehydrogenase 9A1. Biochem.
Biophys. 2020, 691, 108477. [CrossRef]
58. Lincke, C.R.; Broeks, A.; The, I.; Plasterk, R.H.; Borst, P.
The expression of two P-glycoprotein (pgp) genes in transgenic
Caenorhabditis elegans is confined to intestinal cells. EMBO J.
1993, 12, 1615–1620. [CrossRef]
59. Mahajan-Miklos, S.; Tan, M.W.; Rahme, L.G.; Ausubel,
F.M. Molecular mechanisms of bacterial virulence elucidated
using a
Pseudomonas aeruginosa–Caenorhabditis elegans pathogenesis
model. Cell 1999, 96, 47–56. [CrossRef]
60. Broeks, A.; Janssen, H.W.; Calafat, J.; Plasterk, R.H. A P-
glycoprotein protects Caenorhabditis elegans against natural
toxins. EMBO
J. 1995, 14, 1858–1866. [CrossRef]
61. Dues, D.J.; Andrews, E.K.; Schaar, C.E.; Bergsma, A.L.;
Senchuk, M.M.; Van Raamsdonk, J.M. Aging causes decreased
resistance
to multiple stresses and a failure to activate specific stress
response pathways. Aging 2016, 8, 777–795. [CrossRef]
62. El Mouridi, S.; Lecroisey, C.; Tardy, P.; Mercier, M.;
Leclercq-Blondel, A.; Zariohi, N.; Boulin, T. Reliable
CRISPR/Cas9 Genome
Engineering in Caenorhabditis elegans Using a Single Efficient
sgRNA and an Easily Recognizable Phenotype. G3 Genes
Genomes

63. Wu, Z.; Senchuk, M.M.; Dues, D.J.; Johnson, B.K.; Cooper,
J.F.; Lew, L.; Machiela, E.; Schaar, C.E.; Dejonge, H.;
Blackwell, T.K.; et al.
Mitochondrial unfolded protein response transcription factor
ATFS-1 promotes longevity in a long-lived mitochondrial
mutant
through activation of stress response pathways. BMC Biol.
2018, 16, 147. [CrossRef] [PubMed]
64. Cooper, J.F.; Dues, D.J.; Spielbauer, K.K.; Machiela, E.;
Senchuk, M.M.; Van Raamsdonk, J.M. Delaying aging is
neuroprotective in
parkinson’s disease: A genetic analysis in C. elegans models.
NPJ Parkinson’s Dis. 2015, 1, 15022. [CrossRef] [PubMed]
65. Van Raamsdonk, J.M.; Hekimi, S. FUdR causes a twofold
increase in the lifespan of the mitochondrial mutant gas-1.
Mech. Ageing
Dev. 2011, 132, 519–521. [CrossRef]
66. Schaar, C.E.; Dues, D.J.; Spielbauer, K.K.; Machiela, E.;
Cooper, J.F.; Senchuk, M.; Hekimi, S.; Van Raamsdonk, J.M.
Mitochondrial
and cytoplasmic ros have opposing effects on lifespan. PLoS
Genet. 2015, 11, e1004972. [CrossRef]
67. Machiela, E.; Dues, D.J.; Senchuk, M.M.; Van Raamsdonk,
J.M. Oxidative stress is increased in C. elegans models of
Huntington’s
disease but does not contribute to polyglutamine toxicity
phenotypes. Neurobiol. Dis. 2016, 96, 1–11. [CrossRef]
68. Senchuk, M.M.; Dues, D.J.; Schaar, C.E.; Johnson, B.K.;
Madaj, Z.B.; Bowman, M.J.; Winn, M.E.; Van Raamsdonk, J.M.
Activation

of daf-16/foxo by reactive oxygen species contributes to
longevity in long-lived mitochondrial mutants in Caenorhabditis
elegans.
PLoS Genet. 2018, 14, e1007268. [CrossRef]
http://doi.org/10.1098/rspb.2015.1028
http://doi.org/10.1016/j.bbabio.2010.01.004
http://doi.org/10.1016/j.mad.2009.05.001
http://doi.org/10.1038/s41598-017-16637-2
http://doi.org/10.1016/j.abb.2020.108477
http://doi.org/10.1002/j.1460-2075.1993.tb05806.x
http://doi.org/10.1016/S0092-8674(00)80958-7
http://doi.org/10.1002/j.1460-2075.1995.tb07178.x
http://doi.org/10.18632/aging.100939
http://doi.org/10.1534/g3.117.040824
http://doi.org/10.1186/s12915-018-0615-3
http://doi.org/10.1038/npjparkd.2015.22
http://doi.org/10.1016/j.mad.2011.08.006
http://doi.org/10.1016/j.nbd.2016.08.008
Copyright of International Journal of Molecular Sciences is the
property of MDPI and its
content may not be copied or emailed to multiple sites or posted
to a listserv without the
copyright holder's express written permission. However, users
may print, download, or email
articles for individual use.

Introduction Results Mitochondrial Morphology Is Disrupted in
a Neuronal Model of Polyglutamine Toxicity Differences in
Mitochondrial Morphology in Neuronal Model of Polyglutamine
Toxicity Are Exacerbated with Increasing Age Neuronal Model
of Polyglutamine Toxicity Exhibits Altered Mitochondrial
Function Disruption of Mitochondrial Fission Is Beneficial in a
Neuronal Model of Polyglutamine Toxicity Disruption of
Mitochondrial Fission Decreases Mitochondrial Fragmentation
in Neurons Targeting Genes That Affect Mitochondrial
Fragmentation Improves Thrashing Rate and Lifespan in a
Neuronal Model of Polyglutamine Toxicity Discussion CAG
Repeat Expansion Disrupts Mitochondrial Morphology and
Function in Neurons Tissue-Specific Effects of Disrupting
Mitochondrial Fission Decreasing Mitochondrial Fragmentation
as a Therapeutic Strategy for Polyglutamine Diseases Materials
and Methods Strains Generation of Strains to Monitor
Mitochondrial Morphology in GABA Neurons Confocal Imaging
and Quantification Oxygen Consumption ATP Production Rate
of Movement Lifespan Brood Size Post-Embryonic
Development Quantitative Reverse-Transcription PCR (qPCR)
RNAi Experimental Design and Statistical Analysis Conclusions
References
http://dx.doi.org/10.14336/AD.2021.0404
*Correspondence should be addressed to: Dr. Jeremy M. Van
Raamsdonk, McGill University, MeDiC and BRaIN Programs,
McGill
University Health Centre, Quebec, Canada.

Email:[email protected] #these authors equally contributed this
work.
Copyright: © 2021 Machiela E et al. This is an open-access
article distributed under the terms of the Creative Commons
Attribution
License, which permits unrestricted use, distribution, and
reproduction in any medium, provided the original author and
source are credited.
ISSN: 2152-5250
1753
Original Article
Targeting Mitochondrial Network Disorganization is
Protective in C. elegans Models of Huntington’s Disease
Emily Machiela1,#, Paige D. Rudich2,3,#, Annika Traa2,3,#,
Ulrich Anglas2,3, Sonja K. Soo2,3,
Megan M. Senchuk1, Jeremy M. Van Raamsdonk1,2,3,4,5,*
1
Laboratory of Aging and Neurodegenerative Disease, Center for
Neurodegenerative Science, Van Andel

Research Institute, Grand Rapids MI 49503, USA
2
Department of Neurology and Neurosurgery, McGill University,
Montreal, Quebec, H4A 3J1, Canada
3
Metabolic Disorders and Complications Program, and Brain
Repair and Integrative Neuroscience Program,
Research Institute of the McGill University Health Centre,
Montreal, Quebec, H4A 3J1, Canada
4
Division of Experimental Medicine, Department of Medicine,
McGill University, Montreal, Quebec, Canada
5
Department of Genetics, Harvard Medical School, Boston MA
02115, USA
[Received January 2, 2021; Revised April 3, 2021; Accepted
April 3, 2021]
ABSTRACT: Huntington’s disease (HD) is an adult-onset
neurodegenerative disease caused by a trinucleotide
CAG repeat expansion in the HTT gene. While the pathogenesis
of HD is incompletely understood, mitochondrial
dysfunction is thought to be a key contributor. In this work, we
used C. elegans models to elucidate the role of
mitochondrial dynamics in HD. We found that expression of a
disease-length polyglutamine tract in body wall

muscle, either with or without exon 1 of huntingtin, results in
mitochondrial fragmentation and mitochondrial
network disorganization. While mitochondria in young HD
worms form elongated tubular networks as in wild-
type worms, mitochondrial fragmentation occurs with age as
expanded polyglutamine protein forms aggregates.
To correct the deficit in mitochondrial morphology, we reduced
levels of DRP-1, the GTPase responsible for
mitochondrial fission. Surprisingly, we found that disrupting
drp-1 can have detrimental effects, which are
dependent on how much expression is decreased. To avoi d
potential negative side effects of disrupting drp-1, we
examined whether decreasing mitochondrial fragmentation by
targeting other genes could be beneficial. Through
this approach, we identified multiple genetic targets that rescue
movement deficits in worm models of HD. Three
of these genetic targets, pgp-3, F25B5.6 and alh-12, increased
movement in the HD worm model and restored
mitochondrial morphology to wild-type morphology. This work
demonstrates that disrupting the mitochondrial
fission gene drp-1 can be detrimental in animal models of HD,
but that decreasing mitochondrial fragmentation
by targeting other genes can be protective. Overall, this study
identifies novel therapeutic targets for HD aimed

at improving mitochondrial health.
Key words: Huntington’s disease, mitochondria, mitochondrial
dynamics, C. elegans, neuroprotection, genetics,
neuroprotection, neurodegeneration, aggregation, DRP1, animal
model
Huntington’s disease (HD) is an autosomal dominant
neurodegenerative disease caused by an expansion of the
polyglutamine tract in the N-terminal of the huntingtin
(Htt) protein. The expression of the expanded
polyglutamine tract is both necessary and sufficient for
cellular toxicity [1], although loss of wild-type huntingtin
function might also contribute to disease pathogenesis [2].
HD is characterized by progressive cognitive decline,
neuropsychiatric abnormalities, and motor impairment
[3]. In unaffected individuals, the polyglutamine tract of
the Htt protein is polymorphic, containing from 9-34
glutamines. However, mutations in the HD gene leading

Volume 12, Number 7; 1753-1772, October 2021
http://dx.doi.org/10.14336/AD.2021.0404
mailto:[email protected]
Machiela E., et al
Mitochondrial dynamics and HD
Aging and Disease • Volume 12, Number 7, October 2021
1754
to 35 or more glutamines have been shown to cause HD.
Within the disease range of 35 glutamines and above, age
of onset negatively correlates with the number of
glutamines present [4, 5]. Although Htt is expressed in
every cell of the body and pathology has been observed in
multiple tissues, cellular dysfunction and atrophy are most
severe in the GABAergic medium spiny neurons of the
striatum. The reasons for this selective vulnerability are
still unknown.
While the cause of cellular dysfunction in HD is still

incompletely understood, mitochondrial dysfunction is
thought to play a central role in disease pathogenesis [6,
7]. There is significant evidence for mitochondrial
dysfunction in HD patients and animal models including
decreased activity of complexes in the electron transport
chain [8], increased lactate production in the brain [9],
decreased levels of ATP production [10], decreased
mitochondrial membrane potential [11], and impaired
trafficking of mitochondria within the cell [12]. The
importance of mitochondrial dysfunction to HD
pathogenesis is also suggested by the fact that systemic
administration of 3-nitropropionic acid, a neurotoxin that
inhibits mitochondrial function, can reproduce symptoms
and neuropathological deficits that occur in HD [13, 14].
In addition, a genome-wide association study
investigating genetic modifiers for age of onset of HD
found pathways involving mitochondrial fission to
significantly modify age of onset of the disease [15].

Recent work has demonstrated that mitochondrial
dynamics are disrupted in HD. Mitochondria continually
change their shape in response to the needs of the cell, and
these changes impact both the function and distribution of
the mitochondria. Mitochondrial morphology is
determined by two opposing processes: fission and fusion.
Mitochondrial fission results in an increase in
mitochondrial fragmentation as new mitochondria are
pinched off of existing mitochondria or mitochondrial
networks. The fission process is mediated by dynamin-
related protein 1 (DRP-1/DRP1) with the help of
mitochondrial fission proteins (FIS-1/FIS-2/FIS1) and
mitochondrial fission factors (MFF-1/MFF-2/MFF1).
Conversely, mitochondrial fusion leads to decreased
mitochondrial fragmentation by joining individual
mitochondria together with other mitochondria to form
interconnected mitochondrial networks. The fusion
process requires merging of the inner mitochondrial

membrane by optic atrophy protein 1 (EAT-3/OPA1) and
the merging of the outer mitochondrial membrane by
mitofusin (FZO-1/MFN).
In HD cell lines [16-21], the 3-nitropropionic acid
neurotoxin model of HD [22], cells from HD mouse
models [23] and cells derived from HD patients [19, 23],
it has been found that mitochondria are more fragmented
than in unaffected controls. In addition, examination of
mitochondria by electron microscopy in brain sections
from R6/2 mice [20] and YAC128 mice [17] revealed the
presence of smaller mitochondria in HD mice compared
to controls, suggesting that increased mitochondrial
fragmentation also occurs in vivo. In these studies, it has
been shown that the expression of exon 1 fragments of
mutant Htt is sufficient to cause mitochondrial
fragmentation [16-18]. The increase in mitochondrial
fragmentation in HD could result from excess
mitochondrial fission, decreased mitochondrial fusion or

both. While the precise mechanism by which mutant Htt
causes mitochondrial fragmentation is still unclear,
contributing factors may include: alterations in expression
levels of fission and fusion proteins [20, 24, 25], an
increase in DRP-1 enzymatic activity resulting from
increased interaction with mutant Htt [17, 26], increased
S-nitrosylation of DRP-1 leading to increased fission
activity [18], increased levels of reactive oxygen species
[22, 27], decreased Nrf2 signaling [20], and increased
calcineurin activity [23].
Importantly, reducing mitochondrial fragmentation
has been shown to be beneficial in models of HD.
Decreasing the activity or expression of the mitochondrial
fission protein DRP-1 increases survival in cell models of
HD [16, 17, 19]. In addition, treating a worm model of
HD expressing exon 1 fragment of mutant Htt with 74
CAG repeats in body wall muscle with RNAi against drp-
1 improved the movement deficit present in these worms,

although the effect of this treatment on mitochondrial
morphology in these worms was not assessed [16].
Furthermore, treatment of the R6/2 mouse model of HD
with a DRP-1 inhibitor (P110-Tat) improved behavior,
survival and neuropathology in these mice, and resulted
in a significant increase in cristae area in electron
micrographs [19]. The P110-Tat DRP-1 inhibitor was also
able to ameliorate mitochondrial structural deficits in the
hearts of R6/2 mice, indicating that this inhibitor can also
be effective in muscle tissue [21]. Combined, these
results suggest that developing interventions that inhibit
DRP-1 may be beneficial in the treatment of HD.
In this work, we explore the role of mitochondrial
fragmentation in the pathogenesis of HD, and whether
targeting this deficit may be an effective strategy to treat
HD. To do this, we use C. elegans models, which permit
the visualization of mitochondrial morphology in a live
organism that exhibits quantifiable, disease-relevant

phenotypic deficits. We find that C. elegans models of HD
exhibit mitochondrial fragmentation, which is temporally
correlated with polyglutamine aggregation. We find that
decreasing levels of drp-1 fails to correct the deficit in
mitochondrial morphology and can be detrimental,
depending on the level of disruption. In contrast, treating
worms with other RNAi clones that decrease
Machiela E., et al
1755
mitochondrial fragmentation improved movement in
worm models of HD.
MATERIALS AND METHODS
Strains
The following strains were used in this study:

N2 (WT)
JVR240 syIs243[Pmyo-3::TOM20:RFP] referred to as
mitoRFP
MQ1699 Punc-54::Htt28Q:GFP referred to as BW-
Htt28Q
MQ1698 Punc-54::Htt74Q:GFP referred to as BW-
Htt74Q
AM138 rmIs120[Punc-54::24Q:YFP] referred to as
BW-24Q
AM141 rmIs133[Punc-54::40Q:YFP] referred to as
BW-40Q
MQ1753 drp-1 (tm1108)
JVR248 Punc-54::Htt28Q:GFP;syIs243[Pmyo-
3::TOM20:RFP]
3::TOM20:RFP]
JVR251 drp-1(tm1108);Punc-54::Htt74Q:GFP
JVR255 drp-1(tm1108);syIs243[Pmyo-3::TOM20:RFP]

JVR259 drp-1(tm1108);Punc-
54::Htt74Q:GFP;syIs243[Pmyo-3::TOM20:RFP]
JVR473 syIs243[Pmyo-3::TOM20:RFP];rol-6(su1006)
JVR474 rmIs120[Punc-54::24Q:YFP];syIs243[Pmyo-
3::TOM20:RFP];rol-6(su1006)
JVR475 rmIs133[Punc-54::40Q:YFP];syIs243[Pmyo-
3::TOM20:RFP]; rol-6(su1006)
JVR521 drp-1(tm1108);Punc-
54::Htt74Q:GFP;syIs243[Pmyo-3::TOM20:RFP]; rol-
6(su1006)
All strains were maintained at 20°C on NGM plates
seeded with OP50 bacteria. All crosses were confirmed by
genotyping using PCR and, where applicable, confirmed
by fluorescent microscopy.

Confocal imaging and quantification
Mitochondrial morphology was imaged and quantified
using worms that express mitochondrially-targeted RFP
specifically in body wall muscle (syIs243[Pmyo-
3::TOM20:RFP]). In order to facilitate imaging, these
worms were crossed into a rol-6 background. The rol-6
mutation results in animals moving in a twisting motion,
thus displaying a helix of muscle cells upon imaging
(Supplementary Fig. 1). This is beneficial when imaging
the mitochondria of body wall muscle cells in the
nematode as it ensures that several portions of both the
ventral and dorsal quadrants of muscle cells are within the
plane of view (facing the objective lens). This facilitates
mitochondrial imaging as the tubular mitochondrial
organization can be seen within much of the muscle.
Without the rol-6 mutation, the lateral side of the
nematode may face the objective lens with only the

longitudinal edges of the muscle being visible, thus
making it difficult to observe mitochondrial organization.
To image the mitochondria, approximately 20 young
adult worms were mounted on 2% agar pads and
immobilized using 10 µM levamisole. Worms were
imaged under a 63x objective lens on a Zeiss LSM 780 or
Nikon A1R Ti confocal microscope. All conditions were
kept the same for all images. For representative images, a
z-stack of images spaced 0.125-0.40 µm apart were
collected and a z-stack projection was created using either
Nikon Elements or ImageJ to compress stacks into a
single image.
For quantification, a single plane image taken in the
same body region for each worm was used to avoid the
complication of mitochondria being present in two planes.
This slice was made binary using the Nikon Elements
thresholding tool. A background subtraction of a constant
50 was applied. Next, a pixel picker was applied to

several control mitoRFP images to define the low and
high threshold levels. Once optimum threshold numbers
were defined for control images, these limits were applied
to all images to be quantified with the separate function
on. Size and circularity were not used to define thresholds.
Prior to creating the binary mask, images were manually
inspected for proper threshold parameters. In the event
that threshold parameters mislabeled mitochondria,
objects were manually included or excluded prior to
masking. Mitochondrial circularity, number, and area
were measured using the measure objects tool in Nikon
Elements AR after the threshold mask was applied. For
mitochondrial circularity, raw numbers were exported to
Microsoft Excel and averages were calculated prior to
statistical analysis in Graphpad Prism. All other
calculations were exported directly to Prism for analysis.
Oxygen consumption

Basal oxygen consumption rate was measured using a
Seahorse XFe96 analyzer (Seahorse bioscience Inc., North
Billerica, MA, USA)[28]. Synchronized worms at day 1
of adulthood were cleaned in M9 buffer (22 mM KH2PO4,
34 mM NA2HPO4, 86 mM NaCl, 1 mM MgSO4). Cleaned
nematodes were pipetted in calibrant (~50 worms per
well) into a Seahorse 96-well plate. Oxygen consumption
was measured six times and rates of respiration were
Machiela E., et al
1756
normalized to the number of worms in each individual
well. The plate readings were begun within 20 minutes of
introduction of the worms into the well. Reading from
each well were normalized relative to the number of
animals per well. Well probes were hydrated in a 175 µL
Seahorse calibrant overnight before this assay was begun.

We found it is important to turn off the heating incubator
to allow the Seahorse machine to reach room temperature
before placing nematodes inside the machine. For these
experiments, we chose to measure oxygen consumption
per worm so that we could compare the rate of oxidative
phosphorylation for the whole organism to the whole
organism phenotypes that we were measuring (e.g.
movement and lifespan). Also, we chose to use a Seahorse
extracellular flux analyzer to measure oxygen
consumption so that all of the strains being compared
could be measured at the same time so that the conditions
would be identical. With the low number of worms that
are used in each well, it would be difficult to accurately
measure protein content, especially given that worms will
often stick to pipet tips or the side of the dish during
transfer.
ATP production

ATP levels were measured using a luminescence-based
ATP kit [29]. Approximately 200 worms were age-
synchronized by a limited lay. Worms were collected in
de-ionized water, washed, and freeze-thawed three times.
The resulting pellet was sonicated in a Bioruptor
(Diagenode) with 30 cycles of 30 seconds on, 30 seconds
off. The pellet was boiled for 15 minutes to release ATP,
supernatant was collected and measured using a
Molecular Probes ATP determination Kit (Life
Technologies). Luminescence was normalized to protein
content, which was measured with a Pierce BCA protein
determination kit (Thermo Scientific).
Rate of movement
For measuring the effects of drp-1, the rate of movement
was assessed by measuring thrashing rate in liquid using
video-tracking and computer analysis [30].

Approximately 50 pre-fertile day 1 young adult worms
were placed in M9 buffer on a clean NGM plate. Videos
were taken with an Allied Vision Tech Stingray F-145 B
Firewire Camera (Allied Vision, Exton, PA, USA) at
1024×768 resolution, 8-bit using the MATLAB image
acquisition toolbox. Analysis was performed using
wrMTrck plugin for ImageJ (publicly available at
www.phage.dk/plugins).
For screening the mitochondrial fragmentation genes,
the rate of movement was assessed by measuring absolute
crawling speed and thrashing rate using WormLab
2019.1.2 (MBF BioSciences). Experiments were done on
day 1 adults, and the animals were isolated as L4’s 24 hrs
before. Animals were exposed to RNAi using the parental
paradigm, or if the RNAi clone inhibited development, the
animals were grown on empty vector RNAi and placed on
the respective RNAi clone as L4’s (E04A4.4, C33A12.1,

abhd-11.1, iars-1, his-12 and acs-1). For the experiment,
worms were removed from their plates with M9 buffer,
washed twice with M9 buffer, and placed on clean 3-cm
NGM plates. A Kimwipe was used to remove excess
liquid and the worms were allowed to acclimate for 5
minutes. The plates were placed under a monochrome
digital camera (Basler acA2440 camera with an AF Micro
Nikkor 60 mm f/2.8 D lens) and tapped to stimulate
movement. 20-30 animals were normally in frame. The
worms were recorded using the WormLab software
(Version 2019.1.2), in 45 s long videos with a resolution
recorded at a frame rate of 7.5 frames/s. After recording
crawling, M9 buffer was added to the plate. Worms were
allowed to acclimate for 5 minutes and then recorded
while swimming at a frame rate of 14 frames/s. Worms
that were tracked for less than half of the video were
excluded from the analysis because the worms could have

left the field-of-view and then returned, causing double
counting. Crawling speed and thrashing rates were
analyzed using the Absolute Peristaltic Speed results and
Wave Initiation Rate results, respectfully, exported from
WormLab and processed using Microsoft Excel 2016
(Microsoft, Redmond, WA, USA). 3 replicates of ~20
worms were performed for each RNAi clone.
Imaging and quantification of aggregation
Experimental animals were day 1 adults and were isolated
at the L4 stage 24 hours before the experiments. Animals
were exposed to RNAi using the parental paradigm, or if
the RNAi clone inhibited development, the animals were
grown on empty vector RNAi and placed on the respective
RNAi clone as L4’s (E04A4.4, C33A12.1, abhd-11.1,
iars-1, his-12 and acs-1). 10 animals were mounted on 3%
agarose pads using 10mM levamisole for anesthesia and
imaged within 45 minutes of levamisole exposure. Images

were taken on a Nikon Eclipse Ti microscope with a
Nikon Plan Apo 20x/0.75 NA objective and a Zyla Andor
sCM05 camera. z-stacks of the animals were recorded
(Version 2.1.0/1.53c) by merging the z-stack using
Temporal-Color Code to color code the different z planes,
and then the aggregates were manually counted using the
Cell Counter plugin. At least 10 animals per clone were
http://www.phage.dk/plugins
Machiela E., et al
1757
quantified. Clones which caused a measurable decrease
were repeated for confirmation.
Lifespan
Lifespan was determined on nematode growth media

(NGM) agar plates with 25 μM 5-fluoro-2′-deoxyuridine
(FUdR) in order to reduce the development of progeny.
Plates with 25 μM FUdR do not completely prevent the
development of progeny to adulthood in the first
generation so animals were transferred to fresh agar plates
after 4 days [31]. After the initial transfer, worms were
moved to fresh plates weekly. Animal survival was
observed every 2 days by gentle prodding. Three
replicates of 30 animals each were completed.
Brood size
Brood size was determined by placing individual young
adult staged animals onto agar plates with daily transfers
to new plates until progeny production ceased. The
resulting progeny were allowed to develop to adulthood
before quantification. Three replicates of 5 animals each
were completed.
Post-embryonic development

International Journal of Molecular SciencesArticle

International Journal of Molecular SciencesArticle

Recommended

Recommended

More Related Content

Similar to International Journal of Molecular SciencesArticle

Similar to International Journal of Molecular SciencesArticle (20)

More from MargaritoWhitt221

More from MargaritoWhitt221 (20)

Recently uploaded

Recently uploaded (20)

International Journal of Molecular SciencesArticle