SlideShare a Scribd company logo
1 of 32
In silico analysis of the impact of SNPs/SNP
haplotypes on protein structure and function in
autosomal dominant polycystic kidney disease
Dr. P. VEERAMUTHUMARI, M.Sc., M.Phil., B.Ed., PGDCA., Ph.D.,
ASSISTANT PROFESSOR OF ZOOLOGY
DEPARTMENT OF ZOOLOGY
V.V. VANNIAPERUMAL COLLEGE FOR WOMEN,
VIRUDHUNAGAR – 626 001
Mail id.: muthusdream@gmail.com; veeramuthumari@vvvcollege.org
13 July 2020
Introduction
 Polycystic kidney disease (PKD) is a disorder in which clusters of cysts develop
within the kidneys.
 Polycystic kidney disease (PKD) is the most common genetic, life threatening
disease, affecting more than 12.5 million people worldwide
 The polycystic kidney diseases are the most common hereditary nephropathies
and constitute one of the leading causes of end-stage renal disease (Persu et al.,
2002) .
 There are two types of PKD
Autosomal recessive polycystic kidney disease (ARPKD)
Autosomal dominant polycystic kidney disease (ADPKD)
 Occurrence of ADPKD is 1: 400 to 1 :1000 in common population.
(Constantinides et al., 1997, Koptides et al., 1999, 2000)
 Caused due to mutation in
(i) PKD1(85%) -16p13.3- polycystin 1
(ii) PKD2(15%)- 4q21- polycystin 2
(Pei et al., 1998, Koptides et al., 1999, 2000)
PKD1 gene is located on chromosome 16p13.3
PKD1 gene has 46 exon distributed over 52kb of genomic DNA
Produces polycystine 1 - 4302 amino acids
PKD1 gene
Chromosome location of PKD1 gene
PKD1 GENE LOCATION
Single nucleotide polymorphism and ADPKD
:
It is a single gene disorder, affecting approximately 1/500 individuals in
worldwide (Caucasian, China, Spain, Cyprus, Netherland, UK) populations (Ding et al.,
2002). ADPKD is characterized by progressive enlargement of cysts in the kidney, often
leading to end –stage renal failure disease (ESRD) in adult life.
… Torra et al., (1999) (UK) reported a mutation that involves
Substitution
Deletion of (2511 AG-C),
Inversion
G C transversion
Missense mutation
. Most of these mutations are expected to lead to the formation of shortened,
truncated proteins lacking the carboxyl terminus of PKD2 gene products. These
truncating mutations suggest that ADPKD is caused by the lack of normal protein.
Hence, the current study focused on PKD gene in polycystic kidney disease.
Cyst formation in nephron, kidney and at cellular level: (Hannah &caplan, 2010)
Mechanisms of cyst formation:
ADPKD is genetically dominant at the organism level and it is recessive at the cellular level.
The kidneys of an ADPKD patient who inherits one mutated copy of polycystin-1 or polycystin-2 from a
parent will develop and function normally into adulthood. Cysts will form in this patient’s kidneys and
several studies suggests that the cells which line these cysts will have lost both functional copies of a
polycystin gene (Qian et al., 1996; Brasier & Henske 1997)
Defects in the genes encoding PC1 and PC2 lead to aberrant gene transcription, cell proliferation, and
ion secretion, which in turn results in the formation of fluid-filled cysts. As cysts ballon out from
individual nephrons, their collective effects leads to the displacement of the normal renal parenchyma and the
formation of a cyst-filled kidney with reduced functional capacity.
Why the study is focused on PKD gene polymorphism?
PKD1 and PKD2 genes encode polycystins 1 and 2
Functions of Gene products:
Polycystins 1 and 2 are considered to be part of a common
development pathway that involves cell-cell and cell-
matrix interactions leading to the transfer of signal.
They work together to help regulate cell growth, cell division,
cell movement and interaction with other cells.
Their interaction in renal tubules promote the normal
development and function of kidney.
OBJECTIVES:
• To study the association between PKD1 and PKD2 gene
polymorphism and autosomal dominant polycystic kidney disease
(ADPKD) in patients and control group among South Indian
(Madurai) population.
• To analyse SNP database of PKD gene polymorphism.
• To Design the 3D structure of polycystin-1 proteins and locate the
SNP.
 Sample collection :
ADPKD Patients within the age group of 10-80 years of both sexes
were selected.
Sample Size:
PKD patients : 300
Control subjects : 300
SURVEY & SAMPLE COLLECTION
Blood samples free from any infectious disease and related data were collected
by using questionnaire from the Department of Nephrology, Madurai Government
Rajaji hospital, and Madurai kidney transplantation and research Centre, Madurai,
Tamil Nadu..
CellsThe blood samples DNA PCR
Gene Sequencing
RFLP
Locating Polymorphism In
Protein Structure
II. Steps involved 3D structure prediction:
• Database search against protein sequences
protein structures
• Conserved domain
• Secondary structure prediction
• Three dimensional structure prediction by threading (MUSTER
server), (http://zhanglab.ccmb.med.umich.edu/MUSTER/), MODELLER,
version 8.2
I. SNP database analysis – http://www.ncbi.nlm.nih.gov/snp
GENETIC STUDY
I. Conformation of genomic DNA
DNA
100bp
Gene PKD1
Location CR16
Type SNP
Location Exon45
Substitutio
n
Ala/Val (C/T)
PCR primer
sequences
F
5’AGCTGTACGCCCTCACTGG-
3’
R:5’GTGACAGGTGCCAGGACT
C-3
Size 298bp
L2-L8-298bp
Conformation PCR product of PKD1
(Ala/Val4058) gene
L1-100bpMarker
L1 L2 L3 L4 L5 L6 L7 L8
Conformation RFLP product of PKD1
(Ala/Val4058) gene genotype frequency
L1 L2 L3 L4 L5 L6 L7 L8
298bp
225bp
73bp
L1-100bpMarker
CC Normal homozygous
CT Mutant heterozygous
TT Mutant homozygous
The PKD1 (C/T) single nucleotide polymorphism also confirmed by sequencing
the PCR amplified gene products of PKD1
Ala
5’ - AAG CTG TAC GCC CTC ACT GG- 3’ – Wild type Allele
Val
5’ - AAG CTG TAC GTC CTC ACT GG- 3’ - Mutant Allele
Nucleotide sequence of PKD1 gene :(C/T polymorphism)
Wild
CGCCGTGGCCGAGGCCCGTACTTGGCACAGGGAAGGGCGCTGGCGCGTGCTGCGGC
TCGGAGCCTGGGCGCGGTGGCTGCTGGTGGCGCTGACGGCGGCCACGGCACTGGTAC
GCCTCGCCCAGCTGGGTGCCGCTGACCGCCAGTGGACCCGTTTCGTGCGCGGCCGCC
CGCGCCGCTTCACTAGCTTCGACCAGGTGGCGCAGCTGAGCTCCGCAGCCCGTGGCC
TGGCGGCCTCGCTGCTCTTCCTGCTTTTGGTCAAGGCTGCCCAGCAGCTACGCTTCGT
GCGCCAGTGGTCC
Mutant
CGCCGTGGCCGAGGCCCGTACTTGGCACAGGGAAGGGCGCTGGCGCGTGCTGCGGC
TCGGAGCCTGGGCGCGGTGGCTGCTGGTGGCGCTGACGGCGGCCACGGCACTGGTAC
GCCTCGCCCAGCTGGGTGCCGCTGACCGCCAGTGGACCCGTTTCGTGCGCGGCCGCC
CGCGCCGCTTCACTAGCTTCGACCAGGTGGCGCAGCTGAGCTCCGCAGCCCGTGGTC
TGGCGGCCTCGCTGCTCTTCCTGCTTTTGGTCAAGGCTGCCCAGCAGCTACGCTTCGT
GCGCCAGTGGTCC
Comparison of genotype and allelic frequency of PKD1
(Ala/Val4058) gene in control subjects and ADPKD subjects
T/T – Homozygous mutant C/T – Heterozygous mutant C/C–Homozygous normal
Number indicates number of individuals having the genotype and number of individuals
( in percentage)
GENOTYPE Allele frequency χ2
value
p value
T/T C/T C/C T C 14.16 P<0.05
9.488
Control
subjects
N=300
87
(29%)
82
(27.33%)
131
(43.67%)
0.425 0.575
ADPKD
subjects
N= 300
143
(47.67%)
99
(33%)
58
(19.33%)
0.642 0.358 13.93
The present study worked on the genotype and allele data of PKD1gene from
SNP database and demonstrated the occurrence of A/G and C/T is more when
compounded with other SNPs available for PKD1 gene.
Region found
Coding Synonymous codon 283
Intron SNP 661
Coding non Synonymous codon 148
UTR (5’ &3’) 35
Splice site No item
Locus region No item
Stop gained, No SNP 16
ANNOTATION
OMIM 36
SNP Protein sequence 359
SNP 3D structure 2
Pubmed 37
Cited in Pubmed 28
Nucleotide sequence 28
PKD1 protein sequence search against
protein sequence database
POLYCYSTIN -1 Database search against sequences
PKD1 protein sequence search
against protein structure database
PKD1 protein sequence structure
database hits
POLYCYSTIN -1 conserved domain
Polycystin 1 Secondary structure prediction
Polycystin 1 Cation channel model
- Wild
Polycystin 1 Cation channel model
- mutant
DISCUSSION
From this study, it is found that, there is association between PKD1
(Ala/Val4058, C/T) gene polymorphism and the severity of the disease in ADPKD
subjects among South Indian (Madurai) population. This finding also enables us to
understand the pathogenesis of ADPKD.
In order to understand the molecular mechanism of ADPKD completely, one
must screen the duplicated area, the promoter region, and the introns of PKD1 and 2
genes in each population (Ding et al., 2009).
Currently there is no effective therapy for ADPKD or ARPKD.
Kidney transplantation and dialysis are the only methods that can be
performed to prolong life.
Current therpeutic approaches involve the use of caspase inhibitors, Cyclin-
dependent kinases (CKD) inhibitors, Triptolide, and mammalian target of rapamycin
(mTOR) inhibitors. (Tao, et al., 2005, Bukanov, et.al., 2006, Torres, et.al., 2007,
Leuenroth, et al., 2007).
The structural study of the protein by biocomputing method is
confirmed the absence of structural significance of a protein and such
protein might be affects an important domain in the protein structure
(Gomez et al., (2009)
Bioinformatics is also found to be become a powerful tool
in genetic mapping, association studies, diversity analysis and positional
cloning (Rafalski, 2010, Galeano et al., 2012).
The emergence of bioinformatics is provided a platform to
explore diseases at the molecular level using computational techniques.
Insilico methods are mainly harnessed to reduce the time, coat and risk
associated with Drug discovey (Shoba et al., 2010).
Hence the present study focused on structure prediction of protein
sequence of polycystin 1.
Interaction of PKD1 and PKD2 gene with other genes and between them
This study also help to employ the existing natural products as a
prime solution for the treatment of ADPKD- Silent killer.
Future Focus:
The study will be focused on interaction of polycystin-1(PC-1) and
polcystin-2 (PC-2) between them and other proteins; and docking as
future perspectives. It leads to DNA based drug designing for the
polycystic kidney disease and for other hereditary diseases.
CONCLUSION
Genetic testing offers the chance of performing prenatal or pre-implantation testing
in families with severe cases of the disease.
Hence the current study suggests that genetic testing is very important in
controlling the severity and progression of the disease and could delay the end stage
renal disease (ESRD) with effective drugs.
REFERENCES
Pei Y, He N, Wang K, Kasenda M, Paterson AD, Chan G, Liang Y, Roscoe J,
Brissenden J, Hefferton D, Parfrey P, Somlo S, ST. George – Hyslop P: A
spectrum of mutation in polycystic kidney disease – 2(PKD2) gene from eight
Canadian kidrede. J AM Soc Nephrol 9:1853 – 1860, 1998.
Sambrook J. and Russel D.W. Molecular cloning, a laboratory manual, 3rdDe
Gomez Dumm NT,Giammona AM,Touceda LA and Raimondi C:Lipid
abnormalities in chronic renal failyre patients undergoing hemodialysis. Lipids and
health diseases,2;1-6: 2003.
Grzegorzewska AE and Mlot M. Serum Osteoprotegrin level is lower in peritoneal
dialysis patients than in hemodialysis ones.Annales Academiaec S Medcae
Bialostocensis 49,2004.
De Gomez Dumm NT,Giammona AM,Touceda LA and Raimondi C:Lipid
abnormalities in chronic renal failyre patients undergoing hemodialysis. Lipids and
health diseases,2;1-6: 2003.
Constantinides R, Xenophontos, S, Neophytou P, Nomura S, Pierides A,
Constantinou, C:New amino acid polymorphism, Ala/Val4058, in exon 45 of the
polycystic kidney disease 1 gene: evolution of alleles. Hum Genet 99: 644-647,
1997.
Koptides M,Hadjimichad C,Koupepidou P,Pierides A and Constinous Deltasc
(1999) “Germinal and Somatic mutation in the PKD2 gene of renal cyst in
autosomal dominant polycystic kidney diseases” Hum.mol. Gents
Tazon Vega, Mireia Vilardell: Study of candidate genes affecting the
progression of renal disease in autosomal dominant polycystic kidney disease type
1.Nephrol Dial Transplant 2007, 22:1567-1577.
Thomas J, Manunath AP, Rai L, Kudva R. Autosomal recessive polycystic
kidney disease diagnosed in fetus. Indian J Urol 2007; 23:328-9.
Torra R, Viribay M, Tellaria D, Badenas C, Watson M, Harris P, Darnell A, San
Millan JL: Seven novel mutations of the PKD2 gene families with autosomal
dominant polycyctic kidney disease. Kidney international 56:28 – 33, 1999.
Guo C-H and Wang C-L. Effects of zinc supplementation on plasma copper/zinc
ratios, oxidative stress, and immunological status in hemodialysis patients. Int J
Med Sci 10(1):79-89,2013.
Kim Y, and Lee BK. (2011) Iron deficiency increases blood manganese level in
the Korean general population according to KNHANES 2008. Neurotoxicology
Insilico analysis of pkd genes in polycystic kidney disease patients

More Related Content

What's hot

Lnc rna h19 induces retinal müller cell apoptosis via mir-29b foxo4 axis in d...
Lnc rna h19 induces retinal müller cell apoptosis via mir-29b foxo4 axis in d...Lnc rna h19 induces retinal müller cell apoptosis via mir-29b foxo4 axis in d...
Lnc rna h19 induces retinal müller cell apoptosis via mir-29b foxo4 axis in d...Clinical Surgery Research Communications
 
Ultrasound reverses adriamycin resistance in non-small cell lung cancer via p...
Ultrasound reverses adriamycin resistance in non-small cell lung cancer via p...Ultrasound reverses adriamycin resistance in non-small cell lung cancer via p...
Ultrasound reverses adriamycin resistance in non-small cell lung cancer via p...Clinical Surgery Research Communications
 
Lnc rna nnt as1 affect progesterone resistance by regulating mir-542-3p or su...
Lnc rna nnt as1 affect progesterone resistance by regulating mir-542-3p or su...Lnc rna nnt as1 affect progesterone resistance by regulating mir-542-3p or su...
Lnc rna nnt as1 affect progesterone resistance by regulating mir-542-3p or su...Clinical Surgery Research Communications
 
Korc Poster Final 11 23 10
Korc Poster Final 11 23 10Korc Poster Final 11 23 10
Korc Poster Final 11 23 10Jack Crawford
 
Lnc rna meg3 promotes glaucomatous retinal ganglion cell apoptosis via upregu...
Lnc rna meg3 promotes glaucomatous retinal ganglion cell apoptosis via upregu...Lnc rna meg3 promotes glaucomatous retinal ganglion cell apoptosis via upregu...
Lnc rna meg3 promotes glaucomatous retinal ganglion cell apoptosis via upregu...Clinical Surgery Research Communications
 
Mi r 449b inhibits the migration and invasion of colorectal cancer cells thro...
Mi r 449b inhibits the migration and invasion of colorectal cancer cells thro...Mi r 449b inhibits the migration and invasion of colorectal cancer cells thro...
Mi r 449b inhibits the migration and invasion of colorectal cancer cells thro...Clinical Surgery Research Communications
 
Casc15 promotes lens epithelial cell apoptosis in age related cataracts by re...
Casc15 promotes lens epithelial cell apoptosis in age related cataracts by re...Casc15 promotes lens epithelial cell apoptosis in age related cataracts by re...
Casc15 promotes lens epithelial cell apoptosis in age related cataracts by re...Clinical Surgery Research Communications
 
Dr. Francesc Palau - 'Neuropatías periféricas hereditarias'
Dr. Francesc Palau - 'Neuropatías periféricas hereditarias'Dr. Francesc Palau - 'Neuropatías periféricas hereditarias'
Dr. Francesc Palau - 'Neuropatías periféricas hereditarias'Fundación Ramón Areces
 
Cholestasis induces reversible accumulation of periplakin in mouse liver
Cholestasis induces reversible accumulation of periplakin in mouse liverCholestasis induces reversible accumulation of periplakin in mouse liver
Cholestasis induces reversible accumulation of periplakin in mouse liverEnrique Moreno Gonzalez
 
Triple Screen FINAL poster-3
Triple Screen FINAL poster-3Triple Screen FINAL poster-3
Triple Screen FINAL poster-3Whitney Best
 
Dissertation final complete1
Dissertation final complete1Dissertation final complete1
Dissertation final complete1Patrick Newton
 
Recombinant DNA Technology
Recombinant DNA TechnologyRecombinant DNA Technology
Recombinant DNA Technologylabheshparakh
 

What's hot (20)

Lnc rna h19 induces retinal müller cell apoptosis via mir-29b foxo4 axis in d...
Lnc rna h19 induces retinal müller cell apoptosis via mir-29b foxo4 axis in d...Lnc rna h19 induces retinal müller cell apoptosis via mir-29b foxo4 axis in d...
Lnc rna h19 induces retinal müller cell apoptosis via mir-29b foxo4 axis in d...
 
Ultrasound reverses adriamycin resistance in non-small cell lung cancer via p...
Ultrasound reverses adriamycin resistance in non-small cell lung cancer via p...Ultrasound reverses adriamycin resistance in non-small cell lung cancer via p...
Ultrasound reverses adriamycin resistance in non-small cell lung cancer via p...
 
Lnc rna nnt as1 affect progesterone resistance by regulating mir-542-3p or su...
Lnc rna nnt as1 affect progesterone resistance by regulating mir-542-3p or su...Lnc rna nnt as1 affect progesterone resistance by regulating mir-542-3p or su...
Lnc rna nnt as1 affect progesterone resistance by regulating mir-542-3p or su...
 
Korc Poster Final 11 23 10
Korc Poster Final 11 23 10Korc Poster Final 11 23 10
Korc Poster Final 11 23 10
 
Lnc rna meg3 promotes glaucomatous retinal ganglion cell apoptosis via upregu...
Lnc rna meg3 promotes glaucomatous retinal ganglion cell apoptosis via upregu...Lnc rna meg3 promotes glaucomatous retinal ganglion cell apoptosis via upregu...
Lnc rna meg3 promotes glaucomatous retinal ganglion cell apoptosis via upregu...
 
Mi r 449b inhibits the migration and invasion of colorectal cancer cells thro...
Mi r 449b inhibits the migration and invasion of colorectal cancer cells thro...Mi r 449b inhibits the migration and invasion of colorectal cancer cells thro...
Mi r 449b inhibits the migration and invasion of colorectal cancer cells thro...
 
Casc15 promotes lens epithelial cell apoptosis in age related cataracts by re...
Casc15 promotes lens epithelial cell apoptosis in age related cataracts by re...Casc15 promotes lens epithelial cell apoptosis in age related cataracts by re...
Casc15 promotes lens epithelial cell apoptosis in age related cataracts by re...
 
Suppress lung cancer progression via up regulation of linc rna-p21
Suppress lung cancer progression via up regulation of linc rna-p21Suppress lung cancer progression via up regulation of linc rna-p21
Suppress lung cancer progression via up regulation of linc rna-p21
 
Effect of miR-21 on Oral Squamous Cell Carcinoma Cell Proliferation and Apopt...
Effect of miR-21 on Oral Squamous Cell Carcinoma Cell Proliferation and Apopt...Effect of miR-21 on Oral Squamous Cell Carcinoma Cell Proliferation and Apopt...
Effect of miR-21 on Oral Squamous Cell Carcinoma Cell Proliferation and Apopt...
 
2014 Zorniak JNS
2014 Zorniak JNS2014 Zorniak JNS
2014 Zorniak JNS
 
Medicina
Medicina Medicina
Medicina
 
Dr. Francesc Palau - 'Neuropatías periféricas hereditarias'
Dr. Francesc Palau - 'Neuropatías periféricas hereditarias'Dr. Francesc Palau - 'Neuropatías periféricas hereditarias'
Dr. Francesc Palau - 'Neuropatías periféricas hereditarias'
 
CRISPR REPORT
CRISPR REPORTCRISPR REPORT
CRISPR REPORT
 
Gasdermin D Open Sepsis-Induced Acute Kidney Injury via Cell Pyroptosis by NL...
Gasdermin D Open Sepsis-Induced Acute Kidney Injury via Cell Pyroptosis by NL...Gasdermin D Open Sepsis-Induced Acute Kidney Injury via Cell Pyroptosis by NL...
Gasdermin D Open Sepsis-Induced Acute Kidney Injury via Cell Pyroptosis by NL...
 
Cholestasis induces reversible accumulation of periplakin in mouse liver
Cholestasis induces reversible accumulation of periplakin in mouse liverCholestasis induces reversible accumulation of periplakin in mouse liver
Cholestasis induces reversible accumulation of periplakin in mouse liver
 
Triple Screen FINAL poster-3
Triple Screen FINAL poster-3Triple Screen FINAL poster-3
Triple Screen FINAL poster-3
 
Effects of Ginsenoside Rh2 on STAT3 Signaling Pathway in Human Gastric Cancer...
Effects of Ginsenoside Rh2 on STAT3 Signaling Pathway in Human Gastric Cancer...Effects of Ginsenoside Rh2 on STAT3 Signaling Pathway in Human Gastric Cancer...
Effects of Ginsenoside Rh2 on STAT3 Signaling Pathway in Human Gastric Cancer...
 
Dissertation final complete1
Dissertation final complete1Dissertation final complete1
Dissertation final complete1
 
CASC5 Is Elevated in Lung Adenocarcinoma and Confers Poor Patient Survival
CASC5 Is Elevated in Lung Adenocarcinoma and Confers Poor Patient SurvivalCASC5 Is Elevated in Lung Adenocarcinoma and Confers Poor Patient Survival
CASC5 Is Elevated in Lung Adenocarcinoma and Confers Poor Patient Survival
 
Recombinant DNA Technology
Recombinant DNA TechnologyRecombinant DNA Technology
Recombinant DNA Technology
 

Similar to Insilico analysis of pkd genes in polycystic kidney disease patients

Year in review 2011-Nature reviews
Year in review 2011-Nature reviewsYear in review 2011-Nature reviews
Year in review 2011-Nature reviewsVishal Golay
 
Identification of the Enrichment Pathways of Catalase in Multiple Primary Tumors
Identification of the Enrichment Pathways of Catalase in Multiple Primary TumorsIdentification of the Enrichment Pathways of Catalase in Multiple Primary Tumors
Identification of the Enrichment Pathways of Catalase in Multiple Primary Tumorsdaranisaha
 
DNA Methylation and Epigenetic Events Underlying Renal Cell Carcinomas
DNA Methylation and Epigenetic Events Underlying Renal Cell CarcinomasDNA Methylation and Epigenetic Events Underlying Renal Cell Carcinomas
DNA Methylation and Epigenetic Events Underlying Renal Cell Carcinomaskomalicarol
 
Poster_Molecular analysis of BRAF and RAS family genes in thyroid carcinoma i...
Poster_Molecular analysis of BRAF and RAS family genes in thyroid carcinoma i...Poster_Molecular analysis of BRAF and RAS family genes in thyroid carcinoma i...
Poster_Molecular analysis of BRAF and RAS family genes in thyroid carcinoma i...Alexandra Papadopoulou
 
Lnc rna pcat29 suppresses cell proliferation, invasion, and migration in rena...
Lnc rna pcat29 suppresses cell proliferation, invasion, and migration in rena...Lnc rna pcat29 suppresses cell proliferation, invasion, and migration in rena...
Lnc rna pcat29 suppresses cell proliferation, invasion, and migration in rena...Clinical Surgery Research Communications
 
Management of SHPT in dialysis and beyond.pptx
Management of SHPT in dialysis and beyond.pptxManagement of SHPT in dialysis and beyond.pptx
Management of SHPT in dialysis and beyond.pptxChristos Argyropoulos
 
Disrupted development and altered hormone signaling in male Padi2:Padi4 doubl...
Disrupted development and altered hormone signaling in male Padi2:Padi4 doubl...Disrupted development and altered hormone signaling in male Padi2:Padi4 doubl...
Disrupted development and altered hormone signaling in male Padi2:Padi4 doubl...Cornell University
 
LncRNA WARS2-IT1 Functions as an Oncogene and is Associated with Poor Outcome...
LncRNA WARS2-IT1 Functions as an Oncogene and is Associated with Poor Outcome...LncRNA WARS2-IT1 Functions as an Oncogene and is Associated with Poor Outcome...
LncRNA WARS2-IT1 Functions as an Oncogene and is Associated with Poor Outcome...semualkaira
 
LncRNA WARS2-IT1 Functions as an Oncogene and is Associated with Poor Outcome...
LncRNA WARS2-IT1 Functions as an Oncogene and is Associated with Poor Outcome...LncRNA WARS2-IT1 Functions as an Oncogene and is Associated with Poor Outcome...
LncRNA WARS2-IT1 Functions as an Oncogene and is Associated with Poor Outcome...semualkaira
 
LncRNA WARS2-IT1 Functions as an Oncogene and is Associated with Poor Outcome...
LncRNA WARS2-IT1 Functions as an Oncogene and is Associated with Poor Outcome...LncRNA WARS2-IT1 Functions as an Oncogene and is Associated with Poor Outcome...
LncRNA WARS2-IT1 Functions as an Oncogene and is Associated with Poor Outcome...semualkaira
 
Sperm dna fragmentation
Sperm dna fragmentationSperm dna fragmentation
Sperm dna fragmentationWael Alhuleily
 
30511 prions.ppt
30511 prions.ppt30511 prions.ppt
30511 prions.pptabhi747849
 
Tuberous Sclerosis - Orrin Devinsky, MD
Tuberous Sclerosis - Orrin Devinsky, MDTuberous Sclerosis - Orrin Devinsky, MD
Tuberous Sclerosis - Orrin Devinsky, MDNYU FACES
 
Determination and comparison rate of expression markers of osteoblast derived...
Determination and comparison rate of expression markers of osteoblast derived...Determination and comparison rate of expression markers of osteoblast derived...
Determination and comparison rate of expression markers of osteoblast derived...IJERD Editor
 
Adenomatous polyposis coli (apc) gene mutation in a population of prostate ca...
Adenomatous polyposis coli (apc) gene mutation in a population of prostate ca...Adenomatous polyposis coli (apc) gene mutation in a population of prostate ca...
Adenomatous polyposis coli (apc) gene mutation in a population of prostate ca...BioMedSciDirect Publications
 

Similar to Insilico analysis of pkd genes in polycystic kidney disease patients (20)

Year in review 2011-Nature reviews
Year in review 2011-Nature reviewsYear in review 2011-Nature reviews
Year in review 2011-Nature reviews
 
Study of the Association of PCSK9/Eam1104I Gene Polymorphism with Plasma Lipi...
Study of the Association of PCSK9/Eam1104I Gene Polymorphism with Plasma Lipi...Study of the Association of PCSK9/Eam1104I Gene Polymorphism with Plasma Lipi...
Study of the Association of PCSK9/Eam1104I Gene Polymorphism with Plasma Lipi...
 
Identification of the Enrichment Pathways of Catalase in Multiple Primary Tumors
Identification of the Enrichment Pathways of Catalase in Multiple Primary TumorsIdentification of the Enrichment Pathways of Catalase in Multiple Primary Tumors
Identification of the Enrichment Pathways of Catalase in Multiple Primary Tumors
 
DNA Methylation and Epigenetic Events Underlying Renal Cell Carcinomas
DNA Methylation and Epigenetic Events Underlying Renal Cell CarcinomasDNA Methylation and Epigenetic Events Underlying Renal Cell Carcinomas
DNA Methylation and Epigenetic Events Underlying Renal Cell Carcinomas
 
Poster_Molecular analysis of BRAF and RAS family genes in thyroid carcinoma i...
Poster_Molecular analysis of BRAF and RAS family genes in thyroid carcinoma i...Poster_Molecular analysis of BRAF and RAS family genes in thyroid carcinoma i...
Poster_Molecular analysis of BRAF and RAS family genes in thyroid carcinoma i...
 
Lnc rna pcat29 suppresses cell proliferation, invasion, and migration in rena...
Lnc rna pcat29 suppresses cell proliferation, invasion, and migration in rena...Lnc rna pcat29 suppresses cell proliferation, invasion, and migration in rena...
Lnc rna pcat29 suppresses cell proliferation, invasion, and migration in rena...
 
Parkinson`s disease article
Parkinson`s disease articleParkinson`s disease article
Parkinson`s disease article
 
Parkinson`s disease article
Parkinson`s disease articleParkinson`s disease article
Parkinson`s disease article
 
DOOR syndrome
DOOR syndromeDOOR syndrome
DOOR syndrome
 
Management of SHPT in dialysis and beyond.pptx
Management of SHPT in dialysis and beyond.pptxManagement of SHPT in dialysis and beyond.pptx
Management of SHPT in dialysis and beyond.pptx
 
Disrupted development and altered hormone signaling in male Padi2:Padi4 doubl...
Disrupted development and altered hormone signaling in male Padi2:Padi4 doubl...Disrupted development and altered hormone signaling in male Padi2:Padi4 doubl...
Disrupted development and altered hormone signaling in male Padi2:Padi4 doubl...
 
LncRNA WARS2-IT1 Functions as an Oncogene and is Associated with Poor Outcome...
LncRNA WARS2-IT1 Functions as an Oncogene and is Associated with Poor Outcome...LncRNA WARS2-IT1 Functions as an Oncogene and is Associated with Poor Outcome...
LncRNA WARS2-IT1 Functions as an Oncogene and is Associated with Poor Outcome...
 
LncRNA WARS2-IT1 Functions as an Oncogene and is Associated with Poor Outcome...
LncRNA WARS2-IT1 Functions as an Oncogene and is Associated with Poor Outcome...LncRNA WARS2-IT1 Functions as an Oncogene and is Associated with Poor Outcome...
LncRNA WARS2-IT1 Functions as an Oncogene and is Associated with Poor Outcome...
 
LncRNA WARS2-IT1 Functions as an Oncogene and is Associated with Poor Outcome...
LncRNA WARS2-IT1 Functions as an Oncogene and is Associated with Poor Outcome...LncRNA WARS2-IT1 Functions as an Oncogene and is Associated with Poor Outcome...
LncRNA WARS2-IT1 Functions as an Oncogene and is Associated with Poor Outcome...
 
Sperm dna fragmentation
Sperm dna fragmentationSperm dna fragmentation
Sperm dna fragmentation
 
bbrc aghdam 2013
bbrc aghdam 2013bbrc aghdam 2013
bbrc aghdam 2013
 
30511 prions.ppt
30511 prions.ppt30511 prions.ppt
30511 prions.ppt
 
Tuberous Sclerosis - Orrin Devinsky, MD
Tuberous Sclerosis - Orrin Devinsky, MDTuberous Sclerosis - Orrin Devinsky, MD
Tuberous Sclerosis - Orrin Devinsky, MD
 
Determination and comparison rate of expression markers of osteoblast derived...
Determination and comparison rate of expression markers of osteoblast derived...Determination and comparison rate of expression markers of osteoblast derived...
Determination and comparison rate of expression markers of osteoblast derived...
 
Adenomatous polyposis coli (apc) gene mutation in a population of prostate ca...
Adenomatous polyposis coli (apc) gene mutation in a population of prostate ca...Adenomatous polyposis coli (apc) gene mutation in a population of prostate ca...
Adenomatous polyposis coli (apc) gene mutation in a population of prostate ca...
 

Recently uploaded

Difference Between Search & Browse Methods in Odoo 17
Difference Between Search & Browse Methods in Odoo 17Difference Between Search & Browse Methods in Odoo 17
Difference Between Search & Browse Methods in Odoo 17Celine George
 
Earth Day Presentation wow hello nice great
Earth Day Presentation wow hello nice greatEarth Day Presentation wow hello nice great
Earth Day Presentation wow hello nice greatYousafMalik24
 
DATA STRUCTURE AND ALGORITHM for beginners
DATA STRUCTURE AND ALGORITHM for beginnersDATA STRUCTURE AND ALGORITHM for beginners
DATA STRUCTURE AND ALGORITHM for beginnersSabitha Banu
 
Solving Puzzles Benefits Everyone (English).pptx
Solving Puzzles Benefits Everyone (English).pptxSolving Puzzles Benefits Everyone (English).pptx
Solving Puzzles Benefits Everyone (English).pptxOH TEIK BIN
 
Pharmacognosy Flower 3. Compositae 2023.pdf
Pharmacognosy Flower 3. Compositae 2023.pdfPharmacognosy Flower 3. Compositae 2023.pdf
Pharmacognosy Flower 3. Compositae 2023.pdfMahmoud M. Sallam
 
Capitol Tech U Doctoral Presentation - April 2024.pptx
Capitol Tech U Doctoral Presentation - April 2024.pptxCapitol Tech U Doctoral Presentation - April 2024.pptx
Capitol Tech U Doctoral Presentation - April 2024.pptxCapitolTechU
 
Like-prefer-love -hate+verb+ing & silent letters & citizenship text.pdf
Like-prefer-love -hate+verb+ing & silent letters & citizenship text.pdfLike-prefer-love -hate+verb+ing & silent letters & citizenship text.pdf
Like-prefer-love -hate+verb+ing & silent letters & citizenship text.pdfMr Bounab Samir
 
Computed Fields and api Depends in the Odoo 17
Computed Fields and api Depends in the Odoo 17Computed Fields and api Depends in the Odoo 17
Computed Fields and api Depends in the Odoo 17Celine George
 
Presiding Officer Training module 2024 lok sabha elections
Presiding Officer Training module 2024 lok sabha electionsPresiding Officer Training module 2024 lok sabha elections
Presiding Officer Training module 2024 lok sabha electionsanshu789521
 
Final demo Grade 9 for demo Plan dessert.pptx
Final demo Grade 9 for demo Plan dessert.pptxFinal demo Grade 9 for demo Plan dessert.pptx
Final demo Grade 9 for demo Plan dessert.pptxAvyJaneVismanos
 
EPANDING THE CONTENT OF AN OUTLINE using notes.pptx
EPANDING THE CONTENT OF AN OUTLINE using notes.pptxEPANDING THE CONTENT OF AN OUTLINE using notes.pptx
EPANDING THE CONTENT OF AN OUTLINE using notes.pptxRaymartEstabillo3
 
Historical philosophical, theoretical, and legal foundations of special and i...
Historical philosophical, theoretical, and legal foundations of special and i...Historical philosophical, theoretical, and legal foundations of special and i...
Historical philosophical, theoretical, and legal foundations of special and i...jaredbarbolino94
 
Enzyme, Pharmaceutical Aids, Miscellaneous Last Part of Chapter no 5th.pdf
Enzyme, Pharmaceutical Aids, Miscellaneous Last Part of Chapter no 5th.pdfEnzyme, Pharmaceutical Aids, Miscellaneous Last Part of Chapter no 5th.pdf
Enzyme, Pharmaceutical Aids, Miscellaneous Last Part of Chapter no 5th.pdfSumit Tiwari
 
CELL CYCLE Division Science 8 quarter IV.pptx
CELL CYCLE Division Science 8 quarter IV.pptxCELL CYCLE Division Science 8 quarter IV.pptx
CELL CYCLE Division Science 8 quarter IV.pptxJiesonDelaCerna
 
Proudly South Africa powerpoint Thorisha.pptx
Proudly South Africa powerpoint Thorisha.pptxProudly South Africa powerpoint Thorisha.pptx
Proudly South Africa powerpoint Thorisha.pptxthorishapillay1
 
Alper Gobel In Media Res Media Component
Alper Gobel In Media Res Media ComponentAlper Gobel In Media Res Media Component
Alper Gobel In Media Res Media ComponentInMediaRes1
 
ENGLISH 7_Q4_LESSON 2_ Employing a Variety of Strategies for Effective Interp...
ENGLISH 7_Q4_LESSON 2_ Employing a Variety of Strategies for Effective Interp...ENGLISH 7_Q4_LESSON 2_ Employing a Variety of Strategies for Effective Interp...
ENGLISH 7_Q4_LESSON 2_ Employing a Variety of Strategies for Effective Interp...JhezDiaz1
 

Recently uploaded (20)

Difference Between Search & Browse Methods in Odoo 17
Difference Between Search & Browse Methods in Odoo 17Difference Between Search & Browse Methods in Odoo 17
Difference Between Search & Browse Methods in Odoo 17
 
Earth Day Presentation wow hello nice great
Earth Day Presentation wow hello nice greatEarth Day Presentation wow hello nice great
Earth Day Presentation wow hello nice great
 
DATA STRUCTURE AND ALGORITHM for beginners
DATA STRUCTURE AND ALGORITHM for beginnersDATA STRUCTURE AND ALGORITHM for beginners
DATA STRUCTURE AND ALGORITHM for beginners
 
Solving Puzzles Benefits Everyone (English).pptx
Solving Puzzles Benefits Everyone (English).pptxSolving Puzzles Benefits Everyone (English).pptx
Solving Puzzles Benefits Everyone (English).pptx
 
Pharmacognosy Flower 3. Compositae 2023.pdf
Pharmacognosy Flower 3. Compositae 2023.pdfPharmacognosy Flower 3. Compositae 2023.pdf
Pharmacognosy Flower 3. Compositae 2023.pdf
 
Capitol Tech U Doctoral Presentation - April 2024.pptx
Capitol Tech U Doctoral Presentation - April 2024.pptxCapitol Tech U Doctoral Presentation - April 2024.pptx
Capitol Tech U Doctoral Presentation - April 2024.pptx
 
Model Call Girl in Bikash Puri Delhi reach out to us at 🔝9953056974🔝
Model Call Girl in Bikash Puri  Delhi reach out to us at 🔝9953056974🔝Model Call Girl in Bikash Puri  Delhi reach out to us at 🔝9953056974🔝
Model Call Girl in Bikash Puri Delhi reach out to us at 🔝9953056974🔝
 
Like-prefer-love -hate+verb+ing & silent letters & citizenship text.pdf
Like-prefer-love -hate+verb+ing & silent letters & citizenship text.pdfLike-prefer-love -hate+verb+ing & silent letters & citizenship text.pdf
Like-prefer-love -hate+verb+ing & silent letters & citizenship text.pdf
 
TataKelola dan KamSiber Kecerdasan Buatan v022.pdf
TataKelola dan KamSiber Kecerdasan Buatan v022.pdfTataKelola dan KamSiber Kecerdasan Buatan v022.pdf
TataKelola dan KamSiber Kecerdasan Buatan v022.pdf
 
Computed Fields and api Depends in the Odoo 17
Computed Fields and api Depends in the Odoo 17Computed Fields and api Depends in the Odoo 17
Computed Fields and api Depends in the Odoo 17
 
Presiding Officer Training module 2024 lok sabha elections
Presiding Officer Training module 2024 lok sabha electionsPresiding Officer Training module 2024 lok sabha elections
Presiding Officer Training module 2024 lok sabha elections
 
Final demo Grade 9 for demo Plan dessert.pptx
Final demo Grade 9 for demo Plan dessert.pptxFinal demo Grade 9 for demo Plan dessert.pptx
Final demo Grade 9 for demo Plan dessert.pptx
 
EPANDING THE CONTENT OF AN OUTLINE using notes.pptx
EPANDING THE CONTENT OF AN OUTLINE using notes.pptxEPANDING THE CONTENT OF AN OUTLINE using notes.pptx
EPANDING THE CONTENT OF AN OUTLINE using notes.pptx
 
Model Call Girl in Tilak Nagar Delhi reach out to us at 🔝9953056974🔝
Model Call Girl in Tilak Nagar Delhi reach out to us at 🔝9953056974🔝Model Call Girl in Tilak Nagar Delhi reach out to us at 🔝9953056974🔝
Model Call Girl in Tilak Nagar Delhi reach out to us at 🔝9953056974🔝
 
Historical philosophical, theoretical, and legal foundations of special and i...
Historical philosophical, theoretical, and legal foundations of special and i...Historical philosophical, theoretical, and legal foundations of special and i...
Historical philosophical, theoretical, and legal foundations of special and i...
 
Enzyme, Pharmaceutical Aids, Miscellaneous Last Part of Chapter no 5th.pdf
Enzyme, Pharmaceutical Aids, Miscellaneous Last Part of Chapter no 5th.pdfEnzyme, Pharmaceutical Aids, Miscellaneous Last Part of Chapter no 5th.pdf
Enzyme, Pharmaceutical Aids, Miscellaneous Last Part of Chapter no 5th.pdf
 
CELL CYCLE Division Science 8 quarter IV.pptx
CELL CYCLE Division Science 8 quarter IV.pptxCELL CYCLE Division Science 8 quarter IV.pptx
CELL CYCLE Division Science 8 quarter IV.pptx
 
Proudly South Africa powerpoint Thorisha.pptx
Proudly South Africa powerpoint Thorisha.pptxProudly South Africa powerpoint Thorisha.pptx
Proudly South Africa powerpoint Thorisha.pptx
 
Alper Gobel In Media Res Media Component
Alper Gobel In Media Res Media ComponentAlper Gobel In Media Res Media Component
Alper Gobel In Media Res Media Component
 
ENGLISH 7_Q4_LESSON 2_ Employing a Variety of Strategies for Effective Interp...
ENGLISH 7_Q4_LESSON 2_ Employing a Variety of Strategies for Effective Interp...ENGLISH 7_Q4_LESSON 2_ Employing a Variety of Strategies for Effective Interp...
ENGLISH 7_Q4_LESSON 2_ Employing a Variety of Strategies for Effective Interp...
 

Insilico analysis of pkd genes in polycystic kidney disease patients

  • 1. In silico analysis of the impact of SNPs/SNP haplotypes on protein structure and function in autosomal dominant polycystic kidney disease Dr. P. VEERAMUTHUMARI, M.Sc., M.Phil., B.Ed., PGDCA., Ph.D., ASSISTANT PROFESSOR OF ZOOLOGY DEPARTMENT OF ZOOLOGY V.V. VANNIAPERUMAL COLLEGE FOR WOMEN, VIRUDHUNAGAR – 626 001 Mail id.: muthusdream@gmail.com; veeramuthumari@vvvcollege.org 13 July 2020
  • 2. Introduction  Polycystic kidney disease (PKD) is a disorder in which clusters of cysts develop within the kidneys.  Polycystic kidney disease (PKD) is the most common genetic, life threatening disease, affecting more than 12.5 million people worldwide  The polycystic kidney diseases are the most common hereditary nephropathies and constitute one of the leading causes of end-stage renal disease (Persu et al., 2002) .  There are two types of PKD Autosomal recessive polycystic kidney disease (ARPKD) Autosomal dominant polycystic kidney disease (ADPKD)  Occurrence of ADPKD is 1: 400 to 1 :1000 in common population. (Constantinides et al., 1997, Koptides et al., 1999, 2000)  Caused due to mutation in (i) PKD1(85%) -16p13.3- polycystin 1 (ii) PKD2(15%)- 4q21- polycystin 2 (Pei et al., 1998, Koptides et al., 1999, 2000)
  • 3. PKD1 gene is located on chromosome 16p13.3 PKD1 gene has 46 exon distributed over 52kb of genomic DNA Produces polycystine 1 - 4302 amino acids PKD1 gene Chromosome location of PKD1 gene PKD1 GENE LOCATION
  • 4. Single nucleotide polymorphism and ADPKD : It is a single gene disorder, affecting approximately 1/500 individuals in worldwide (Caucasian, China, Spain, Cyprus, Netherland, UK) populations (Ding et al., 2002). ADPKD is characterized by progressive enlargement of cysts in the kidney, often leading to end –stage renal failure disease (ESRD) in adult life. … Torra et al., (1999) (UK) reported a mutation that involves Substitution Deletion of (2511 AG-C), Inversion G C transversion Missense mutation . Most of these mutations are expected to lead to the formation of shortened, truncated proteins lacking the carboxyl terminus of PKD2 gene products. These truncating mutations suggest that ADPKD is caused by the lack of normal protein. Hence, the current study focused on PKD gene in polycystic kidney disease.
  • 5. Cyst formation in nephron, kidney and at cellular level: (Hannah &caplan, 2010) Mechanisms of cyst formation: ADPKD is genetically dominant at the organism level and it is recessive at the cellular level. The kidneys of an ADPKD patient who inherits one mutated copy of polycystin-1 or polycystin-2 from a parent will develop and function normally into adulthood. Cysts will form in this patient’s kidneys and several studies suggests that the cells which line these cysts will have lost both functional copies of a polycystin gene (Qian et al., 1996; Brasier & Henske 1997) Defects in the genes encoding PC1 and PC2 lead to aberrant gene transcription, cell proliferation, and ion secretion, which in turn results in the formation of fluid-filled cysts. As cysts ballon out from individual nephrons, their collective effects leads to the displacement of the normal renal parenchyma and the formation of a cyst-filled kidney with reduced functional capacity.
  • 6. Why the study is focused on PKD gene polymorphism? PKD1 and PKD2 genes encode polycystins 1 and 2 Functions of Gene products: Polycystins 1 and 2 are considered to be part of a common development pathway that involves cell-cell and cell- matrix interactions leading to the transfer of signal. They work together to help regulate cell growth, cell division, cell movement and interaction with other cells. Their interaction in renal tubules promote the normal development and function of kidney.
  • 7. OBJECTIVES: • To study the association between PKD1 and PKD2 gene polymorphism and autosomal dominant polycystic kidney disease (ADPKD) in patients and control group among South Indian (Madurai) population. • To analyse SNP database of PKD gene polymorphism. • To Design the 3D structure of polycystin-1 proteins and locate the SNP.
  • 8.  Sample collection : ADPKD Patients within the age group of 10-80 years of both sexes were selected. Sample Size: PKD patients : 300 Control subjects : 300 SURVEY & SAMPLE COLLECTION Blood samples free from any infectious disease and related data were collected by using questionnaire from the Department of Nephrology, Madurai Government Rajaji hospital, and Madurai kidney transplantation and research Centre, Madurai, Tamil Nadu.. CellsThe blood samples DNA PCR Gene Sequencing RFLP Locating Polymorphism In Protein Structure
  • 9. II. Steps involved 3D structure prediction: • Database search against protein sequences protein structures • Conserved domain • Secondary structure prediction • Three dimensional structure prediction by threading (MUSTER server), (http://zhanglab.ccmb.med.umich.edu/MUSTER/), MODELLER, version 8.2 I. SNP database analysis – http://www.ncbi.nlm.nih.gov/snp
  • 10.
  • 11. GENETIC STUDY I. Conformation of genomic DNA DNA 100bp
  • 12. Gene PKD1 Location CR16 Type SNP Location Exon45 Substitutio n Ala/Val (C/T) PCR primer sequences F 5’AGCTGTACGCCCTCACTGG- 3’ R:5’GTGACAGGTGCCAGGACT C-3 Size 298bp L2-L8-298bp Conformation PCR product of PKD1 (Ala/Val4058) gene L1-100bpMarker L1 L2 L3 L4 L5 L6 L7 L8
  • 13. Conformation RFLP product of PKD1 (Ala/Val4058) gene genotype frequency L1 L2 L3 L4 L5 L6 L7 L8 298bp 225bp 73bp L1-100bpMarker CC Normal homozygous CT Mutant heterozygous TT Mutant homozygous
  • 14. The PKD1 (C/T) single nucleotide polymorphism also confirmed by sequencing the PCR amplified gene products of PKD1 Ala 5’ - AAG CTG TAC GCC CTC ACT GG- 3’ – Wild type Allele Val 5’ - AAG CTG TAC GTC CTC ACT GG- 3’ - Mutant Allele Nucleotide sequence of PKD1 gene :(C/T polymorphism) Wild CGCCGTGGCCGAGGCCCGTACTTGGCACAGGGAAGGGCGCTGGCGCGTGCTGCGGC TCGGAGCCTGGGCGCGGTGGCTGCTGGTGGCGCTGACGGCGGCCACGGCACTGGTAC GCCTCGCCCAGCTGGGTGCCGCTGACCGCCAGTGGACCCGTTTCGTGCGCGGCCGCC CGCGCCGCTTCACTAGCTTCGACCAGGTGGCGCAGCTGAGCTCCGCAGCCCGTGGCC TGGCGGCCTCGCTGCTCTTCCTGCTTTTGGTCAAGGCTGCCCAGCAGCTACGCTTCGT GCGCCAGTGGTCC Mutant CGCCGTGGCCGAGGCCCGTACTTGGCACAGGGAAGGGCGCTGGCGCGTGCTGCGGC TCGGAGCCTGGGCGCGGTGGCTGCTGGTGGCGCTGACGGCGGCCACGGCACTGGTAC GCCTCGCCCAGCTGGGTGCCGCTGACCGCCAGTGGACCCGTTTCGTGCGCGGCCGCC CGCGCCGCTTCACTAGCTTCGACCAGGTGGCGCAGCTGAGCTCCGCAGCCCGTGGTC TGGCGGCCTCGCTGCTCTTCCTGCTTTTGGTCAAGGCTGCCCAGCAGCTACGCTTCGT GCGCCAGTGGTCC
  • 15. Comparison of genotype and allelic frequency of PKD1 (Ala/Val4058) gene in control subjects and ADPKD subjects T/T – Homozygous mutant C/T – Heterozygous mutant C/C–Homozygous normal Number indicates number of individuals having the genotype and number of individuals ( in percentage) GENOTYPE Allele frequency χ2 value p value T/T C/T C/C T C 14.16 P<0.05 9.488 Control subjects N=300 87 (29%) 82 (27.33%) 131 (43.67%) 0.425 0.575 ADPKD subjects N= 300 143 (47.67%) 99 (33%) 58 (19.33%) 0.642 0.358 13.93
  • 16. The present study worked on the genotype and allele data of PKD1gene from SNP database and demonstrated the occurrence of A/G and C/T is more when compounded with other SNPs available for PKD1 gene. Region found Coding Synonymous codon 283 Intron SNP 661 Coding non Synonymous codon 148 UTR (5’ &3’) 35 Splice site No item Locus region No item Stop gained, No SNP 16 ANNOTATION OMIM 36 SNP Protein sequence 359 SNP 3D structure 2 Pubmed 37 Cited in Pubmed 28 Nucleotide sequence 28
  • 17. PKD1 protein sequence search against protein sequence database
  • 18. POLYCYSTIN -1 Database search against sequences
  • 19. PKD1 protein sequence search against protein structure database
  • 20. PKD1 protein sequence structure database hits
  • 22. Polycystin 1 Secondary structure prediction
  • 23. Polycystin 1 Cation channel model - Wild Polycystin 1 Cation channel model - mutant
  • 24.
  • 25. DISCUSSION From this study, it is found that, there is association between PKD1 (Ala/Val4058, C/T) gene polymorphism and the severity of the disease in ADPKD subjects among South Indian (Madurai) population. This finding also enables us to understand the pathogenesis of ADPKD. In order to understand the molecular mechanism of ADPKD completely, one must screen the duplicated area, the promoter region, and the introns of PKD1 and 2 genes in each population (Ding et al., 2009). Currently there is no effective therapy for ADPKD or ARPKD. Kidney transplantation and dialysis are the only methods that can be performed to prolong life. Current therpeutic approaches involve the use of caspase inhibitors, Cyclin- dependent kinases (CKD) inhibitors, Triptolide, and mammalian target of rapamycin (mTOR) inhibitors. (Tao, et al., 2005, Bukanov, et.al., 2006, Torres, et.al., 2007, Leuenroth, et al., 2007).
  • 26. The structural study of the protein by biocomputing method is confirmed the absence of structural significance of a protein and such protein might be affects an important domain in the protein structure (Gomez et al., (2009) Bioinformatics is also found to be become a powerful tool in genetic mapping, association studies, diversity analysis and positional cloning (Rafalski, 2010, Galeano et al., 2012). The emergence of bioinformatics is provided a platform to explore diseases at the molecular level using computational techniques. Insilico methods are mainly harnessed to reduce the time, coat and risk associated with Drug discovey (Shoba et al., 2010). Hence the present study focused on structure prediction of protein sequence of polycystin 1.
  • 27. Interaction of PKD1 and PKD2 gene with other genes and between them
  • 28. This study also help to employ the existing natural products as a prime solution for the treatment of ADPKD- Silent killer. Future Focus: The study will be focused on interaction of polycystin-1(PC-1) and polcystin-2 (PC-2) between them and other proteins; and docking as future perspectives. It leads to DNA based drug designing for the polycystic kidney disease and for other hereditary diseases.
  • 29. CONCLUSION Genetic testing offers the chance of performing prenatal or pre-implantation testing in families with severe cases of the disease. Hence the current study suggests that genetic testing is very important in controlling the severity and progression of the disease and could delay the end stage renal disease (ESRD) with effective drugs.
  • 30. REFERENCES Pei Y, He N, Wang K, Kasenda M, Paterson AD, Chan G, Liang Y, Roscoe J, Brissenden J, Hefferton D, Parfrey P, Somlo S, ST. George – Hyslop P: A spectrum of mutation in polycystic kidney disease – 2(PKD2) gene from eight Canadian kidrede. J AM Soc Nephrol 9:1853 – 1860, 1998. Sambrook J. and Russel D.W. Molecular cloning, a laboratory manual, 3rdDe Gomez Dumm NT,Giammona AM,Touceda LA and Raimondi C:Lipid abnormalities in chronic renal failyre patients undergoing hemodialysis. Lipids and health diseases,2;1-6: 2003. Grzegorzewska AE and Mlot M. Serum Osteoprotegrin level is lower in peritoneal dialysis patients than in hemodialysis ones.Annales Academiaec S Medcae Bialostocensis 49,2004. De Gomez Dumm NT,Giammona AM,Touceda LA and Raimondi C:Lipid abnormalities in chronic renal failyre patients undergoing hemodialysis. Lipids and health diseases,2;1-6: 2003. Constantinides R, Xenophontos, S, Neophytou P, Nomura S, Pierides A, Constantinou, C:New amino acid polymorphism, Ala/Val4058, in exon 45 of the polycystic kidney disease 1 gene: evolution of alleles. Hum Genet 99: 644-647, 1997.
  • 31. Koptides M,Hadjimichad C,Koupepidou P,Pierides A and Constinous Deltasc (1999) “Germinal and Somatic mutation in the PKD2 gene of renal cyst in autosomal dominant polycystic kidney diseases” Hum.mol. Gents Tazon Vega, Mireia Vilardell: Study of candidate genes affecting the progression of renal disease in autosomal dominant polycystic kidney disease type 1.Nephrol Dial Transplant 2007, 22:1567-1577. Thomas J, Manunath AP, Rai L, Kudva R. Autosomal recessive polycystic kidney disease diagnosed in fetus. Indian J Urol 2007; 23:328-9. Torra R, Viribay M, Tellaria D, Badenas C, Watson M, Harris P, Darnell A, San Millan JL: Seven novel mutations of the PKD2 gene families with autosomal dominant polycyctic kidney disease. Kidney international 56:28 – 33, 1999. Guo C-H and Wang C-L. Effects of zinc supplementation on plasma copper/zinc ratios, oxidative stress, and immunological status in hemodialysis patients. Int J Med Sci 10(1):79-89,2013. Kim Y, and Lee BK. (2011) Iron deficiency increases blood manganese level in the Korean general population according to KNHANES 2008. Neurotoxicology