The power point tells about the gene polymorphism alters the protein structure. Alteration in protein structure leads to malfunction of gene causes disease. PKD gnes-Polycystin 1 and 2 protein - Polycystic kidney disease.
ENGLISH 7_Q4_LESSON 2_ Employing a Variety of Strategies for Effective Interp...
Insilico analysis of pkd genes in polycystic kidney disease patients
1. In silico analysis of the impact of SNPs/SNP
haplotypes on protein structure and function in
autosomal dominant polycystic kidney disease
Dr. P. VEERAMUTHUMARI, M.Sc., M.Phil., B.Ed., PGDCA., Ph.D.,
ASSISTANT PROFESSOR OF ZOOLOGY
DEPARTMENT OF ZOOLOGY
V.V. VANNIAPERUMAL COLLEGE FOR WOMEN,
VIRUDHUNAGAR – 626 001
Mail id.: muthusdream@gmail.com; veeramuthumari@vvvcollege.org
13 July 2020
2. Introduction
Polycystic kidney disease (PKD) is a disorder in which clusters of cysts develop
within the kidneys.
Polycystic kidney disease (PKD) is the most common genetic, life threatening
disease, affecting more than 12.5 million people worldwide
The polycystic kidney diseases are the most common hereditary nephropathies
and constitute one of the leading causes of end-stage renal disease (Persu et al.,
2002) .
There are two types of PKD
Autosomal recessive polycystic kidney disease (ARPKD)
Autosomal dominant polycystic kidney disease (ADPKD)
Occurrence of ADPKD is 1: 400 to 1 :1000 in common population.
(Constantinides et al., 1997, Koptides et al., 1999, 2000)
Caused due to mutation in
(i) PKD1(85%) -16p13.3- polycystin 1
(ii) PKD2(15%)- 4q21- polycystin 2
(Pei et al., 1998, Koptides et al., 1999, 2000)
3. PKD1 gene is located on chromosome 16p13.3
PKD1 gene has 46 exon distributed over 52kb of genomic DNA
Produces polycystine 1 - 4302 amino acids
PKD1 gene
Chromosome location of PKD1 gene
PKD1 GENE LOCATION
4. Single nucleotide polymorphism and ADPKD
:
It is a single gene disorder, affecting approximately 1/500 individuals in
worldwide (Caucasian, China, Spain, Cyprus, Netherland, UK) populations (Ding et al.,
2002). ADPKD is characterized by progressive enlargement of cysts in the kidney, often
leading to end –stage renal failure disease (ESRD) in adult life.
… Torra et al., (1999) (UK) reported a mutation that involves
Substitution
Deletion of (2511 AG-C),
Inversion
G C transversion
Missense mutation
. Most of these mutations are expected to lead to the formation of shortened,
truncated proteins lacking the carboxyl terminus of PKD2 gene products. These
truncating mutations suggest that ADPKD is caused by the lack of normal protein.
Hence, the current study focused on PKD gene in polycystic kidney disease.
5. Cyst formation in nephron, kidney and at cellular level: (Hannah &caplan, 2010)
Mechanisms of cyst formation:
ADPKD is genetically dominant at the organism level and it is recessive at the cellular level.
The kidneys of an ADPKD patient who inherits one mutated copy of polycystin-1 or polycystin-2 from a
parent will develop and function normally into adulthood. Cysts will form in this patient’s kidneys and
several studies suggests that the cells which line these cysts will have lost both functional copies of a
polycystin gene (Qian et al., 1996; Brasier & Henske 1997)
Defects in the genes encoding PC1 and PC2 lead to aberrant gene transcription, cell proliferation, and
ion secretion, which in turn results in the formation of fluid-filled cysts. As cysts ballon out from
individual nephrons, their collective effects leads to the displacement of the normal renal parenchyma and the
formation of a cyst-filled kidney with reduced functional capacity.
6. Why the study is focused on PKD gene polymorphism?
PKD1 and PKD2 genes encode polycystins 1 and 2
Functions of Gene products:
Polycystins 1 and 2 are considered to be part of a common
development pathway that involves cell-cell and cell-
matrix interactions leading to the transfer of signal.
They work together to help regulate cell growth, cell division,
cell movement and interaction with other cells.
Their interaction in renal tubules promote the normal
development and function of kidney.
7. OBJECTIVES:
• To study the association between PKD1 and PKD2 gene
polymorphism and autosomal dominant polycystic kidney disease
(ADPKD) in patients and control group among South Indian
(Madurai) population.
• To analyse SNP database of PKD gene polymorphism.
• To Design the 3D structure of polycystin-1 proteins and locate the
SNP.
8. Sample collection :
ADPKD Patients within the age group of 10-80 years of both sexes
were selected.
Sample Size:
PKD patients : 300
Control subjects : 300
SURVEY & SAMPLE COLLECTION
Blood samples free from any infectious disease and related data were collected
by using questionnaire from the Department of Nephrology, Madurai Government
Rajaji hospital, and Madurai kidney transplantation and research Centre, Madurai,
Tamil Nadu..
CellsThe blood samples DNA PCR
Gene Sequencing
RFLP
Locating Polymorphism In
Protein Structure
9. II. Steps involved 3D structure prediction:
• Database search against protein sequences
protein structures
• Conserved domain
• Secondary structure prediction
• Three dimensional structure prediction by threading (MUSTER
server), (http://zhanglab.ccmb.med.umich.edu/MUSTER/), MODELLER,
version 8.2
I. SNP database analysis – http://www.ncbi.nlm.nih.gov/snp
14. The PKD1 (C/T) single nucleotide polymorphism also confirmed by sequencing
the PCR amplified gene products of PKD1
Ala
5’ - AAG CTG TAC GCC CTC ACT GG- 3’ – Wild type Allele
Val
5’ - AAG CTG TAC GTC CTC ACT GG- 3’ - Mutant Allele
Nucleotide sequence of PKD1 gene :(C/T polymorphism)
Wild
CGCCGTGGCCGAGGCCCGTACTTGGCACAGGGAAGGGCGCTGGCGCGTGCTGCGGC
TCGGAGCCTGGGCGCGGTGGCTGCTGGTGGCGCTGACGGCGGCCACGGCACTGGTAC
GCCTCGCCCAGCTGGGTGCCGCTGACCGCCAGTGGACCCGTTTCGTGCGCGGCCGCC
CGCGCCGCTTCACTAGCTTCGACCAGGTGGCGCAGCTGAGCTCCGCAGCCCGTGGCC
TGGCGGCCTCGCTGCTCTTCCTGCTTTTGGTCAAGGCTGCCCAGCAGCTACGCTTCGT
GCGCCAGTGGTCC
Mutant
CGCCGTGGCCGAGGCCCGTACTTGGCACAGGGAAGGGCGCTGGCGCGTGCTGCGGC
TCGGAGCCTGGGCGCGGTGGCTGCTGGTGGCGCTGACGGCGGCCACGGCACTGGTAC
GCCTCGCCCAGCTGGGTGCCGCTGACCGCCAGTGGACCCGTTTCGTGCGCGGCCGCC
CGCGCCGCTTCACTAGCTTCGACCAGGTGGCGCAGCTGAGCTCCGCAGCCCGTGGTC
TGGCGGCCTCGCTGCTCTTCCTGCTTTTGGTCAAGGCTGCCCAGCAGCTACGCTTCGT
GCGCCAGTGGTCC
15. Comparison of genotype and allelic frequency of PKD1
(Ala/Val4058) gene in control subjects and ADPKD subjects
T/T – Homozygous mutant C/T – Heterozygous mutant C/C–Homozygous normal
Number indicates number of individuals having the genotype and number of individuals
( in percentage)
GENOTYPE Allele frequency χ2
value
p value
T/T C/T C/C T C 14.16 P<0.05
9.488
Control
subjects
N=300
87
(29%)
82
(27.33%)
131
(43.67%)
0.425 0.575
ADPKD
subjects
N= 300
143
(47.67%)
99
(33%)
58
(19.33%)
0.642 0.358 13.93
16. The present study worked on the genotype and allele data of PKD1gene from
SNP database and demonstrated the occurrence of A/G and C/T is more when
compounded with other SNPs available for PKD1 gene.
Region found
Coding Synonymous codon 283
Intron SNP 661
Coding non Synonymous codon 148
UTR (5’ &3’) 35
Splice site No item
Locus region No item
Stop gained, No SNP 16
ANNOTATION
OMIM 36
SNP Protein sequence 359
SNP 3D structure 2
Pubmed 37
Cited in Pubmed 28
Nucleotide sequence 28
23. Polycystin 1 Cation channel model
- Wild
Polycystin 1 Cation channel model
- mutant
24.
25. DISCUSSION
From this study, it is found that, there is association between PKD1
(Ala/Val4058, C/T) gene polymorphism and the severity of the disease in ADPKD
subjects among South Indian (Madurai) population. This finding also enables us to
understand the pathogenesis of ADPKD.
In order to understand the molecular mechanism of ADPKD completely, one
must screen the duplicated area, the promoter region, and the introns of PKD1 and 2
genes in each population (Ding et al., 2009).
Currently there is no effective therapy for ADPKD or ARPKD.
Kidney transplantation and dialysis are the only methods that can be
performed to prolong life.
Current therpeutic approaches involve the use of caspase inhibitors, Cyclin-
dependent kinases (CKD) inhibitors, Triptolide, and mammalian target of rapamycin
(mTOR) inhibitors. (Tao, et al., 2005, Bukanov, et.al., 2006, Torres, et.al., 2007,
Leuenroth, et al., 2007).
26. The structural study of the protein by biocomputing method is
confirmed the absence of structural significance of a protein and such
protein might be affects an important domain in the protein structure
(Gomez et al., (2009)
Bioinformatics is also found to be become a powerful tool
in genetic mapping, association studies, diversity analysis and positional
cloning (Rafalski, 2010, Galeano et al., 2012).
The emergence of bioinformatics is provided a platform to
explore diseases at the molecular level using computational techniques.
Insilico methods are mainly harnessed to reduce the time, coat and risk
associated with Drug discovey (Shoba et al., 2010).
Hence the present study focused on structure prediction of protein
sequence of polycystin 1.
28. This study also help to employ the existing natural products as a
prime solution for the treatment of ADPKD- Silent killer.
Future Focus:
The study will be focused on interaction of polycystin-1(PC-1) and
polcystin-2 (PC-2) between them and other proteins; and docking as
future perspectives. It leads to DNA based drug designing for the
polycystic kidney disease and for other hereditary diseases.
29. CONCLUSION
Genetic testing offers the chance of performing prenatal or pre-implantation testing
in families with severe cases of the disease.
Hence the current study suggests that genetic testing is very important in
controlling the severity and progression of the disease and could delay the end stage
renal disease (ESRD) with effective drugs.
30. REFERENCES
Pei Y, He N, Wang K, Kasenda M, Paterson AD, Chan G, Liang Y, Roscoe J,
Brissenden J, Hefferton D, Parfrey P, Somlo S, ST. George – Hyslop P: A
spectrum of mutation in polycystic kidney disease – 2(PKD2) gene from eight
Canadian kidrede. J AM Soc Nephrol 9:1853 – 1860, 1998.
Sambrook J. and Russel D.W. Molecular cloning, a laboratory manual, 3rdDe
Gomez Dumm NT,Giammona AM,Touceda LA and Raimondi C:Lipid
abnormalities in chronic renal failyre patients undergoing hemodialysis. Lipids and
health diseases,2;1-6: 2003.
Grzegorzewska AE and Mlot M. Serum Osteoprotegrin level is lower in peritoneal
dialysis patients than in hemodialysis ones.Annales Academiaec S Medcae
Bialostocensis 49,2004.
De Gomez Dumm NT,Giammona AM,Touceda LA and Raimondi C:Lipid
abnormalities in chronic renal failyre patients undergoing hemodialysis. Lipids and
health diseases,2;1-6: 2003.
Constantinides R, Xenophontos, S, Neophytou P, Nomura S, Pierides A,
Constantinou, C:New amino acid polymorphism, Ala/Val4058, in exon 45 of the
polycystic kidney disease 1 gene: evolution of alleles. Hum Genet 99: 644-647,
1997.
31. Koptides M,Hadjimichad C,Koupepidou P,Pierides A and Constinous Deltasc
(1999) “Germinal and Somatic mutation in the PKD2 gene of renal cyst in
autosomal dominant polycystic kidney diseases” Hum.mol. Gents
Tazon Vega, Mireia Vilardell: Study of candidate genes affecting the
progression of renal disease in autosomal dominant polycystic kidney disease type
1.Nephrol Dial Transplant 2007, 22:1567-1577.
Thomas J, Manunath AP, Rai L, Kudva R. Autosomal recessive polycystic
kidney disease diagnosed in fetus. Indian J Urol 2007; 23:328-9.
Torra R, Viribay M, Tellaria D, Badenas C, Watson M, Harris P, Darnell A, San
Millan JL: Seven novel mutations of the PKD2 gene families with autosomal
dominant polycyctic kidney disease. Kidney international 56:28 – 33, 1999.
Guo C-H and Wang C-L. Effects of zinc supplementation on plasma copper/zinc
ratios, oxidative stress, and immunological status in hemodialysis patients. Int J
Med Sci 10(1):79-89,2013.
Kim Y, and Lee BK. (2011) Iron deficiency increases blood manganese level in
the Korean general population according to KNHANES 2008. Neurotoxicology