SlideShare a Scribd company logo
1 of 21
SALOMÉ RIVERA MARTINEZ
JULIANA VARGAS ARBOLEDA
Tercer semestre
2017-1
INTRODUCTION
ELLIPTOCYTOSIS
Also known as
ovalocytosis, is an
inherited disorders
where the erythrocytes
are elliptical rather
than the typical
biconcave disc shape.
INTRODUCTION
X-LINKED RECESSIVE SYNDROME
INTRODUCTION
AMMECR1
Is a protein encoded by the
AMMECR1 gene on human
chromosome Xq22.3. Is localized
in the critical region of contiguous
deletion syndrome implicated in
Alport syndrome, mental
retardation, midface hypoplasia,
and elliptocytosis chromosomal
region gene 1.
INTRODUCTION
RELATION
A truncating mutation in AMME chromosomal
region gene 1 (AMMECR1) gene is leading
candidate due to X-linked inheritance that is
characterized by the presence of elliptocytosis
and midface hypoplasia in the proband.
OBJETIVE
Provide further evidence that
mutated AMMECR1 gene is
responsible for the clinically
recognizable X-linked condition
with variable expressivity.
MÉTODOS
1. Sujetos: Niño de 4 años nacido de padres no
consanguíneos y no afectados, de origen judío , libio,
yemenita y turco; hermana no afectada y tio materno
afectado.
MÉTODOS
MÉTODOS
2. Secuenciación:
Extracción de DNA Fragmentación
por sonicación
Centrifugación
PurificaciónLimpieza
Procesamiento
de muestras
alineación del genoma y
selección de variantes
Lectura
2. Secuenciación:
Utilización del método enzimático o de Sanger,
en el cual no se degrada el DNA sino que se
interrumpe de forma controlada de la síntesis
de una hebra complementaria.
Forward: 5'- cccgtggacatttggtcattgg-3 ', Reverse 5'-ggcacctaacctagcagacagtcaatactc-3'.
MÉTODOS
MÉTODOS
3. PCR
➝Se extrajo RNA de la sangre periférica de el
niño y la madre.
➝ Se sintetizó ADN complementario y se
amplifico el AMMERC1 con RT PCR:
Forward: 5'-GATGGTGGTGTCAGCAGAGAT -3'.
Reverse: 5'- CAGGAATAATGGTTGTATGGCGG -
3'.
➝ se cargó y pasó por un gel de agarosa al 1.5%.
MÉTODOS
RESULTADOS
RESULTADOS
Fig. 3. Alternative splicing ofAMMECR1. (A)AMMECR1 schematic representation of exons, numbered 1 to 6, in theWild-type(WT) isoforms
and Patient (II-2) isoforms. Themutation in the patient transcript is indicated on alternative exon 2.
(B) PCR amplification and separation in Agarose gel of AMMECR1 from proband and mother. Upper bands represent the exon 2
inclusion events, while the lower represent the exon 2 skipping events. Bands were excised, extracted and sequenced for confirmation.
RESULTADOS
Fig. 3. (C) AMMECR1 isoforms (taken from UCSC Genome Browser website; https://genome.ucsc.edu/) show that in one out of the three
isoforms exon 2 is skipped (missing box, indicated by arrow). The horizontal line represents the introns while the vertical boxed indicate the
exons. The image is drawn to scale. Note that the bottom isoform starts further upstream to this current view.
(D) PCR amplification as in B on eight healthy individuals.
RESULTADOS
Fig. 4. AMMECR1 protein model demonstrating the structural importance of position R45 on exon 2 of the protein. (A) AMMECR1 protein ribbon is colored by conservation (maroonwhite-
cyan scale from most conserved to least conserved positions) and R45 is shown in CPK representation, with the nitrogen atoms in blue and the carbons in conserve colors. R45
is located on a loop between two beta sheets that interact with an alpha helix on the core of a subdomain. (B) R45 is close to a 6-amino-acid motif (LRGCIG), colored in maroon, that is
highly conserved throughout evolution and is thus probably functionally important. (C) A change on a nearby loop, or skipping of this region which is located on exon 2 of the gene,
will lead to protein complete destabilization and probably lack of this entire protein. (For interpretation of the references to color in this figure legend, the reader is referred to the
web version of this article.)
DISCUSSION
ACTOR WHAT SAID YES OR NOT
Vitelli et al AMMECR1 gene encodes a
protein with a nuclear
localization and presently
unknown function, yet was
suggested to play a role as a
regulatory protein.
Meloni et al FACL4 gene has been
implicated in intellectual
disability in patients with
deletions including this gene.
DISCUSSION
ACTOR WHAT SAID YES OR NOT
Andreoletti et al Clinical features shared by the
individuals escribed in this report and
individuals described by Andreoletti et
al. include cleft palate, club feet, a flat
facial profile with a flat nasal bridge,
thin lips micrognathia,hearing loss and
eliptocytosis.
Balaji and Aravind AMMECR1 has previously been linked
to involvement in an uncharacterized
RNA base modification, potentially
entailing the transfer of a modifying
group onto an RNA base via a
conserved cysteine.
CONCLUSION
• It is a dissease that can be treated but not cured,
since we can improve the patient's lifestyle but not
prevent the gene from expressing itself.
• This disease is little previous and the largest number
of cases have been recorded in central and western
Africa.
• With the RT PCR the expression of the mutated gene
in the proband could be determined.
• The clinical characteristics of patients with
AMMECR1 gene mutation are not always the same.
Juliana Vargas Arboleda
Seminario Eliptocitosis

More Related Content

What's hot

Epigenetic regulation in plants
Epigenetic regulation in plantsEpigenetic regulation in plants
Epigenetic regulation in plantsRyza Priatama
 
Dna replication, repair, recombination
Dna replication, repair, recombinationDna replication, repair, recombination
Dna replication, repair, recombinationAlbert
 
Structure-Function Analysis of POR Mutants
Structure-Function Analysis of POR MutantsStructure-Function Analysis of POR Mutants
Structure-Function Analysis of POR MutantsAYang999
 
Prediction of disorder in protein structure (amit singh)
Prediction of disorder in protein structure (amit singh)Prediction of disorder in protein structure (amit singh)
Prediction of disorder in protein structure (amit singh)Amit Singh
 
MUTATIONS & DNA REPAIR MECHANISMS
MUTATIONS & DNA REPAIR MECHANISMSMUTATIONS & DNA REPAIR MECHANISMS
MUTATIONS & DNA REPAIR MECHANISMSYESANNA
 
The Role of DNA Methylation in Coronary Artery Disease
 The Role of DNA Methylation in Coronary Artery Disease The Role of DNA Methylation in Coronary Artery Disease
The Role of DNA Methylation in Coronary Artery DiseaseBardia Farivar
 
Structure-Function Analysis of POR Mutants
Structure-Function Analysis of POR MutantsStructure-Function Analysis of POR Mutants
Structure-Function Analysis of POR MutantsAYang999
 
71st ICREA Colloquium - Intrinsically disordered proteins (IDPs) the challeng...
71st ICREA Colloquium - Intrinsically disordered proteins (IDPs) the challeng...71st ICREA Colloquium - Intrinsically disordered proteins (IDPs) the challeng...
71st ICREA Colloquium - Intrinsically disordered proteins (IDPs) the challeng...Mayi Suárez
 
Folding proteins in fatal ways
Folding proteins in fatal waysFolding proteins in fatal ways
Folding proteins in fatal waysAyesha Zainab Beg
 
FallFestPoster
FallFestPosterFallFestPoster
FallFestPosterJamal Ali
 

What's hot (19)

NCB
NCBNCB
NCB
 
Dna mutations, recombination & repair
Dna mutations, recombination & repairDna mutations, recombination & repair
Dna mutations, recombination & repair
 
Epigenetic regulation in plants
Epigenetic regulation in plantsEpigenetic regulation in plants
Epigenetic regulation in plants
 
Definition of epigenetics
Definition of epigeneticsDefinition of epigenetics
Definition of epigenetics
 
Dna replication, repair, recombination
Dna replication, repair, recombinationDna replication, repair, recombination
Dna replication, repair, recombination
 
Alzheimer’s disease
Alzheimer’s disease Alzheimer’s disease
Alzheimer’s disease
 
Dna repair genes
Dna repair genesDna repair genes
Dna repair genes
 
Structure-Function Analysis of POR Mutants
Structure-Function Analysis of POR MutantsStructure-Function Analysis of POR Mutants
Structure-Function Analysis of POR Mutants
 
Prediction of disorder in protein structure (amit singh)
Prediction of disorder in protein structure (amit singh)Prediction of disorder in protein structure (amit singh)
Prediction of disorder in protein structure (amit singh)
 
MUTATIONS & DNA REPAIR MECHANISMS
MUTATIONS & DNA REPAIR MECHANISMSMUTATIONS & DNA REPAIR MECHANISMS
MUTATIONS & DNA REPAIR MECHANISMS
 
Dna repair
Dna repairDna repair
Dna repair
 
Epigenetics
EpigeneticsEpigenetics
Epigenetics
 
The Role of DNA Methylation in Coronary Artery Disease
 The Role of DNA Methylation in Coronary Artery Disease The Role of DNA Methylation in Coronary Artery Disease
The Role of DNA Methylation in Coronary Artery Disease
 
Structure-Function Analysis of POR Mutants
Structure-Function Analysis of POR MutantsStructure-Function Analysis of POR Mutants
Structure-Function Analysis of POR Mutants
 
Base pair mismatch
Base pair mismatchBase pair mismatch
Base pair mismatch
 
71st ICREA Colloquium - Intrinsically disordered proteins (IDPs) the challeng...
71st ICREA Colloquium - Intrinsically disordered proteins (IDPs) the challeng...71st ICREA Colloquium - Intrinsically disordered proteins (IDPs) the challeng...
71st ICREA Colloquium - Intrinsically disordered proteins (IDPs) the challeng...
 
Folding proteins in fatal ways
Folding proteins in fatal waysFolding proteins in fatal ways
Folding proteins in fatal ways
 
FallFestPoster
FallFestPosterFallFestPoster
FallFestPoster
 
Dna repair
Dna repair Dna repair
Dna repair
 

Similar to Seminario Eliptocitosis

Evolution of a Drug Target BACE1
Evolution of a Drug Target BACE1Evolution of a Drug Target BACE1
Evolution of a Drug Target BACE1Chris Southan
 
Chromosomal brekage syndrome
Chromosomal brekage syndromeChromosomal brekage syndrome
Chromosomal brekage syndromeReetika (jmu)
 
Epigenetic modifications of proteins
Epigenetic modifications of proteinsEpigenetic modifications of proteins
Epigenetic modifications of proteinsAkshay More
 
Abstract piis0022202 x1831114x
Abstract piis0022202 x1831114xAbstract piis0022202 x1831114x
Abstract piis0022202 x1831114xWaddah Moghram
 
1 At least 2 questions from this section will be on the .docx
1 At least 2 questions from this section will be on the .docx1 At least 2 questions from this section will be on the .docx
1 At least 2 questions from this section will be on the .docxmercysuttle
 
Youngetal2021complete.pdf
Youngetal2021complete.pdfYoungetal2021complete.pdf
Youngetal2021complete.pdfAndreaCerase3
 
Sperm dna fragmentation
Sperm dna fragmentationSperm dna fragmentation
Sperm dna fragmentationWael Alhuleily
 
Drosophila Melanogaster Genome And its developmental process
Drosophila Melanogaster  Genome And its developmental processDrosophila Melanogaster  Genome And its developmental process
Drosophila Melanogaster Genome And its developmental processSubhradeep sarkar
 
Amyloid and alzheimer’s disease
Amyloid and alzheimer’s diseaseAmyloid and alzheimer’s disease
Amyloid and alzheimer’s diseaseNikhil Agrawal
 
Urbach-Wiethe Syndrome Associated Fear Processing Defect
Urbach-Wiethe Syndrome Associated Fear Processing DefectUrbach-Wiethe Syndrome Associated Fear Processing Defect
Urbach-Wiethe Syndrome Associated Fear Processing DefectShalimar Shadeed
 
The answers can be found below as discussedPart 1)The human gen.pdf
The answers can be found below as discussedPart 1)The human gen.pdfThe answers can be found below as discussedPart 1)The human gen.pdf
The answers can be found below as discussedPart 1)The human gen.pdfaravlitraders2012
 
Advances In Thalassemia Research
Advances In Thalassemia ResearchAdvances In Thalassemia Research
Advances In Thalassemia ResearchKim Daniels
 
Tmc gene therapy restores auditory function in deaf mice
Tmc gene therapy restores auditory function in deaf miceTmc gene therapy restores auditory function in deaf mice
Tmc gene therapy restores auditory function in deaf miceJosé Luis Moreno Garvayo
 
Genes, Genomics, and Chromosomes computational biology introduction .ppt
Genes, Genomics, and Chromosomes computational biology introduction .pptGenes, Genomics, and Chromosomes computational biology introduction .ppt
Genes, Genomics, and Chromosomes computational biology introduction .pptMohamedHasan816582
 
The Impact of Lysogenic and Tail Assembly Chaperone Proteins on the Life Cycl...
The Impact of Lysogenic and Tail Assembly Chaperone Proteins on the Life Cycl...The Impact of Lysogenic and Tail Assembly Chaperone Proteins on the Life Cycl...
The Impact of Lysogenic and Tail Assembly Chaperone Proteins on the Life Cycl...Wyatt Nelson
 
Mutation with transmission pattern of single gene disorder
Mutation with transmission pattern of single gene disorderMutation with transmission pattern of single gene disorder
Mutation with transmission pattern of single gene disorderHriman Sharma Sarkar
 
Human pigmentation genes: identification, structure and consequences of polym...
Human pigmentation genes: identification, structure and consequences of polym...Human pigmentation genes: identification, structure and consequences of polym...
Human pigmentation genes: identification, structure and consequences of polym...José Luis Moreno Garvayo
 
Amelogenesis imperfecta
Amelogenesis imperfectaAmelogenesis imperfecta
Amelogenesis imperfectaLouis Solaman
 

Similar to Seminario Eliptocitosis (20)

Evolution of a Drug Target BACE1
Evolution of a Drug Target BACE1Evolution of a Drug Target BACE1
Evolution of a Drug Target BACE1
 
Chromosomal brekage syndrome
Chromosomal brekage syndromeChromosomal brekage syndrome
Chromosomal brekage syndrome
 
Epigenetic modifications of proteins
Epigenetic modifications of proteinsEpigenetic modifications of proteins
Epigenetic modifications of proteins
 
Abstract piis0022202 x1831114x
Abstract piis0022202 x1831114xAbstract piis0022202 x1831114x
Abstract piis0022202 x1831114x
 
1 At least 2 questions from this section will be on the .docx
1 At least 2 questions from this section will be on the .docx1 At least 2 questions from this section will be on the .docx
1 At least 2 questions from this section will be on the .docx
 
Youngetal2021complete.pdf
Youngetal2021complete.pdfYoungetal2021complete.pdf
Youngetal2021complete.pdf
 
Sperm dna fragmentation
Sperm dna fragmentationSperm dna fragmentation
Sperm dna fragmentation
 
Drosophila Melanogaster Genome And its developmental process
Drosophila Melanogaster  Genome And its developmental processDrosophila Melanogaster  Genome And its developmental process
Drosophila Melanogaster Genome And its developmental process
 
Amyloid and alzheimer’s disease
Amyloid and alzheimer’s diseaseAmyloid and alzheimer’s disease
Amyloid and alzheimer’s disease
 
Urbach-Wiethe Syndrome Associated Fear Processing Defect
Urbach-Wiethe Syndrome Associated Fear Processing DefectUrbach-Wiethe Syndrome Associated Fear Processing Defect
Urbach-Wiethe Syndrome Associated Fear Processing Defect
 
The answers can be found below as discussedPart 1)The human gen.pdf
The answers can be found below as discussedPart 1)The human gen.pdfThe answers can be found below as discussedPart 1)The human gen.pdf
The answers can be found below as discussedPart 1)The human gen.pdf
 
Advances In Thalassemia Research
Advances In Thalassemia ResearchAdvances In Thalassemia Research
Advances In Thalassemia Research
 
Tmc gene therapy restores auditory function in deaf mice
Tmc gene therapy restores auditory function in deaf miceTmc gene therapy restores auditory function in deaf mice
Tmc gene therapy restores auditory function in deaf mice
 
Genes, Genomics, and Chromosomes computational biology introduction .ppt
Genes, Genomics, and Chromosomes computational biology introduction .pptGenes, Genomics, and Chromosomes computational biology introduction .ppt
Genes, Genomics, and Chromosomes computational biology introduction .ppt
 
The Impact of Lysogenic and Tail Assembly Chaperone Proteins on the Life Cycl...
The Impact of Lysogenic and Tail Assembly Chaperone Proteins on the Life Cycl...The Impact of Lysogenic and Tail Assembly Chaperone Proteins on the Life Cycl...
The Impact of Lysogenic and Tail Assembly Chaperone Proteins on the Life Cycl...
 
Mutation with transmission pattern of single gene disorder
Mutation with transmission pattern of single gene disorderMutation with transmission pattern of single gene disorder
Mutation with transmission pattern of single gene disorder
 
Nitub workshop july 2018
Nitub workshop july 2018Nitub workshop july 2018
Nitub workshop july 2018
 
Summer project poster
Summer project posterSummer project poster
Summer project poster
 
Human pigmentation genes: identification, structure and consequences of polym...
Human pigmentation genes: identification, structure and consequences of polym...Human pigmentation genes: identification, structure and consequences of polym...
Human pigmentation genes: identification, structure and consequences of polym...
 
Amelogenesis imperfecta
Amelogenesis imperfectaAmelogenesis imperfecta
Amelogenesis imperfecta
 

Recently uploaded

Feature-aligned N-BEATS with Sinkhorn divergence (ICLR '24)
Feature-aligned N-BEATS with Sinkhorn divergence (ICLR '24)Feature-aligned N-BEATS with Sinkhorn divergence (ICLR '24)
Feature-aligned N-BEATS with Sinkhorn divergence (ICLR '24)Joonhun Lee
 
❤Jammu Kashmir Call Girls 8617697112 Personal Whatsapp Number 💦✅.
❤Jammu Kashmir Call Girls 8617697112 Personal Whatsapp Number 💦✅.❤Jammu Kashmir Call Girls 8617697112 Personal Whatsapp Number 💦✅.
❤Jammu Kashmir Call Girls 8617697112 Personal Whatsapp Number 💦✅.Nitya salvi
 
Forensic Biology & Its biological significance.pdf
Forensic Biology & Its biological significance.pdfForensic Biology & Its biological significance.pdf
Forensic Biology & Its biological significance.pdfrohankumarsinghrore1
 
GBSN - Microbiology (Unit 1)
GBSN - Microbiology (Unit 1)GBSN - Microbiology (Unit 1)
GBSN - Microbiology (Unit 1)Areesha Ahmad
 
High Profile 🔝 8250077686 📞 Call Girls Service in GTB Nagar🍑
High Profile 🔝 8250077686 📞 Call Girls Service in GTB Nagar🍑High Profile 🔝 8250077686 📞 Call Girls Service in GTB Nagar🍑
High Profile 🔝 8250077686 📞 Call Girls Service in GTB Nagar🍑Damini Dixit
 
Presentation Vikram Lander by Vedansh Gupta.pptx
Presentation Vikram Lander by Vedansh Gupta.pptxPresentation Vikram Lander by Vedansh Gupta.pptx
Presentation Vikram Lander by Vedansh Gupta.pptxgindu3009
 
GBSN - Biochemistry (Unit 1)
GBSN - Biochemistry (Unit 1)GBSN - Biochemistry (Unit 1)
GBSN - Biochemistry (Unit 1)Areesha Ahmad
 
Zoology 4th semester series (krishna).pdf
Zoology 4th semester series (krishna).pdfZoology 4th semester series (krishna).pdf
Zoology 4th semester series (krishna).pdfSumit Kumar yadav
 
GBSN - Microbiology (Unit 2)
GBSN - Microbiology (Unit 2)GBSN - Microbiology (Unit 2)
GBSN - Microbiology (Unit 2)Areesha Ahmad
 
Conjugation, transduction and transformation
Conjugation, transduction and transformationConjugation, transduction and transformation
Conjugation, transduction and transformationAreesha Ahmad
 
GBSN - Microbiology (Unit 3)
GBSN - Microbiology (Unit 3)GBSN - Microbiology (Unit 3)
GBSN - Microbiology (Unit 3)Areesha Ahmad
 
Nanoparticles synthesis and characterization​ ​
Nanoparticles synthesis and characterization​  ​Nanoparticles synthesis and characterization​  ​
Nanoparticles synthesis and characterization​ ​kaibalyasahoo82800
 
Vip profile Call Girls In Lonavala 9748763073 For Genuine Sex Service At Just...
Vip profile Call Girls In Lonavala 9748763073 For Genuine Sex Service At Just...Vip profile Call Girls In Lonavala 9748763073 For Genuine Sex Service At Just...
Vip profile Call Girls In Lonavala 9748763073 For Genuine Sex Service At Just...Monika Rani
 
Call Girls Alandi Call Me 7737669865 Budget Friendly No Advance Booking
Call Girls Alandi Call Me 7737669865 Budget Friendly No Advance BookingCall Girls Alandi Call Me 7737669865 Budget Friendly No Advance Booking
Call Girls Alandi Call Me 7737669865 Budget Friendly No Advance Bookingroncy bisnoi
 
Bacterial Identification and Classifications
Bacterial Identification and ClassificationsBacterial Identification and Classifications
Bacterial Identification and ClassificationsAreesha Ahmad
 
Pests of cotton_Borer_Pests_Binomics_Dr.UPR.pdf
Pests of cotton_Borer_Pests_Binomics_Dr.UPR.pdfPests of cotton_Borer_Pests_Binomics_Dr.UPR.pdf
Pests of cotton_Borer_Pests_Binomics_Dr.UPR.pdfPirithiRaju
 
Connaught Place, Delhi Call girls :8448380779 Model Escorts | 100% verified
Connaught Place, Delhi Call girls :8448380779 Model Escorts | 100% verifiedConnaught Place, Delhi Call girls :8448380779 Model Escorts | 100% verified
Connaught Place, Delhi Call girls :8448380779 Model Escorts | 100% verifiedDelhi Call girls
 
Proteomics: types, protein profiling steps etc.
Proteomics: types, protein profiling steps etc.Proteomics: types, protein profiling steps etc.
Proteomics: types, protein profiling steps etc.Silpa
 
Labelling Requirements and Label Claims for Dietary Supplements and Recommend...
Labelling Requirements and Label Claims for Dietary Supplements and Recommend...Labelling Requirements and Label Claims for Dietary Supplements and Recommend...
Labelling Requirements and Label Claims for Dietary Supplements and Recommend...Lokesh Kothari
 

Recently uploaded (20)

Feature-aligned N-BEATS with Sinkhorn divergence (ICLR '24)
Feature-aligned N-BEATS with Sinkhorn divergence (ICLR '24)Feature-aligned N-BEATS with Sinkhorn divergence (ICLR '24)
Feature-aligned N-BEATS with Sinkhorn divergence (ICLR '24)
 
❤Jammu Kashmir Call Girls 8617697112 Personal Whatsapp Number 💦✅.
❤Jammu Kashmir Call Girls 8617697112 Personal Whatsapp Number 💦✅.❤Jammu Kashmir Call Girls 8617697112 Personal Whatsapp Number 💦✅.
❤Jammu Kashmir Call Girls 8617697112 Personal Whatsapp Number 💦✅.
 
Forensic Biology & Its biological significance.pdf
Forensic Biology & Its biological significance.pdfForensic Biology & Its biological significance.pdf
Forensic Biology & Its biological significance.pdf
 
GBSN - Microbiology (Unit 1)
GBSN - Microbiology (Unit 1)GBSN - Microbiology (Unit 1)
GBSN - Microbiology (Unit 1)
 
High Profile 🔝 8250077686 📞 Call Girls Service in GTB Nagar🍑
High Profile 🔝 8250077686 📞 Call Girls Service in GTB Nagar🍑High Profile 🔝 8250077686 📞 Call Girls Service in GTB Nagar🍑
High Profile 🔝 8250077686 📞 Call Girls Service in GTB Nagar🍑
 
Presentation Vikram Lander by Vedansh Gupta.pptx
Presentation Vikram Lander by Vedansh Gupta.pptxPresentation Vikram Lander by Vedansh Gupta.pptx
Presentation Vikram Lander by Vedansh Gupta.pptx
 
GBSN - Biochemistry (Unit 1)
GBSN - Biochemistry (Unit 1)GBSN - Biochemistry (Unit 1)
GBSN - Biochemistry (Unit 1)
 
Zoology 4th semester series (krishna).pdf
Zoology 4th semester series (krishna).pdfZoology 4th semester series (krishna).pdf
Zoology 4th semester series (krishna).pdf
 
GBSN - Microbiology (Unit 2)
GBSN - Microbiology (Unit 2)GBSN - Microbiology (Unit 2)
GBSN - Microbiology (Unit 2)
 
Conjugation, transduction and transformation
Conjugation, transduction and transformationConjugation, transduction and transformation
Conjugation, transduction and transformation
 
GBSN - Microbiology (Unit 3)
GBSN - Microbiology (Unit 3)GBSN - Microbiology (Unit 3)
GBSN - Microbiology (Unit 3)
 
Nanoparticles synthesis and characterization​ ​
Nanoparticles synthesis and characterization​  ​Nanoparticles synthesis and characterization​  ​
Nanoparticles synthesis and characterization​ ​
 
CELL -Structural and Functional unit of life.pdf
CELL -Structural and Functional unit of life.pdfCELL -Structural and Functional unit of life.pdf
CELL -Structural and Functional unit of life.pdf
 
Vip profile Call Girls In Lonavala 9748763073 For Genuine Sex Service At Just...
Vip profile Call Girls In Lonavala 9748763073 For Genuine Sex Service At Just...Vip profile Call Girls In Lonavala 9748763073 For Genuine Sex Service At Just...
Vip profile Call Girls In Lonavala 9748763073 For Genuine Sex Service At Just...
 
Call Girls Alandi Call Me 7737669865 Budget Friendly No Advance Booking
Call Girls Alandi Call Me 7737669865 Budget Friendly No Advance BookingCall Girls Alandi Call Me 7737669865 Budget Friendly No Advance Booking
Call Girls Alandi Call Me 7737669865 Budget Friendly No Advance Booking
 
Bacterial Identification and Classifications
Bacterial Identification and ClassificationsBacterial Identification and Classifications
Bacterial Identification and Classifications
 
Pests of cotton_Borer_Pests_Binomics_Dr.UPR.pdf
Pests of cotton_Borer_Pests_Binomics_Dr.UPR.pdfPests of cotton_Borer_Pests_Binomics_Dr.UPR.pdf
Pests of cotton_Borer_Pests_Binomics_Dr.UPR.pdf
 
Connaught Place, Delhi Call girls :8448380779 Model Escorts | 100% verified
Connaught Place, Delhi Call girls :8448380779 Model Escorts | 100% verifiedConnaught Place, Delhi Call girls :8448380779 Model Escorts | 100% verified
Connaught Place, Delhi Call girls :8448380779 Model Escorts | 100% verified
 
Proteomics: types, protein profiling steps etc.
Proteomics: types, protein profiling steps etc.Proteomics: types, protein profiling steps etc.
Proteomics: types, protein profiling steps etc.
 
Labelling Requirements and Label Claims for Dietary Supplements and Recommend...
Labelling Requirements and Label Claims for Dietary Supplements and Recommend...Labelling Requirements and Label Claims for Dietary Supplements and Recommend...
Labelling Requirements and Label Claims for Dietary Supplements and Recommend...
 

Seminario Eliptocitosis

  • 1. SALOMÉ RIVERA MARTINEZ JULIANA VARGAS ARBOLEDA Tercer semestre 2017-1
  • 2. INTRODUCTION ELLIPTOCYTOSIS Also known as ovalocytosis, is an inherited disorders where the erythrocytes are elliptical rather than the typical biconcave disc shape.
  • 4. INTRODUCTION AMMECR1 Is a protein encoded by the AMMECR1 gene on human chromosome Xq22.3. Is localized in the critical region of contiguous deletion syndrome implicated in Alport syndrome, mental retardation, midface hypoplasia, and elliptocytosis chromosomal region gene 1.
  • 5. INTRODUCTION RELATION A truncating mutation in AMME chromosomal region gene 1 (AMMECR1) gene is leading candidate due to X-linked inheritance that is characterized by the presence of elliptocytosis and midface hypoplasia in the proband.
  • 6. OBJETIVE Provide further evidence that mutated AMMECR1 gene is responsible for the clinically recognizable X-linked condition with variable expressivity.
  • 7. MÉTODOS 1. Sujetos: Niño de 4 años nacido de padres no consanguíneos y no afectados, de origen judío , libio, yemenita y turco; hermana no afectada y tio materno afectado.
  • 9. MÉTODOS 2. Secuenciación: Extracción de DNA Fragmentación por sonicación Centrifugación PurificaciónLimpieza Procesamiento de muestras alineación del genoma y selección de variantes Lectura
  • 10. 2. Secuenciación: Utilización del método enzimático o de Sanger, en el cual no se degrada el DNA sino que se interrumpe de forma controlada de la síntesis de una hebra complementaria. Forward: 5'- cccgtggacatttggtcattgg-3 ', Reverse 5'-ggcacctaacctagcagacagtcaatactc-3'. MÉTODOS
  • 11. MÉTODOS 3. PCR ➝Se extrajo RNA de la sangre periférica de el niño y la madre. ➝ Se sintetizó ADN complementario y se amplifico el AMMERC1 con RT PCR: Forward: 5'-GATGGTGGTGTCAGCAGAGAT -3'. Reverse: 5'- CAGGAATAATGGTTGTATGGCGG - 3'. ➝ se cargó y pasó por un gel de agarosa al 1.5%.
  • 14. RESULTADOS Fig. 3. Alternative splicing ofAMMECR1. (A)AMMECR1 schematic representation of exons, numbered 1 to 6, in theWild-type(WT) isoforms and Patient (II-2) isoforms. Themutation in the patient transcript is indicated on alternative exon 2. (B) PCR amplification and separation in Agarose gel of AMMECR1 from proband and mother. Upper bands represent the exon 2 inclusion events, while the lower represent the exon 2 skipping events. Bands were excised, extracted and sequenced for confirmation.
  • 15. RESULTADOS Fig. 3. (C) AMMECR1 isoforms (taken from UCSC Genome Browser website; https://genome.ucsc.edu/) show that in one out of the three isoforms exon 2 is skipped (missing box, indicated by arrow). The horizontal line represents the introns while the vertical boxed indicate the exons. The image is drawn to scale. Note that the bottom isoform starts further upstream to this current view. (D) PCR amplification as in B on eight healthy individuals.
  • 16. RESULTADOS Fig. 4. AMMECR1 protein model demonstrating the structural importance of position R45 on exon 2 of the protein. (A) AMMECR1 protein ribbon is colored by conservation (maroonwhite- cyan scale from most conserved to least conserved positions) and R45 is shown in CPK representation, with the nitrogen atoms in blue and the carbons in conserve colors. R45 is located on a loop between two beta sheets that interact with an alpha helix on the core of a subdomain. (B) R45 is close to a 6-amino-acid motif (LRGCIG), colored in maroon, that is highly conserved throughout evolution and is thus probably functionally important. (C) A change on a nearby loop, or skipping of this region which is located on exon 2 of the gene, will lead to protein complete destabilization and probably lack of this entire protein. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
  • 17. DISCUSSION ACTOR WHAT SAID YES OR NOT Vitelli et al AMMECR1 gene encodes a protein with a nuclear localization and presently unknown function, yet was suggested to play a role as a regulatory protein. Meloni et al FACL4 gene has been implicated in intellectual disability in patients with deletions including this gene.
  • 18. DISCUSSION ACTOR WHAT SAID YES OR NOT Andreoletti et al Clinical features shared by the individuals escribed in this report and individuals described by Andreoletti et al. include cleft palate, club feet, a flat facial profile with a flat nasal bridge, thin lips micrognathia,hearing loss and eliptocytosis. Balaji and Aravind AMMECR1 has previously been linked to involvement in an uncharacterized RNA base modification, potentially entailing the transfer of a modifying group onto an RNA base via a conserved cysteine.
  • 19. CONCLUSION • It is a dissease that can be treated but not cured, since we can improve the patient's lifestyle but not prevent the gene from expressing itself. • This disease is little previous and the largest number of cases have been recorded in central and western Africa. • With the RT PCR the expression of the mutated gene in the proband could be determined. • The clinical characteristics of patients with AMMECR1 gene mutation are not always the same.