Broad Objective: Enhance productivity of cell lines for biopharmaceutical products.
This required the study of the biology of mammalian cell lines to assess their characteristics for producing these recombinant products. Unfolded Protein Response (UPR) pathway is the key to understanding the parameters for maintaining growth andstable conditions for these cell lines.
Cell culture techniques were optimized to maximize productivity. The stress assays performed for this included: Glucose, Lactate, Thioflavin, and ROS Assays.
1. Project Report on
Quantification of ER stress in recombinant IgG secreting Chinese Hamster (Cricetulus
griseus) Ovary (CHO) cell lines.
Submitted in partial fulfillment of the degree of
Bachelor of Technology
in
Biotechnology
Under the guidance
of
Prof. Sarika Mehra
Department of Chemical Engineering
Indian Institute of Technology, Mumbai - 400 076
By
Kritika Lakhotia
10BBT0099
Internal Guide
Prof. Abhishek Sinha
2. DECLARATION CERTIFICATE
I hereby declare that the thesis entitled, “Quantification of ER stress in recombinant IgG
secreting Chinese Hamster (Cricetulus griseus) Ovary (CHO) cell lines” submitted to Vellore
Institute of Technology, Vellore, Tamil Nadu, India for the award of the Degree of
Bachelor of Technology in Biotechnology is an authentic record of research work carried
out by me during the period from Dec 2013 to May 2014, under the guidance and
supervision of Professor Sarika Mehra, Chemical Engineering Department, Indian
Institute of Technology, Bombay. I also declare that this project has not been submitted to
any other Universities or Institutions for the award of any degree.
13th
May, 2014
Kritika Lakhotia
3. Acknowledgements
I would like to extend my deepest gratitude to Prof Sarika Mehra for giving me an
opportunity to work under her established guidance and for her constant support.
I would also like to thank my PhD mentors Mr Kamal Prashad and Vikas Chandrawanshi for
their immense patience in guiding me and for their constant encouragement. Also, I would
also like to thank my other lab members: Prasanna Sir, Minal Ma’am, Yesha, Priyanka,
Monali and Sampada for their cooperation.
I would like to thank my guide Prof Abhishek Sinha from VIT University, Vellore for his
valuable support throughout and helping me in every possible way.
4. Abstract
With the surge in demand for recombinant products, there is a need to enhance productivity
of the cell lines used in the biopharmaceutical industries. In order to fulfill this objective, the
biology of the mammalian cell lines that are essentially preferred for the production of
recombinant products, need to be assessed. Here, we are trying to optimize the cell culture
techniques to maximize productivity. In addition, protein secretion is one the steps in the
production pathway that is said to be connected to the high productivity status of the
culminating product. The UPR pathway that fundamentally regulates the ER homeostasis is
one of the key links in understanding the optimum conditions required for the maintaining
high growth and productivity in stable mammalian cell lines. Stress assays give us important
information regarding the misfolded proteins and their quantification in a culture through the
RFU values at certain excitation and emission spectra. Glucose and lactate consumption
rates along with IgG secretion values provide an astute comprehension in studying the cell
kinetics. As a whole, the idea is to perceive optimum production conditions and gain
information on how one can enhance and produce a highly productive and stable
mammalian cell line that can be utilized successfully at an industrial scale.
5. Objectives
The objective of this work is to quantify ER stress in recombinant CHO cells at high
productivity conditions. These are met through the following specific objectives.
1) To understand the molecular mechanism of protein secretion in mammalian
system
2) To perform kinetic and metabolic profiling of CHO cell lines
3) To map the key stress element sites in the upstream regions of the UPR genes
4) To quantify ER stress using biochemical assays – DCFDA and ThT
6. Table of Contents
Chapter 1............................................................................................................................................... 1
Introduction........................................................................................................................................... 1
1.1 Cell culture technology................................................................................................................... 2
1.2 CHO cell line ............................................................................................................................ 3
1.3 Media .............................................................................................................................................. 5
1.4 Culture conditions........................................................................................................................... 6
1.5 Growth Kinetics.............................................................................................................................. 6
Chapter 2 Materials and Methods......................................................................................................... 8
Chapter 3 Cell Culture Assay Results................................................................................................. 12
3.1 Growth curve ................................................................................................................................ 12
3.2 Glucose and Lactate Assay........................................................................................................... 14
3.3 IgG quantification......................................................................................................................... 15
Chapter 4 Unfolded Protein Response............................................................................................... 16
2.1 The unfolded protein response pathway ....................................................................................... 17
Chapter 5 Biochemical Assays to quantify ER Stress ........................................................................ 20
5.1 Thioflavin Assay........................................................................................................................... 20
5.2 Thioflavin T assay Results............................................................................................................ 21
5.2 ROS Assay.................................................................................................................................... 25
5.3 ROS assay Results ........................................................................................................................ 27
Chapter 6............................................................................................................................................. 30
Multiple sequence alignment and stress elements identification ........................................................ 30
6.1 Verification Tools......................................................................................................................... 34
Chapter 7 Discussion and Conclusion ................................................................................................ 53
References........................................................................................................................................... 55
Appendix............................................................................................................................................. 57
7. List of Figures
Figure 1: Epithelial-like CHO-K1 cell line........................................................................................... 4
Figure 2: Growth Kinetics .................................................................................................................... 7
Figure 3: Viable cell densities of MTX, No-MTX, & No-G418 treated 250-4 cells......................... 12
Figure 4: Viability profile................................................................................................................... 13
Figure 5: Specific growth rate profile of MTX, No-MTX and No G418 treated 250-4 cells............. 13
Figure 6: Glucose and Lactate Standard Curve .................................................................................. 14
Figure 7: Glucose and lactate assay for control cultures..................................................................... 14
Figure 8: IgG titers and cumulative productivity................................................................................ 15
Figure 9: A basic outline of the protein secretion pathway ................................................................ 17
Figure 10: An outline of UPR............................................................................................................. 19
Figure 11: RFU vs dye concentration................................................................................................. 21
Figure 12: Standard curve with 250-4 cells ........................................................................................ 22
Figure 13: Standard curve with 250-4 MTX culture.......................................................................... 22
Figure 14: RFU vs. dilution units/µL comparison for media and supernatant.................................... 23
Figure 15: Standard curve with supernatant of 250-4 CHO cells....................................................... 23
Figure 16: ThT comparison for MTX, No-MTX, & No-G418 culture conditions............................. 24
Figure 17: RFU plot for suppressor of UPR ....................................................................................... 24
Figure 18: ThT comparison for Control (dark) & Ind 1 (light) treated culture................................... 25
Figure 19: ROS Standard curves with different dye concentrations................................................... 27
Figure 20: ROS Comparison for 1.25 X 106
cells............................................................................... 27
Figure 21: ROS comparison for 0.5 X 106
cells.................................................................................. 28
Figure 22: Complete culture ROS profile........................................................................................... 28
Figure 23: ROS assay for control and Tunicamycin treated cultures.................................................. 29
Figure 24: MSA for GRP78................................................................................................................ 37
Figure 25: Matched Stress Elements with Grp78 consensus sequence.............................................. 38
Figure 26: MSA for GRP94................................................................................................................ 39
Figure 27: Matched Stress Elements with Grp94 consensus sequence............................................... 40
Figure 28: MSA for CRT.................................................................................................................... 41
Figure 29: Matched Stress Elements with CRT consensus sequence................................................. 42
Figure 30: MSA for CNX ................................................................................................................... 43
Figure 31: Matched Stress Elements with CNX consensus sequence ................................................ 44
Figure 32: MSA for ATF4.................................................................................................................. 45
Figure 33: Matched Stress Elements with ATF4 consensus sequence ............................................... 46
Figure 34: MSA for CHOP................................................................................................................. 47
Figure 35: Matched Stress Elements with CHOP consensus sequence .............................................. 48
Figure 36: MSA for GADD34............................................................................................................ 49
Figure 37: Matched Stress Elements with GADD34 consensus sequence ......................................... 50
Figure 38: MSA for XBP1.................................................................................................................. 51
Figure 39: Matched Stress Elements with XBP1 consensus sequence............................................... 52
8. List of Tables
Table 1: Selected list of approved antibodies produced in CHO cells (Wlaschin & Yap, 1987) ......... 5
Table 2: Overview of the UPR site information for chaperones......................................................... 32
Table 3: an overview of the UPR site information for UPR pathway and the related apoptotic
pathway............................................................................................................................................... 33
Table 4: List of consensus positions for UPR genes........................................................................... 35
9. 1
Chapter 1
Introduction
A biopharmaceutical product or a ―biologic‖ essentially refers to a medicinal product which
are produced through biotechnology. It could be a vaccine or a recombinant protein or a
blood component but in totality, it can be utilized as a therapeutic for the treatment of a
disease. A majority of biologic products are obtained from life forms. There can be a spark
of a controversy here as these products can be acquired from a method that involves
transgenic organisms specifically, genetically modified plants and animals. More work is
being done on high ―content‖ assays than on ―throughput‖ assays. There is a logicality
behind this, i.e., instead of working on miniaturizing assays to reduce costs and increase
productivity, complex biology is now being transferred to 96-well formats.
The biopharmaceutical market can be categorized on the basis of the class of the medical
drug into purified proteins, monoclonal antibodies, and recombinant proteins. The United
States has the largest market for biopharmaceuticals valued at USD 90 billion and is
assessed to grow in the coming years. The major section of this can be ascribed to
monoclonal antibodies which have witnessed an upsurge since the 90s due to the exquisite
specificity it offers while tracking proteins and other chemicals. Though their effectiveness
is limited, some of the technical problems have been overcome and drugs based on
monoclonal antibodies have been routinely used.
Monoclonal antibodies have been used for diagnosis of diseases by the western blot test and
immuno dot blot test which detect the protein on a membrane. By combining monoclonal
antibodies with poison, cells have given a protein on their surface that can be tracked down
by the antibody and destroyed. This method has been successful against some types of
cancers, especially breast cancers and leukemia. In addition, monoclonal antibodies are
being exploited for treatment of autoimmune diseases such as rheumatoid arthritis. CHO cell
lines are optimal for the production of monoclonal antibodies at larger scales.
10. 2
1.1 Cell culture technology
Cell culture technology derived products have been used as medicines to treat and prevent
cancer, viral infections, etc. The products of cell culture are said to be safe, effective, and
economical. It all began with the use of cells as viral vaccines for therapeutic purposes and
this led to the acceptance of continuous cell lines.
Cell cultures can be obtained by removal of cells from an animal or plant and ensuing
growth in a favorable environment. These cells can be removed by means of enzymatic
degradation or mechanically before cultivation. Primary culture refers to the phase of
culture that after the cells are isolated from the tissue and proliferated under suitable
conditions until they reach confluence. At this stage, the cells need to be subcultured or
passaged. Passaging or subculturing is referred to as the removal of medium and transfer
of cells from the primary culture for further propagation of the cell line. Subculturing for
mammalian cells is carried out before they reach confluency lest causing it to clump and the
solution to render turbid. Once surfeits of cells are obtained, they can be treated with
cryoprotective agents like dimethylsulfoxide (DMSO) or glycerol and carefully frozen
following storage at cryogenic temperatures (below -130ºC until needed).
Two basic cell culture systems that are used for growing cells are based upon the capability
of the cells to grow attached to a surface (Monolayer Culture Systems) or floating free in
the culture medium (Suspension Culture Systems). Of the two systems, suspension culture
was used for our mammalian cells. The suspension cultures are usually grown in Erlenmeyer
flasks in which the cells are actively suspended in the medium. The characteristics of
cultured cells depend on how ably they adapt to the culture conditions. Some characteristics
are lost or change when placed in an artificial environment. The cell lines that eventually
stop dividing are called finite cell lines. The cell lines that keep dividing infinitely are called
continuous cell lines.
Suspension cultures are easier to passage albeit it requires cell counts on a daily basis for
viability determination. They do not require enzymatic or mechanical disruption which is
beneficial as there will be minimal cell loss. These cultures are maintained in culture vessels
but require agitation for passable gas exchange on a routine basis.
The vertical laminar-flow biosafety cabinet provides a clean and sterile environment for the
worker and the product in carrying out the cell culture experiments. The successful
11. 3
manipulation of cell culture majorly relies on the capacity to maintain aseptic conditions.
The effectiveness of laminar flow cabinets as physical barriers to contamination depends on
the cabinet design integrating high-efficiency particulate air (HEPA) filters to trap airborne
contaminants and the blowers should move the filtered air at specified velocities in a non-
mixing stream across the work area.
Incubators are another basic necessity for maintaining a constant temperature of 37ºC for the
cell culture. They are required to maintain constant culture conditions and for preserving the
viability of the cells. The humidified atmosphere is maintained to prevent the loss of
medium of unsealed culture systems. The CO2 atmosphere is for maintaining a constant
buffering system.
The popular form of culture containers that we used were multi-well plates, and culture
flasks. The multi-well plates can accommodate many replicates of small-volume cultures.
The rapid volumes can be added through multi-well pipettors especially for dyes that follow
a high reaction speed. Following this, we can read the absorbance data using a
spectrophotometer.
1.2 CHO cell line
The cells that are used to a larger extent in any cell culture process are mammalian cell lines
due to the numerous advantages that it offers. They have the ability to perform post-
translational modifications which increase the efficacy of the protein drugs targeted towards
therapeutics (Wong, Wong, Tan, Wang, & Yap, n.d.). Mammalian cell lines, at large, are
classified into three basic categories on the basis of their morphology:
1. Fibroblastic: Bipolar or multipolar cells that have elongated shapes. They grow
attached to a substrate
2. Epithelial-like: These cells are polygonal in shape and grow attached to a substrate
in detached patches
3. Lymphoblast-like: These cells are spherical in shape and grown in suspension
without attaching to a surface
CHO cell line stems from the ovary of Chinese Hamster Cricetulus griseus organism. CHO-
K1 comes under the epithelial-like cell line and is the subclone of the parent CHO cell line.
12. 4
Figure 1: Epithelial-like CHO-K1 cell line
Basic overview of CHO mutant cell line development
CHO-K1 cell line is suitable as a transfection host and therefore, it makes the development
of a mutant cell line easier. The expression vector containing the promoter region, dhfr site
along with an antibiotic selection marker can be transfected into a CHO cell by a variety of
methods that include co-precipitation, lipofection, electroporation and microinjection. This
is grown in a media comprising antibiotics and simultaneously, deficient in glycine,
hypoxanthine, and thymidine. Post selection pressure, the transfected cell lines grow and
survive and the producing cells expand either as pools or colonies. It is then screened for
producing clones following which a scale-up step is performed in tissue culture plates or
flasks. It is then amplified via Methotrexate and one adapts the cells to grow in a serum-free
and protein-free suspension culture. A selection step is followed where top clones are
chosen based on titre, product quality and growth which is further apt for long term stability
evaluation by cell banking starting from the Master Cell Bank (MCB) to a Working Cell
Bank (WCB) and finally for production and operational processes.
13. 5
Table 1: Selected list of approved antibodies produced in CHO cells (Wlaschin & Yap, 1987)
Product Therapeutic use Manufacturer
Rituximab Chronic lymphocytic
leukaemia
Dr. Reddy’s Laboratories
Ltd.
Vectibix Metastatic colorectal cancer Amgen
Luveris Infertility Serono
Advate Hemophilia A Baxter
Orencia Rheumatoid arthritis Bristol-Myers Squib
Xolair Moderate/severe asthma Genentech
Aranesp Anemia Amgen
1.3 Media
Cell culture media plays the most important role in the culture environment and it is one of
the most demanding aspects for recombinant CHO cell lines. Hence, it necessary to optimize
the culture components as they provide nutrients, growth factors, hormones and also,
regulate the pH and osmotic pressure of the culture.
A chemically defined media is the most suitable for in vitro cell culture and it contains a
basic class of media known as the basal media. This medium is an amalgamation of small
components (sugars, vitamins, and amino acids) and it provides balanced salt concentrations
and osmolarity to allow cell growth. Basal media formulations must be further supplemented
with serum. Serum is a vital component in a cell culture media. It is free of blood cells and
most coagulation proteins. It acts as a source of growth and adhesion factors, hormones,
lipids and minerals for culture of cells in the basal media. As much as serum is an important
component, it has its drawback which is its contamination factor and the high cost.
14. 6
1.4 Culture conditions
Carbohydrates in the form of sugars are a major source of energy. Ideally, most media
contain glucose or galactose. The most commonly used proteins and peptides are albumin,
fibronectin, and transferrin. The binding capacity of albumin contributes in the removal of
toxic components from the media. Fibronectin is important for cell attachment whereas
transferrin is an iron transporter which is recycled in the culture broth. Vitamins are present
in modicum and are essential in the growth and proliferation of the cells. The optimal pH for
mammalian cells is 7.4 and they grow well at this pH. Nevertheless, some transformed cell
lines grow better at slightly acidic environments. Buffering of the cells is required against
changes in the pH. This is often achieved by the means of CO2-bicarbonate based buffer. pH
of the medium is dependent on the balance between dissolved CO2 and bicarbonate (HCO3
-
)
and thus, changes in the atmospheric CO2 can alter the pH of the medium. Most cell culture
experiments are carried out in 5-10% CO2 as this allows firm maintenance in the pH of the
medium. A drop in the pH results in the accumulation of lactic acid which is essentially a
by-product of cell metabolism. Also, lactic acid can be toxic to cells and is in probability,
sub-optimal for the growth of cells. Temperature of the incubator where mammalian cells
are grown is maintained at 36ºC to 37 ºC. In most cases, the temperature is maintained at a
slightly lower temperature than the optimal temperature as overheating poses a more serious
threat than underheating. Another essential component is the distilled water that is used for
various experiments involving mammalian cell lines. A typical water preparation involves
deionization through ion exchange followed by microfiltration to remove particulates and
bacteria and finally, reverse osmosis to reduce the conductivity. Lipids play an equally vital
role in protein secretion by the lipid bilayer membrane. The effect of lipid supply is the
medium is understated. Calcium and magnesium are responsible for cell-substrate adhesion.
Sodium and potassium help in balancing the membrane potential. Iron plays a role in
electron transfer complexes.
1.5 Growth Kinetics
An indication in the growth characteristics of a cell line can facilitate in the monitoring of
the cellular growth and if there happens to be any detrimental effect, one can know of it in
advance and prevent faulty experimental results. The cell growth curve is typically ramified
15. 7
into four different growth phases: Lag phase, Logarithmic growth phase, Plateau phase
and Decline phase. A classic growth curve displays a sigmoid pattern of proliferation.
The time following subculture and reseeding is a phase where there is little or no increase in
the cell number. The cells in the lag phase adapt to the culture conditions by replacing the
elements of the glycoprotein lost during trypsinization following which they attach to the
substrate and spread out. The length of this period depends upon the seeding density and the
growth profile of the cell line during the time of subculture.
The cell population is said to be the most viable in the log or the exponential phase where
the cells actively proliferate and an increase in the cell density arises. The culture is in its
most reproducible form as the growth fraction is as high as 90 to 100%. This phase is the
finest period for sampling and to determine the population doubling time. Suspension cells
should be passaged in the log phase growth before they reach confluency.
As confluency is reached at the end of log phase, the cellular proliferation slows down.
Consequently, the plateau phase is observed where the growth rate of the culture is reduced
as all the available growth surface is occupied. The growth fraction plummets to 0 to 10 %
and the cells are the most disposed to injury.
With the reduction in the number of viable cells, cell death predominates in the decline
phase. The cell death is not due to reduction in the nutrients but a natural occurrence in the
path of the cellular cycle.
Figure 2: Growth Kinetics
0
0.5
1
1.5
2
2.5
3
3.5
4
0 1 2 3 4 5 6 7 8 9
Viablecelldensity(million
cells/mL)
Culture age (Days)
16. 8
Chapter 2
Materials and Methods
Cell Culturing & Cell line
CHO cell lines secreting anti-rhesus IgG were obtained from BTI, Singapore. The cells were
cryopreserved with 10% DMSO (v/v) in a liquid nitrogen container (-196 ºC) at 107
cells/mL in 1mL vials.
Anti-rhesus IgG secreting CHO cells were cultured in a media encompassing 50% PF-CHO
(Thermo-Hyclone) and 50% CD CHO (Gibco-Invitrogen) supplemented with 2.0 g/L
sodium carbonate (sigma-Aldrich), 6mM L-Glutamine (Sigma-Aldrich), 0.10% Pluronic
(Himedia), 600 ug/mL G418 (Sigma-Aldrich) and 250 nM Methotrexate (Sigma-Aldrich) at
37 ºC in 20 mL Erlenmeyer flasks (Corning) in duplicates.
Cell counting
A Neubauer haemocytometer was used for counting the number of live and dead cells by a
dye exclusion method. Trypan Blue (HiMedia) dye is used to stain dead cells. Due to the
specific permeability of this dye, it can penetrate only through dead cells. Dilution factors
were maintained appropriately to obtain a minimum of 10 cells/square of haemocytometer.
Various growth parameters using formulae given below:
Viable cell density: VCD =
𝐿𝑖𝑣𝑒 𝑐𝑒𝑙𝑙𝑠 ∗ 𝐷𝐹
𝑛𝑢𝑚𝑏𝑒𝑟 𝑜𝑓 𝑠𝑞𝑢𝑎𝑟𝑒𝑠 ∗10000
Dead cell density: DCD =
𝐷𝑒𝑎𝑑 𝑐𝑒𝑙𝑙𝑠 ∗𝐷𝐹
𝑛𝑢𝑚𝑏𝑒𝑟 𝑜𝑓 𝑠𝑞𝑢𝑎𝑟𝑒𝑠 ∗10000
Total cell density: TCD =
𝑇𝑜𝑡𝑎𝑙 𝑐𝑒𝑙𝑙𝑠 ∗𝐷𝐹
𝑛𝑢𝑚𝑏𝑒𝑟 𝑜𝑓 𝑠𝑞𝑢𝑎𝑟𝑒𝑠 ∗10000
Integral viable cell count: ∆ IVCC (i) =
[ 𝑋 𝑡ᵢ + 𝑋 𝑡ᵢ₋₁ ]
2
∗ (𝑡ᵢ − 𝑡ᵢ₋₁)
17. 9
IVCC (i) = ᵢ₌₀∆𝐼𝑉𝐶𝐶₍ᵢ ₎
Specific growth rate: µspecific =
𝑋 𝑡𝑜𝑡𝑎𝑙 𝑡2 − 𝑋 𝑡𝑜𝑡𝑎𝑙 (𝑡₁)
𝑋 𝑣 𝑡2 ∶ 𝑋 𝑣 𝑡1 ∗(𝑡2− 𝑡1)
Cumulative growth rate: µcumulative (ti) =
𝑋 𝑡𝑜𝑡𝑎𝑙 𝑡 𝑖 − 𝑋 𝑡𝑜𝑡𝑎𝑙 𝑡0
𝐼𝑉𝐶𝐶 𝑖
Specific death rate: Kd, specific =
𝑋 𝑑𝑒𝑎𝑑 𝑡2 − 𝑋 𝑑𝑒𝑎𝑑 (𝑡₁)
𝑋 𝑣 𝑡2 ∶ 𝑋 𝑣 𝑡1 ∗(𝑡2− 𝑡1)
Cumulative death rate: Kd, cumulative (ti) =
𝑋 𝑑𝑒𝑎𝑑 𝑡 𝑖 − 𝑋 𝑑𝑒𝑎𝑑 𝑡0
𝐼𝑉𝐶𝐶 𝑖
Glucose Assay
Glucose has to be regularly monitored in order to measure the substrate consumption rates
and for feed addition planning in fed-batch operations. The glucose estimation was
performed using GOD-PAP Glucose Estimation Kit (Biolab Diagnostics). The principle of
this experiment is shown below.
Glucose + O2 + H2O ------GOD---->Gluconic acid +H2O2
2 H2O2 + PAP ------POD----> Quinoneimine + 4H2O
Glucose is oxidized by Glucose Oxidase (GOD) to Gluconic acid with the simultaneous
formation of Hydrogen peroxide. The newly formed hydrogen peroxide reacts with Phenol
and 4-amino antipyrene) reagent in the presence of peroxidase (POD) enzyme coalescing
into a pinkish red dye Quinoneimine with λmax at 500 nm. Dextrose was used as a standard
starting from 10mg/mL serially diluted to 0.16 mg/mL
18. 10
Lactate Assay
Lactate levels need to be regularly assessed in a cell culture process in order to keep a track
of the cell viability. The estimation of lactate was done using lactate dehydrogenase enzyme
(Sigma) and the principle is summarized below.
Lactate + NAD <--------LDH---------> Pyruvate + NADH
Pyruvate + Hydrazone ------------> Pyruvate hydrazone
Here, lactate is oxidized to Pyruvate in the presence of lactate dehydrogenase (LDH)
enzyme. The hydrazone formation is triggered by hydrazine to prevent the reverse reaction
by LDH. The concentration of lactate present in the sample is commensurate to the increase
in absorbance at 340 nm as NAD+
is reduced to NADH.
The stock LDH (4250 u/mL) is diluted to a working concentration of 12.5 u/mL A fresh
stock of NAD solution (17 mg/mL) and lactate buffer (pH = 9.0) containing 0.5M glycine
(Himedia) was prepared for this assay. Standard is run with a fresh lactic acid solution
(Sigma) starting from 16mM serially diluted to 0.25 mM.
The calculations performed are shown below:
Specific Productivity (qp, specific) =
𝑃𝑟𝑜𝑑𝑢𝑐𝑡 𝑡2 − 𝑃𝑟𝑜𝑑𝑢𝑐𝑡 (𝑡1)
𝐴𝑣𝑒𝑟𝑎𝑔𝑒 𝑜𝑓 𝑋 𝑣𝑖𝑎𝑏𝑙𝑒 𝑡2 : 𝑋 𝑣𝑖𝑎𝑏𝑙𝑒 𝑡1 ∗ [𝑡2− 𝑡1 ]
Cumulative productivity (qp, cumulative) =
𝑃𝑟𝑜𝑑𝑢𝑐𝑡 𝑡 𝑖 − 𝑃𝑟𝑜𝑑𝑢𝑐𝑡 (𝑡0)
𝐼𝑉𝐶𝐶 𝑖
Enzyme Linked Immunosorbent Assay (ELISA)
Antibody titres in the culture supernatant were measured by sandwich ELISA using the
protocol ascribed by Chuainow et. al (2009). 10 µg/mL Goat Anti-human IgG + IgA + IgM
(H + L) (KPL, USA) was used as the primary coating antibody. Dilution of 1:200 Alkaline
Phosphatase conjugated with anti-human IgG (Fc specific) was used as a secondary antibody
(Sigma-Aldrich, St. Louis, MO) was used as the substrate. The absorbance was read at 405
nm using a multi plate reader (Spectramax M5e, Molecular Devices, USA). Human IgG
(Sigma-Aldrich, St. Louis, MO) was used as a standard.
19. 11
The calculations followed are shown below.
Specific Productivity (qp, specific) =
𝑃 𝑡2 − 𝑃(𝑡1)
𝑋 𝑣 𝑡2 : 𝑋 𝑣 𝑡1 ∗ (𝑡2− 𝑡1)
Cumulative productivity (qp, cumulative) =
𝑃 𝑡 𝑖 − 𝑃(𝑡0)
𝑋 𝑣
𝑡
𝑡0
𝑑𝑇
P(t) is the concentration of IgG at time t determined by ELISA.
Thioflavin T Assay
This assay is basically to quantify the presence of misfolded protein aggregates by
measuring the change in fluorescence intensity of Thioflavin T (Sigma). Thioflavin T (4-(3,
6-dimethyl-1, 3-benzothiazol-3-ium-2-yl)-N, N-dimethylaniline chloride) is a benzothiazole
dye that exhibits enhanced fluorescence upon binding to proteins that are rich in β-sheet
structures. ThT portrays fluorescence intensity upon binding to these structures at an
emission wavelength of 482 nm and an excitation wavelength of 450 nm. Cell
concentrations in the range of 105
to 2 X 106
have been used as the initial concentration
following which it was serially diluted to 0.015624 dilution units/µL. This assay has also
been performed with supernatant to quantify the presence of misfolded aggregates in the IgG
titres.
Reactive Oxygen Species Assay
ROS assay is typical method to measure the ROS activity within the cell. The major source
of ROS is complex I and Complex II which is a part of the mitochondrial electron transport
chain. This assay uses a cell permanent reagent, 2, 7 – dichlorofluorescein diacetate
(DCFDA, Sigma). DCFDA is converted to a non-fluorescent compound in the presence of
deacetylated cellular esterases which then leads to the formation of 2, 7 – difluorescein
(DCF) by oxidation of the reactive oxygen species. Lower levels of ROS play an important
role in signalling pathways and hence, it can give us information regarding the extent to
which cell is damaged due to apoptosis and necrosis.
20. 12
Chapter 3
Cell Culture Assay Results
3.1 Growth curve
The cells were daily maintained at 37 o
C, 85 % R.H., 8% CO2 and 110 rpm culture
conditions with periodic sub-culturing on day3 or 4. These cells were then grown in three
different conditions mentioned below.
Culture Methotrexate Gentamycin Media nutrients
MTX YES YES YES
NO MTX NO YES YES
NO G418 NO NO YES
A detailed comparison of growth and death parameters was performed for the passage
number 51. VCD reached a maximum of 7.05 x 106
cells/mL on Day 5 for No MTX
containing culture whereas the other two cultures remained around 5.1 x 106
cells/mL.
Figure 3: Viable cell densities of MTX, No-MTX, & No-G418 treated 250-4 cells
0
1
2
3
4
5
6
7
8
0 1 2 3 4 5 6 7
Millioncells/mL
Time (Day)
MTX
No MTX
No G418
21. 13
Figure 4 shows the viability comparison for the different treated cultures. The viability
profile is similar for all the conditions throughout the culture duration.
Figure 4: Viability profile
The specific growth rate is highest for the culture where Methotrexate is absent. This could
lead to a possibility that when Methotrexate is present the growth is slowed to an extent as
more resources are diverted towards IgG production. By day 6, the growth rate substantially
decreases.
Figure 5: Specific growth rate profile of MTX, No-MTX and No G418 treated 250-4 cells
0
20
40
60
80
100
120
0 2 4 6 8
Percentage(%)
Time (Day)
MTX
No MTX
No G418
0
0.2
0.4
0.6
0.8
1
1.2
1 2 3 4 5 6
Specificgrowthrate(Day-1)
Time (Day)
MTX
No MTX
No G418
22. 14
3.2 Glucose and Lactate Assay
A glucose standard was run using the serial dilution method starting from a concentration of
10 mg/ml. It helps us in monitoring the substrate consumption rate and planning for nutrient
addition time points.
Similarly, a lactate standard was run using a serial dilution technique beginning with a
concentration of 16mM lactic acid solution. Higher lactate levels are toxic to the cells as
they reduce the culture pH significantly.
Figure 6: Glucose and Lactate Standard Curve
Figure 7: Glucose and lactate assay for control cultures.
y = 0.173x - 0.199
R² = 0.975
0
0.2
0.4
0.6
0.8
1
1.2
1.4
1.6
1.8
0.00 2.00 4.00 6.00 8.00 10.00 12.00
Absorbanceat500nm
Glucose concentration (mg/mL)
y = 0.056x + 0.078
R² = 0.985
0
0.2
0.4
0.6
0.8
1
1.2
0 5 10 15 20
Absorbanceat340nm
Lactate concentration (mM)
23. 15
A glucose and lactate assay was performed on control samples (MTX) for two biological
replicates and results are plotted as an average. The glucose levels during inoculation are
around 6 g/L. At the end of the culture on day 8, the glucose levels are as low as 1g/L.
Initially the lactate levels up to day 4 are very low but reach considerable high levels of 16
mM by day 9.
3.3 IgG quantification
The IgG levels in the culture were quantified using sandwich ELISA. The IgG levels in
control culture reached to 1.35 mg/mL by day 8. The cumulative productivity started to
increase from day 4 onwards reaching an maximum value of 90 pg/cell-day.
Figure 8: IgG titers and cumulative productivity.
0
300
600
900
1200
1500
0 2 4 6 8
IgG(µg/mL)
Time (days)
0
10
20
30
40
50
60
70
80
90
100
1 2 3 4 5 6 7 8
pg/(cell-day)
Time (days)
24. 16
Chapter 4
Unfolded Protein Response
The endoplasmic reticulum is the cardinal membrane of a complex process, Protein Folding,
where the secretary and the transmembrane proteins conform in their native state. Like in
several biochemical pathways, the early steps in the secretary pathway are controlled and the
transit from the endoplasmic reticulum to the Golgi complex is rate-limiting (Schroder &
Kaufman, 2005). The Golgi becomes another primary site as the post-translational
modifications of the protein occur in this organelle which is essentially important for its
activity and structure. Factors like nutrient deprivation and overloading of cholesterol and
genetic mutations lead to perturbations in the ER and disrupt the normal functioning of the
ER (Kraskiewicz & FitzGerald, 2012). In such an instance, when the protein folding is
encumbered, the signal transduction pathways play a key role in bringing the endoplasmic
reticulum to homeostasis. In a simple way, it can be said that if the influx of the newly
formed polypeptides is much greater in comparison to the folding capacity of the protein,
there is bound to be a certain perturbation which causes distress to the endoplasmic
reticulum. The signal transduction pathway increases the biosynthetic capability whilst
decreasing the biosynthetic burden of the endoplasmic reticulum (Schroder & Kaufman,
2005). Consequently, the unfolded protein response (UPR) is activated to return the
endoplasmic reticulum back to its normal state. This is an example of what is called as
―endoplasmic reticulum stress‖. The endoplasmic reticulum quality control and the ERAD
(endoplasmic reticulum associated degradation) machinery guarantees some credence to the
folding mechanism (van Anken & Braakman, 2005).
25. 17
Figure 9: A basic outline of the protein secretion pathway
2.1 The unfolded protein response pathway
The UPR is basically a way of managing the secretion pathway by attenuating protein
translation and increasing the synthesis of molecular chaperones(Schroder & Kaufman,
2005). As a result, the endoplasmic reticulum increases in size to dilute the increased protein
load. Binding immunoglobulin protein (BiP) or GRP78 is the most critical member of the
HSP70 (Heat Shock Protein 70) family of chaperones which ensures that incorrectly folded
proteins do not exit the endoplasmic reticulum. The transduction of unfolded protein signals
occur when the folding protein binds to a molecular chaperone. This, in turn activates three
transmembrane proteins namely:
(i) ATF6 - Activating Transcription Factor
(ii) PERK – Protein Kinase RNA-like Endoplasmic Reticulum Kinase
(iii) IRE1 – Inositol Requiring Kinase 1
26. 18
ATF6 is a membrane spanning protein containing two homologs (ATF6α and ATF6β) with
an unfolded protein sensor domain and an effector domain in the cytosol (Schroder &
Kaufman, 2005; van Anken & Braakman, 2005). It ultimately leads to the up regulation of
the pro-survival transcriptional program in the presence of unfolded or misfolded proteins
(Szegezdi, Logue, Gorman, & Samali, 2006). ATF6 contains two N-terminal Golgi
localization sequences (GLS1 and GLS2) which are apparently involved in the regulation of
BiP (Schroder & Kaufman, 2005). When BiP dissociates from the N-terminal, ATF6 is
translocated to the Golgi where it is cleaved by regulated intramembrane proteolysis with
the help of serine protease (S1P) and metalloprotease site-2 protease (S1P). This cleaved
ATF6 initiates a gene expression program synergistically with bZIP (basic leucine zipper)
factors for example; Nuclear Factor-Y which is responsible for degradation of unfolded
proteins and an increase in the chaperone activity (Schroder & Kaufman, 2005). ATF6
induces the expression of X-box binding protein (XBP1) which essentially activates various
chaperones and control elements. XBP1 has two versions of which one is the unspliced form
(XBP1u) and the other is the spliced form (XBP1s).
PERK is a type I endoplasmic reticulum transmembrane kinase and it has an ER luminal
stress sensor and cytosolic protein kinase domain (Oslowski & Urano, 2011; Schroder &
Kaufman, 2005). As BiP dissociates from the N-terminal of the kinase domain, it causes the
initiation of dimerization and autophosphorylation of the kinase domain. It is of concern
that the C terminal of the cytosolic domain shares homology with the eif2α (eukaryotic
translation initiation factor) (Schroder & Kaufman, 2005). Activated PERK phosophorylates
eIF2α following which there are marked downstream effects of importance to the UPR.
First, the phosphorylated eIF2α attenuates translation resulting in the decrease of protein
entrance to the ER and consequently, it decreases the folding load to a reasonable extent
(Oslowski & Urano, 2011). In actuality, the attenuation of translation isn’t universal and
some genes don’t succumb to this translational block (Szegezdi et al., 2006). ATF4 is one
such gene and it is responsible for driving the expression of pro survival functions. ATF4
gives rise to the expression of CHOP (C/EBP homologous protein), also known as GADD34
(Growth-arrest and DNA damage-inducible gene), which is a transcriptional factor. CHOP is
said to be associated with apoptotic cell death by suppression of BCl2 expression and
sensitization of cells to endoplasmic reticulum stress inducing agents (Szegezdi et al., 2006).
IRE1 is a type I transmembrane protein kinase that is comprised of an endoribonuclease
domain and a Serine-Threonine kinase domain (Oslowski & Urano, 2011; Schroder &
27. 19
Kaufman, 2005). The N-terminal domain of IRE1 recognizes unfolded or misfolded
proteins by BiP interaction. Post dissociation of BiP from this domain, there is IRE1
dimerization followed b7y autophosophorylation of the endoribonuclease and the kinase
domains. This endoribonuclease activity cleaves an intron from XBP-1 mRNA leading to a
spliced form of XBP-1. This is accountable for regulating the expression of ER chaperones
and ER associated degradation (ERAD). In addition, the cytosolic IRE1 dimers interact
with adaptors like TRAF2 (Tumour necrosis factor receptor associated factor 2) and drive
the expression of signal regulating kinase (ASK1) which initiates apoptosis.
Figure 10: An outline of UPR
APOPTOSIS
28. 20
Chapter 5
Biochemical Assays to quantify ER Stress
5.1 Thioflavin Assay
Thioflavin T, also known as Basic Yellow, is a dye with a yellow component that is actually
responsible for staining amyloid fibrils in solution. It was suggested that the positive charges
of the dye was involved in micelle formation (Khurana et al., 2005). The basic conclusion
that could be drawn from this information is that increased fluorescence of amyloid
(essentially known to bind to Thioflavin for detection) causing it to be selectively brighter
than the background as a result of the increased fluorescence of the micelles attaching to it.
The increase in the fluorescence quantum yield can be ascribed to the restriction of torsion
oscillations of the ThT fragments when the dye incorporates in the amyloid fibril
(Kuznetsova, Sulatskaya, Uversky, & Turoverov, 2012). It was revealed that when ThT
binds to fibrils, it displayed a striking shift of its excitation maximum from 385 nm to 450
nm and emission maximum from 445 nm to 485 nm (Picken MD, PhD, FASN, Dogan,
M.D., Ph.D., & Herrera, M.D., 2012). Researchers are still ambiguous when it comes to
high-resolution characterization because of the insolubility and the heterogeneous nature of
the amyloid fibrils (Groenning, 2010). Despite the shortcomings of Thioflavin T as a dye, it
has been used for estimation of misfolded aggregates as it provides a broad staining
capacity, an extraordinary sensitivity and ease of use.
We indulged in obtaining RFUs for the supernatant culture as this can give us information
about the presence of misfolded aggregates in the IgG titers and consequently, we can gain
crucial information on the stress quantification in these supernatant samples of differently
treated cultures.
29. 21
5.2 Thioflavin T assay Results
The Thioflavin assay requires one to optimize the dye concentration and hence, an
experiment was performed to check the optimal concentration range of dye that should be
used. As seen in the figure, saturation was observed at higher concentrations of the dye
suggesting that lower concentrations should be considered for conclusive results.
Figure 11: RFU vs dye concentration
To verify that RFU increases with concentration of cells or with decrease of diluted
supernatant solutions, we ran a standard with supernatant and cells of 250-4 CHO cell lines.
A standard curve was obtained with increasing concentration of cells to verify that RFU
increases with increase in the concentration. The final working dye concentration that was
used is 20 µM.
0
100
200
300
400
500
600
700
0 50 100 150 200 250 300
RFU
Dye concentration (µM)
30. 22
Figure 12: Standard curve with 250-4 cells
A standard curve was obtained with 250-4 Methotrexate containing culture cells which were
serially diluted. The initial concentration of the cells was 1.5 X 106
cells. This again verified
that RFU increases with increase in the concentration. The final working dye concentration
that was used is 20 µM.
Figure 13: Standard curve with 250-4 MTX culture
y = 0.003x + 75.49
R² = 0.990
0
500
1000
1500
2000
2500
0 0.2 0.4 0.6 0.8
Fluorescence
Million cells
y = 0.000x + 326.7
R² = 0.994
0
200
400
600
800
1000
1200
0 0.5 1 1.5 2
Fluorescence
Million cells
31. 23
A ThT assay was done for media (Day 0) and MTX supernatant (Day 1) with a dye
concentration of 25µM. End point results were plotted. The RFU for media has shown a
significantly lower value as compared to the MTX supernatant. This validates the
functionality of the assay.
Figure 14: RFU vs. dilution units/µL comparison for media and supernatant
Likewise, a standard curve was run with the culture supernatant that was serially diluted.
With an increase in the dilutions, RFU showed a proportional decrease.
Figure 15: Standard curve with supernatant of 250-4 CHO cells
0
20
40
60
80
100
120
140
160
0 0.2 0.4 0.6 0.8 1 1.2
Fluorescence
Dilution units/µL
Media
Supernatant
y = 494.2x + 46.72
R² = 0.984
0
100
200
300
400
500
600
0 0.2 0.4 0.6 0.8 1 1.2
Fluorescence
Dilution units/µL
32. 24
ThT assay was performed with Day 5 supernatant samples for three different conditions i.e.
MTX, No MTX and No G418. The final working concentration for the dye was 25µM and
the incubation period was 30 minutes. At the point where there is zero-dilution, the No-
G418 culture showed the highest RFU suggesting higher amounts of misfolded proteins in
the culture.
Figure 16: ThT comparison for MTX, No-MTX, & No-G418 culture conditions
ThT assay was performed for supernatants of the culture treated with different conditions;
Control (Con), Suppressor (Sup 1 and 2). The dye concentration followed was 20µM. The
increase in misfolded proteins was evident from the increasing RFUs in the cultures treated
with suppressors of UPR pathway.
Figure 17: RFU plot for suppressor of UPR
0
100
200
300
400
500
600
MTX No MTX No G
Fluorescence
0
50
100
150
200
250
300
350
Con Sup 1 Sup 2
RFU
Tht assay for suppressor of UPR
33. 25
Another ThT assay was performed with supernatant of 250-4 cells of which one is Control
and the other is treated with an inducer resulting in higher productivity (Ind 1). The final
working dye concentration was 20µM. An increase in the RFU values for Ind 1 treated
culture on Day 2 and Day 3 showed that the misfolded aggregates are higher in the Ind 1
treated cultures.
Figure 18: ThT comparison for Control (dark) & Ind 1 (light) treated culture
This assay suggests that the suppression of UPR pathway leads to the formation of
misfolded aggregates as the suppressor block one of the arms of UPR pathway leading to
constraint n the availability of folding resources. But contrary to that, treatment with an
strong inducer (Ind 1) of overall protein synthesis pathway too resulted in aggregate
formation again suggesting limitation of folding resources. In order to achieve a high quality
and quantity of titers, there needs to be balance between unfolded proteins and folding
machinery.
5.2 ROS Assay
Specific production rate is high for proteins such as monoclonal antibodies in mammalian
cells as they grow more rapidly after the cell growth phase than during the growth. In any
case, it becomes difficult for the cell activity to be maintained in the protein production
phase which can be due to the poor nutritional conditions surfacing from the low-serum or
serum-free environment. As such, from this information, one can say that death of
0
50
100
150
200
250
Day 2 Day 3
RFU
34. 26
mammalian cells including CHO cells is mainly via the apoptotic pathway. Owing to this, it
is necessary to optimize strategies to increase protein productivity by downregulating the
apoptotic pathway (Yun, Takagi, & Yoshida, 2003). Reactive oxidation species (ROS) such
as superoxide, hydrogen peroxide, hydroxyl radical, and singlet oxygen are shown to induce
apoptosis by suppressing the association of cytochrome c which causes the loss of
mitochondrial transmembrane potential (Yun et al., 2003). Naturally, the viability of cells
decreases when the ROS production increases. The two major sources of ROS are said to be
complex I and complex III which is a part of the mitochondrial electron transport chain.
They generate ROS when the electron transport is slowed down by high mitochondrial
membrane potential. Alterations in the ROS or the redox status directly or indirectly affect
ER homeostasis and protein folding (Malhotra & Kaufman, 2007). The major enzymatic
components of UPR that contribute to ROS production are protein disulfide isomerase
(PDI), NADPH Oxidase complexes, and endoplasmic reticulum oxidoreductin (ERO-1)
(Bhandary, Marahatta, Kim, & Chae, 2012). It is said that by way of depletion of
Glutathione (which essentially decreases ROS) during protein misfolding, ROS is produced
during disulfide bond formation. It is being said that ER stress and ROS production are
linked to one another in the UPR pathway and is the cause of a few pathological diseases.
We have performed the ROS assay to quantify these species in differently treated cultures.
Also, as we quantify the ROS, we can gain information regarding the amount of ROS
responsible for apoptosis and thereby, the contribution of ROS to the ER stress. The dye
used was 2’, 7’ – dichlorofluorescein diacetate (DCFDA) as it rapidly and efficiently
diffuses into the cells as a colorless probe (Pogue et al., 2012). A kinetic is run for an ROS
assay and the values are plotted at the 60th
minute.
35. 27
5.3 ROS assay Results
A standard curve with different dye concentrations and cell concentrations was run to check for the
sensitivity of the assay. It was found out that, at the lower concentrations of dye the assay is linear.
So concentrations ranging 5-25 µM of DCFDA were used depending on the available numbers of
cells for analysis.
Figure 19: ROS Standard curves with different dye concentrations
ROS assay was performed with Day 3 samples of 250-4 cells for three different conditions
i.e. MTX, No MTX and No G418. DCFDA dye concentration used was 5µM. The excitation
and emission wavelengths are 485 nm and 525 nm respectively. Initial number of cells that
was considered is 2.5 X 106
following serial dilution. It can be inferred that the MTX culture
has a higher RFU at the second lowest dilution suggesting that the amount of ROS is the
highest in the culture treated with Methotrexate.
Figure 20: ROS Comparison for 1.25 X 106
cells
0
50
100
150
200
250
0 100 200 300
RFU
Dye conc. (µM)
ROS standard curve (0.5 million
cells)
0
200
400
600
800
1000
1200
1400
0 100 200 300
RFU
Dye conc. (µM)
ROS standard curve (1 million cells)
0
500
1000
1500
2000
2500
3000
0 100 200 300
RFU
Dye conc. (µM)
ROS standard curve (5 million cells)
0
10
20
30
40
50
60
70
80
MTX No MTX No G
RFU
36. 28
ROS assay was performed with Day 5 samples of 250-4 CHO cells for three different
conditions i.e. MTX, No MTX and No G418. The DCFDA dye concentration was changed
to 10µM to check the sensitivity of the dye and the effect it has on the treated cells. Initial
number of the cells was 106
following serial dilution. As shown, Methotrexate containing
culture still maintains a higher RFU than the respective cultures suggesting that ROS is
present in an increased amount in this culture. The dye concentration seems to have not had
an effect to a large extent when used in the range of 2 to 10 µM.
Figure 21: ROS comparison for 0.5 X 106
cells
In order to see the generation of ROS pattern throughout the culture, daily ROS assay was
done with 0.5 million cells. It was observed that the latter half of the culture (Day 4
onwards) had higher ROS concentration as compared to the early stages. We had also seen
an increase in cumulative productivity from day 4 onwards suggesting that higher
productivity conditions leads to higher ROS formation.
Figure 22: Complete culture ROS profile
0
500
1000
1500
2000
2500
MTX No MTX No G418
Fluorescence
0
40
80
120
160
200
240
280
1 2 3 4 5 6 7
RFU
Time (Day)
Day-wise ROS profile
37. 29
ROS Assay was performed for Control and Tunicamycin (inhibitor of glycosylation) treated
cultures. It was evident from the results that, from the time-point of addition of
Tunicamycin, there was a significant increase in ROS levels as compared to control.
Tunicamycin treatment is known to increase productivity but such high levels of ROS levels
lead to formation of misfolded proteins.
Figure 23: ROS assay for control and Tunicamycin treated cultures
0
100
200
300
400
500
600
1 2 3
RFU
Time (Day)
ROS assay (Con vs Tun)
Control
Tun
38. 30
Chapter 6
Multiple sequence alignment and stress elements identification
Recombinant antibodies are presently the most significant biologics in mammalian cell
culture. Owing to this, their demand has increased manifold and it has become essential to
employ methods that improve antibody-titer in bio-production. It is essential to study and
locate these stress element sequences like ERSE and UPRE, in various genes that are
directly related to the protein processing pathway as it will help us in identifying genes that
are likely to get induced under stress conditions like excess protein production.
Consequently, we can gain information on various methods and components that affect the
production of the biopharmaceutical products.
Promoter regions are crucial regions that work synergistically with other regulatory regions
to direct the transcription of a gene. The promoter is located in a region upstream of the
gene. The promoter length can vary from 100-1000 bp but for the purpose of easy analysis,
we have considered locating these sites in a 500 bp region. Specific and short DNA
sequences called binding sites are located in this region. The ER Stress Response Element
(ERSE) has a consensus sequence CCAAT-N9-CCACG which is essential and adequate for
the induction of at least three major chaperones GRP78, GRP94, and calreticulin. The
Homocysteine-responsive endoplasmic reticulum-resident ubiquitin-like domain member 1
protein (HERP) which is one of the most highly inducible genes during the UPR, contains
not only the ERSE I but also the cis-acting element ERSE II having consensus sequence of
ATTGG-N-CCACG (Samali, Fitzgerald, Deegan, & Gupta, 2010). The Unfolded Protein
Response Element (UPRE) containing a consensus sequence of TGACGTGG/A was
initially considered as a DNA sequence bound by ATF6. The CCACG domain in the ERSE
I and ERSE II elements is considered the primary binding site (Samali et al., 2010). For
example, XBP1s binds to this domain without NF-Y/CBF factor while A|TF6 requires this
nuclear factor to bind at the same site (Kokame, Kato, & Miyata, 2001). The GC box has a
consensus sequence if GGGCGG and is usually located 100 bp upstream to the transcription
site. The TATAA box is located approximately 70 bp upstream of the start site. It is said to
associate with the transcription process by RNA polymerase.
39. 31
The following flow chart explains the methodology used for identifying the stress element
sites in genomic DNA sequences of a particular chaperone or gene.
Mapping the upstream regions of the UPR genes involves an extensive protocol as shown in
the flow chart. The CHO genome database provides upstream sequences of some genes
involved in the UPR and the connecting apoptotic pathway. After entering the desired name
of the gene in this database, the mRNA of the respective gene shows a symbol representing
the gene. From here on, one can acquire an external link to the National Center for
Biotechnology Information (NCBI) site with a unique gene ID. The genomic location on the
NCBI website leads to a choice for downloading sequences of which GenBank provides the
necessary information for the given protocol. This opens up an entire page of information
regarding coding DNA regions and the upstream sites. Locate the start ATG codon site and
extract the FASTA sequence of the promoter sequences from the CDS region. From the 500
40. 32
bp of nucleotides that one obtains from this region, ERSE, UPRE, GC box, and TATA box
sites can be located and marked successfully. For the genes in human, rat and mouse; the
protocol differs slightly. In this case, one can directly enter the gene name on the NCBI gene
database and choose the required gene from the gene ID and the remaining protocol stands
the same as explained. It is important that the reference sequence number be noted for future
work.
Table 2: Overview of the UPR site information for chaperones
Sites/Gene ERSE I ERSE II UPRE TATA box GC box
GRP78 (CHO) Y* Y* N Y Y
GRP78
(Human)
Y N N N Y
GRP78 (Mouse) Y Y* Y* Y Y
GRP78 (Rat) Y Y* Y* N Y
GRP94 (CHO) Y Y* N N N
GRP94
(Human)
N Y* Y* N Y
GRP94 (Mouse) Y N Y N Y
GRP94 (Rat) Y* Y* Y* Y* N
ERDJ4 (Human) N Y* Y* Y N
ERDJ4 (Mouse) N Y* Y* Y N
CNX (CHO) Y* N Y* N N
CNX (Human) Y* Y* N N N
CNX (Mouse) Y* Y* N N N
CNX (Rat) N Y* N N N
CRT(CHO) Y* Y* Y* Y N
CRT (Human) Y* N Y* Y Y
CRT (Mouse) N Y* Y* N Y
CRT (Rat) N Y* N Y Y
PDI (CHO) N Y* Y* N N
41. 33
Table 3: an overview of the UPR site information for UPR pathway and the related apoptotic pathway
Sites/Gene ERSE I ERSE II UPRE TATA box GC box
ATF4 (Human) Y* Y* Y* N Y
ATF4 (Mouse) N Y* Y* N Y
ATF4 (Rat) N Y* Y* N Y
CHOP (Human) Y* Y* Y* Y N
CHOP (Mouse) Y* Y* N N N
CHOP (Rat) Y* Y* N N N
GADD34 (Mouse) Y* Y* Y* N N
GADD34 (Human) Y* Y* Y* N N
GADD34 (Rat) Y* N Y* N N
XBP1s (Mouse) Y* Y* Y* N N
XBP1s (Human) Y* Y* Y* N N
XBP1s (Rat) Y* Y* Y* N Y
ATF6 (Mouse) Y* N Y* Y N
EDEM (Mouse) Y* N Y* N Y
PERK (Mouse) Y* Y* N Y N
HIFa (Mouse) Y* Y* Y* N N
B Actin (CHO) Y* Y* Y* N N
CASP3 (CHO) N Y* Y* Y N
FADD (Mouse) Y* Y* Y* N Y
BAX (CHO) N Y* Y* N N
BCl2 (Mouse) Y* Y* Y* N Y
BAK1 (CHO) Y* Y* N N N
CASP8 (CHO) Y* Y* Y* N N
JNK1/MAPK8
(CHO)
N Y* N N N
TRAF2 (CHO) Y* Y* Y* N N
BID (Mouse) Y* Y* Y* N N
TRIB3 (Mouse) Y* Y* N N N
ASK1/MAP3K5
(Mouse)
Y* Y* N Y N
Cyclin D1 (CHO) Y* Y* N N N
CDK2 (CHO) Y* Y* N N N
42. 34
APAF1 (CHO) N Y* N N N
6.1 Verification Tools
Multiple Em for Motif Elicitation (MEME) is a tool for identifying motifs in groups of
nucleotide or protein sequences. The input to MEME is a set of unaligned sequences in the
FASTA format. In this particular case, the aim was to match the endoplasmic reticulum
stress element (ERSE I and ERSE II) and the UPRE sites from the promoter regions of the
unfolded protein response related genes. The basic aim was to check the occurrences of the
required sites and the consensus sequences. Further, when the FASTA sequences were
added in the input site of MEME, it was found that the sites that were being probed were
highly conserved and hence, the motif sites did not give a conclusive result. Therefore, the
FIMO (Find Individual Motif Occurrences) tool provided a clinching output result. The
protocol that was followed is:
Go to www.meme.ncbr.net which gives a MEME Suite webpage
↓
Choose ―Discover New Motifs Using MEME‖ from the ―Submit A Job‖ menu
↓
In the Data Submission Form, provide the email address for result submission along
with FASTA sequences containing a repetition of the sequence for the required site
↓
The minimum and maximum width of the resulting sequence can be inserted as per
the requirement (here: 5) with a choice of repetitions
↓
Click on the link containing the results in various output formats. In this case,
HTML output provides a conclusive output
↓
The motif result page gives you a detailed summary of the sites. The site that is
aimed at, for e.g.: CCACG is shown along with the start position
↓
An option for further analysis provides a link to ―FIMO‖
↓
FIMO will search the site using the previously provided motif in MEME. Paste the
desired sequences in the FASTA format and choose the p-value output threshold =1
↓
Start the search
43. 35
↓
View the results in the FIMO HTML output
↓
The results are shown in a tabular format for the high-scoring motif occurrences
along with the start and the end site
Further, Multiple Sequence Alignment from MultiAlin by Florence Corpet was performed
for the sequences of different organisms to check whether they share a common ancestry.
This helps in determining the extent to which the sequences of the same gene among
different organisms are related. We can obtain a set of aligned sequences and then locate the
UPR sites. This saves the time-consuming process of manually aligning each sequence and
also, eases out the process of analyzing the data sequences. The FIMO results that were
obtained in a tabular format aids in locating the sites from the aligned gene sequence data.
After obtaining this aligned data, the consensus sequence was matched for the various sites.
For every gene whose sequences were available for three or more organisms, a table was
deduced with the consensus positions as shown in the following pages.
Table 4: List of consensus positions for UPR genes
Gene/Sites ERSE I ERSE II UPRE AARE I AARE II TATA
Box
CAAT
Box
GC
box
GRP78 -317 to -
336
-22 to -31 -409 to -
418
(partial)
-323 to -
332
(partial)
-323 to -332
(partial)
-278 to
-283
-353 to
-362
-
GRP94 -302 to -
321
-274 to -283
(partial)
-430 to -
436
(partial)
-398 to -
407
(partial)
-398 to -407
(partial)
- -
-105
to -
111
CRT -321 to –
340
(partial)
-282 to -
291(partial)
-94 to -
103
(partial)
-396 to -
405
(partial)
-396 to -
405(partial)
-101 to
-106
- -
44. 36
CNX -75 to -
94
(partial)
-48 to -57
(partial)
-257 to -
266
(partial)
-183 to -
192
(partial)
-183 to -192
(partial)
- - -
ATF4 -202 to -
221
(partial)
-446 to -455
(partial)
-322 to -
331
(partial)
-21 to -
30
(partial)
-21 to -30
(partial)
- - -
CHOP -853 to -
872
(partial)
-559 to -568
(partial)
-117 to -
126
(partial)
-546 to -
555
(partial)
-546 to -555
(partial)
- - -
GADD34 -87 to -
106
(partial)
-248 to -257
(partial)
-209 to -
218
(partial)
-28 to -
37
(partial)
-28 to -37
(partial)
- - -
XBP1 -97 to -
116
-165 to -174
(partial)
-422 to -
431
(partial)
-441 to -
450
(partial)
-441 to -450
(partial)
- - -42
to -
48
61. 53
Chapter 7
Discussion and Conclusion
Mammalian cell productivity has become a primary topic of research. Cell culture
technology has become a powerful medium through which one can alter process parameters
and assess the effects they have on the productivity profile of a particular cell line. CHO cell
lines have become this valuable tool to monitor and control these processes due to the ease
of post-translational modifications and glycosylation. The UPR pathway is the cardinal
pathway which links the overall productivity of recombinant proteins and the folding
capacity of the protein. The UPR, which is responsible for bringing the endoplasmic
reticulum to homeostasis in events of misfolding of proteins, provides an insight into the
mechanism of action that takes place in order to allow the secretion of correctly folded
proteins. An essential understanding of the three UPR transmembrane sensors namely
ATF6, PERK and IRE-1, helped us in overlooking the modifications that we can assume in
performing the experiments.
Metabolic assays, on the other hand, give us vital details regarding the consumption rate and
the productivity profile as a whole. Accumulation of lactate at the end of glycolysis causes
disturbance in the environment of the mammalian cell culture system and hence, it is a
critical limiting factor especially when cell density is high. Thus, the lactate levels of a
particular culture act as an indicator of deteriorating culture. The glucose consumption rate
acts as an indicator of the amount of substrate being consumed. When the cells are reaching
its decline phase, the glucose levels substantially decrease.
Tunicamycin is an antibiotic that inhibits N-linked glycosylation which consequently cause
the accumulation of unfolded proteins in the ER. The treatment of cells with tunicamycin
increased the overall IgG titers (data not shown) but accordingly led to increase in ROS and
misfolded proteins. Similarly treating with other inducers and suppressors resulted in
misfolded protein formation validated by Thioflavin T assay. The ease and sensitivity of the
Thioflavin T assay can be employed in screening large sets of inducers and suppressors
without using costlier and labor intensive techniques. The ROS data indicated that at higher
productivity stages or conditions, there is a significant increase in the ROS concentrations
inside the cell.
62. 54
The computational data gives an altogether different dimension to studying the UPR
pathway and applying it in the productivity profile. Here, the aim is to locate the ERSE and
the UPRE sites in the coding DNA sequences of the transcription factors involved in UPR.
This way, one can determine if there are genes linked to the UPR pathway containing the
primary binding ERSE sites. And from this information, it can give an idea if there are
certain genes that have an effect on ER stress and the mechanism by which they have a
substantial effect, if at all.
To conclude, various parameters have been studied that are said to have an effect on ER
stress and consequently, the productivity. The growth kinetics of CHO cells showed a
variable effect and we could study the effect it eventually had on the culminating days of the
culture profile. The computational data that were obtained for various UPR genes provided
a way to focus closely on the sites and their consensus sequences.
63. 55
References
Bhandary, B., Marahatta, A., Kim, H.-R., & Chae, H.-J. (2012). An involvement of
oxidative stress in endoplasmic reticulum stress and its associated diseases.
International Journal of Molecular Sciences, 14(1), 434–56.
doi:10.3390/ijms14010434
Groenning, M. (2010). Binding mode of Thioflavin T and other molecular probes in the
context of amyloid fibrils-current status. Journal of Chemical Biology, 3(1), 1–18.
doi:10.1007/s12154-009-0027-5
Khurana, R., Coleman, C., Ionescu-Zanetti, C., Carter, S. a, Krishna, V., Grover, R. K., …
Singh, S. (2005). Mechanism of thioflavin T binding to amyloid fibrils. Journal of
Structural Biology, 151(3), 229–38. doi:10.1016/j.jsb.2005.06.006
Kokame, K., Kato, H., & Miyata, T. (2001). Identification of ERSE-II, a new cis-acting
element responsible for the ATF6-dependent mammalian unfolded protein response.
The Journal of Biological Chemistry, 276(12), 9199–205.
doi:10.1074/jbc.M010486200
Kraskiewicz, H., & FitzGerald, U. (2012). InterfERing with endoplasmic reticulum stress.
Trends in Pharmacological Sciences, 33(2), 53–63. doi:10.1016/j.tips.2011.10.002
Kuznetsova, I. M., Sulatskaya, A. I., Uversky, V. N., & Turoverov, K. K. (2012). Analyzing
thioflavin T binding to amyloid fibrils by an equilibrium microdialysis-based
technique. PloS One, 7(2), e30724. doi:10.1371/journal.pone.0030724
Malhotra, J. D., & Kaufman, R. J. (2007). Endoplasmic reticulum stress and oxidative stress:
a vicious cycle or a double-edged sword? Antioxidants & Redox Signaling, 9(12),
2277–93. doi:10.1089/ars.2007.1782
Oslowski, C. M., & Urano, F. (2011). Measuring ER stress and the unfolded protein
response using mammalian tissue culture system. Methods in Enzymology (1st ed., Vol.
490, pp. 71–92). Elsevier Inc. doi:10.1016/B978-0-12-385114-7.00004-0
Picken MD, PhD, FASN, M. M., Dogan, M.D., Ph.D., A., & Herrera, M.D., G. A. (Eds.).
(2012). Amyloid and Related Disorders. Totowa, NJ: Humana Press. doi:10.1007/978-
1-60761-389-3
Pogue, A. I., Jones, B. M., Bhattacharjee, S., Percy, M. E., Zhao, Y., & Lukiw, W. J. (2012).
Metal-Sulfate Induced Generation of ROS in Human Brain Cells: Detection Using an
Isomeric Mixture of 5- and 6-Carboxy-2′,7′-Dichlorofluorescein Diacetate (Carboxy-
DCFDA) as a Cell Permeant Tracer. International Journal of Molecular Sciences.
doi:10.3390/ijms13089615
Samali, A., Fitzgerald, U., Deegan, S., & Gupta, S. (2010). Methods for monitoring
endoplasmic reticulum stress and the unfolded protein response. International Journal
of Cell Biology, 2010, 830307. doi:10.1155/2010/830307
64. 56
Schroder, M., & Kaufman, R. J. (2005). The mammalian unfolded protein response. Annual
Review of Biochemistry, 74, 739–789. doi:10.1146/annurev.biochem.73.011303.074134
Szegezdi, E., Logue, S. E., Gorman, A. M., & Samali, A. (2006). Mediators of endoplasmic
reticulum stress-induced apoptosis. EMBO Reports, 7(9), 880–5.
doi:10.1038/sj.embor.7400779
Van Anken, E., & Braakman, I. (2005). Endoplasmic reticulum stress and the making of a
professional secretory cell. Critical Reviews in Biochemistry and Molecular Biology,
40(5), 269–83. doi:10.1080/10409230500315352
Wlaschin, K. F., & Yap, M. G. S. (1987). Recombinant Protein Therapeutics from CHO
Cells — 20 Years and Counting, 40–47.
Wong, V. V. T., Wong, N. S. C., Tan, H., Wang, D. I. C., & Yap, M. G. S. (n.d.). Enhancing
Production of Recombinant Proteins from Mammalian Cells.
Yun, Z., Takagi, M., & Yoshida, T. (2003). Combined Addition of Glutathione and Iron
Chelators for Decrease of Intracellular Level of Reactive Oxygen Species and Death of
Chinese Hamster Ovary Cells, 95(2), 124–127.
65. 57
Appendix
The location of the stress elements of the chaperones and genes in the UPR are shown
below.
GRP78/HSPA (Human)
ERSE I (CCAAT-N9-CCACG)
UPRE (TGACGTGGA)
ERSE II (ATTGG-N-CCACG)
CAAT box (GGCCAATCT)
GC box (GGGCGG)
TATA box (TATAA)
NCBI Reference Sequence: NG_027761.1; >gi|307746866:4501-11540 Homo sapiens heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) (HSPA5),
RefSeqGene on chromosome 9
GAGTGGGTTGCCACAGTAGGGAGGGGACTCAGAGCTGGAGGCAATTCCTTTGGCCGGGCTTGTCCTGCGACTTACCGTGGGGCAGCGCAATGT
GGAGAGGCCTGGTAAAATGGCTGGGCAAGGGTGCGGAGGGGACATAACTGGCAGGAAGGAGTCATGATTCGTGGTCGAACAGAGTCCAGACCA
GCTCGACCTGTGAGCAACGAACGGCCCTGAGACTCGCATACCCCAATACCGGTAGTGGCCGTGAAGGGCAAAGAAATGTGTTCTGAGGCGATCCCAGCA
TCTAAGCTGCGACTGGTCTACTCAGAGACTGGATGGAAGCTGGGAAGAGAAAGCTGCTTCCCGCTTCGGGGTGAGGGATGGAGGAAGGGAGAACAAGCA
GTAGAGAAGAAAAAGTTTCAGATCCCACAGCCCCGGGGGGTCACTCCTGCTGGACCTACTCCGACCCCCTAGGGCCGGGAGTGAAGGCGGGACTTGTGC
GGTTACCAGCGGAAATGCCTCGGGGTCAGAAGTCGCAGGAGAGATAGACAGCTGCTGAACCAATGGGACCAGCGGATGGGGCGGATGTTATCTACCATT
GGTGAACGTTAGAAACGAATAGCAGCCAATGAATCAGCTGGGGGGGGCGGAGCAGTGACGTTTATTGCGGAGGGGGCCGCTTCGAATCGGCGGCGGCC
AGCTTGGTGGCCTGGGCCAATGAACGGCCTCCAACGAGCAGGGCCTTCACCAATCGGCGGCCTCCACGAcggggctggg
ggagggtatataagccgagtaggcgacggtgaggtcgacgccggccaagacagcacagacagattgacctattggggtgtttcgcgagtgtgagagggaagcgccgcggcctgtatttctagacctgcccttcgcctggttcgtggcgccttgtga
ccccgggcccctgccgcctgcaagtcggaaattgcgctgtgctcctgtgctacggcctgtggctggactgcctgctgctgcccaactggctggcaagATGAAGCTCTCCCTGGTGGCCGCGATGCTGCTGCTGC
TCAGCGCGGCGCGGGCCGAGGAGGAGGACAAGAAGGAGGACGTGGGCACGGTGGTCGGCATCGACCTGGGGACCACCTACTCCTGGTAAGTGGGGTTGC
GGATGCAGGGGGACGGGGCGTGGCCGCCTGGCCTGGCGTGAGAAGTGCGGTGCTGATGTCCCT
GRP78/HSPA (Mouse)
ERSE I (CCAAT-N9-CCACG)
UPRE (TGACGTGGA)
ERSE II (ATTGG-N-CCACG)
CAAT box (GGCCAATCT)
GC box (GGGCGG)
TATA box (TATAA)
NCBI Reference Sequence: NC_000068.7; >gi|372099108:34771590-34776529 Mus musculus strain C57BL/6J chromosome 2, GRCm38.p2 C57BL/6J
GAAGATTCGAAAGGCCTGGAAAGACACATACGGCTAGCCTTGGGGTGAAGGAGAAACACGGTTAGCTGAGAAGCACCAGGATTCTCAGCGAGGCAGAAT
CCAGATCAGGCCCCAGCTCGAGACGTGCAGGCCGGGCGAGTAACAGGGCCTGGACTCTGGGACATCCGAGAACGTGTGGAGGCTGGGGAGGGCGATCAC
AGCTGAGGCCGGGCAGCTCAGGACGCGGGGAATCGAGGAGGAGAAAGGCCGCGTACTTCTTCAGAGTGAGAGACAGAAAAGGAGACCCCGAGGGAACGA
CAGGCAGCTGCTGAACCAATAGGACCAGCGCTCAGGGCGGATGCTGCCTCTCATTGGTGGCCGTTAAGAATGACCAGTAGCCAATGAGTCAGCCCG
GGGGGCGTAGCAATGACGTGAGTTGCGGAGGAGGCCGCTTCGAATCGGCAGCAGCCAGCTTGGTGGCATGGACCAATCAGCGGCC
TCCAACGAGTAGCGACTTCACCAATCGGAGGCCTCCACGACGGGGCTGTGGGGAGGGTATATAAGGCGAGTCGGCGACGGCG
CGCtcgatactggccgagacaacactgacctggacacttgggcttctgcgtgtgtgtgagGTAAGCGCCGCGGCCTGCTGCTAGGCCTGCTCCGAGTCTGCTTCGTGTCTCCTCCTGACC
CCGAGGCCCCTGTCGCCCTCAGACCAGAACCGTCGTCGCGTTTCGGGGCCACAGCCTGTTGCTGGACTCCTAAGACTCCTGCCTGACTGCTG
AGCGACTGGTCCTCAGCGCCGGCATGATGAAGTTCACTGTGGTGGCGGCGGCGTTGCTGCTGCTGGGCGCGGTGCGGGCCGAGGAGGAGGACAAGAA
GGAGGATGTGGGCACGGTGGTCGGCATCGACTTGGGGACCACCTATTCCTGGTAAGTGGTATCCGTCGAAGGAGGAGGGGGTGGGGAGGAGTGG