Successfully reported this slideshow.
Your SlideShare is downloading. ×

B. DNA Barcoding Presentation.pptx

Ad
Ad
Ad
Ad
Ad
Ad
Ad
Ad
Ad
Ad
Ad
Loading in …3
×

Check these out next

1 of 26 Ad
Advertisement

More Related Content

Similar to B. DNA Barcoding Presentation.pptx (20)

More from JosephCross16 (17)

Advertisement

Recently uploaded (20)

B. DNA Barcoding Presentation.pptx

  1. 1. DNA Barcoding A Potential Tracker of Climate Change and it’s Effects on Flora and Fauna TEAM PLANT PRESERVATION (TPP) Bersma, Ashley Daniel, Alana Lack, Amanda Orta, Jose Rajput, Tahreem
  2. 2. Introduction What is DNA barcoding? • Unique Pattern of DNA • Easy Identification and Classification of Species • No need for expert knowledge of morphology or taxonomy • RuBisCo (rbcL) in plants • Cytochrome C oxidase (COI) in animals Why Climate Change? • Warmer Temperatures • New Weather Patterns • Severe Storms • Animal Migration patterns • Displacement of species @2012 2022
  3. 3. Materials and Methods Sample Collection • Wallings Nature Reserve • Lat (17.0343198), Lon (-61.826608) • 10 samples DNA extraction • Mechanical lysing of cells • DNA extraction and Purification was done by following protocols from DNAeasy extraction Kits from QIAGEN
  4. 4. Materials and Methods Polymerase Chain Reaction (PCR) • PCR reaction was set up as per protocols -Initial Denaturation: 94C - 1 min. -Denaturation: 94C - 15 sec. -Annealing: 54C - 15 sec. -Extending: 72C - 30 sec. -35 Cycles. -Preserved at 4C until ready to use. • Primer Design: 5'TGTAAAACGACGGCCAGTATGTCACCACAAACAGAGA CTAAAGC-3' (forward primer–rbcLaf-M13) 5'-CAGGAAACAGCTATGACGTAAAATCAAGTCCACCRCG- 3' (reverse primer–rbcLa-revM13) Gel Electrophoresis • PCR reactions were examined on a 2% agarose gel • Band expected size is approximately 700bp in size
  5. 5. Materials and Methods Sequencing • PCR samples were sent to New York for next generation sequencing. Bioinformatic Analysis • Sequencing results were analyzed through: -DNA Subway program https://dnasubway.cyverse.org/project/browse my - BOLD SDP http://v3.boldsystems.org/index.php/SDP_Man agement_StudentsConsole - NCBI BLAST https://blast.ncbi.nlm.nih.gov/Blast.cgi • A Phylogeny Tree was created from our results
  6. 6. Results Gel Electrophoresis
  7. 7. Results Sequencing and DNA subway Analysis
  8. 8. TPP1- Petrea Kohautiana
  9. 9. • Commonly known as Purple wreath, Queen's wreath, sandpaper vine, Tropical Wisteria, Bluebird Vine, and Fleur de Dieu. • Origin: Central America, South America in the tropics (Mexico, Peru, Brazil, Costa Rica), and Caribbean. • Tropical Shrub/Vine Common Characteristics • Valued especially for its display of violet flowers • In the traditional Amerindian pharmacopoeia, certain ethnic groups such as the Wayãpi (Amazonia, Guyana, Brazil) use the sap in preparation to treat burns, wounds, inflammations, abscesses. • In the Caribbean, associated with other plants, it is used as an antidiarrheal and as an abortifacient. Uses • Prefers full sun and it can tolerate shade, although it will not flower profusely • handles a very light and fleeting frost at temperatures down to -2 °C • thrives in well drained, fertile soils and can tolerate drought • Depending on the climate there may be 2 nectariferous blooms are visited by hummingbirds and butterflies Climate change & Plant growth TPP1-Petrea Kohautiana
  10. 10. TPP2- Petrea Volubilis
  11. 11. • Commonly known as Purple wreath, Queen's wreath, sandpaper vine, Tropical Wisteria, Bluebird Vine, and Fleur de Dieu. • Origin: Central America, South America in the tropics (Mexico, Peru, Brazil, Costa Rica), and Caribbean. • Tropical Shrub/Vine Common Characteristics • Valued especially for its display of violet flowers • In the traditional Amerindian pharmacopoeia, certain ethnic groups such as the Wayãpi (Amazonia, Guyana, Brazil) use the sap in preparation to treat burns, wounds, inflammations, abscesses. • In the Caribbean, associated with other plants, it is used as an antidiarrheal and as an abortifacient. • Leaves have been used for treatment of diabetes/ methanol extract has shown hypoglycemic activity (Philippines) Uses • Prefers full sun and it can tolerate shade, although it will not flower profusely • handles a very light and fleeting frost at temperatures down to -2 °C • thrives in well drained, fertile soils and can tolerate drought • Depending on the climate there may be 2 nectariferous blooms are visited by hummingbirds and butterflies Climate change & Plant growth TPP2-Petrea Volubilis
  12. 12. TPP4- Petrea Racemosa
  13. 13. • Commonly known as Purple wreath, Queen's wreath, sandpaper vine, Tropical Wisteria, Bluebird Vine, and Fleur de Dieu. • Origin: Central America, South America in the tropics (Mexico, Peru, Brazil, Costa Rica), and Caribbean. • Tropical Shrub/Vine • Larger, darker flowers but less blooms than P. Volubilis. Common Characteristics • Valued especially for its display of violet flowers • In the traditional Amerindian pharmacopoeia, certain ethnic groups such as the Wayãpi (Amazonia, Guyana, Brazil) use the sap in preparation to treat burns, wounds, inflammations, abscesses. • In the Caribbean, associated with other plants, it is used as an antidiarrheal and as an abortifacient. Uses • Prefers full sun and it can tolerate shade, although it will not flower profusely • handles a very light and fleeting frost at temperatures down to -2 °C • thrives in well drained, fertile soils and can tolerate drought • Depending on the climate there may be 2 nectariferous blooms are visited by hummingbirds and butterflies Climate change & Plant growth TPP4-Petrea Racemosa
  14. 14. TPP5- Ocotea Veraguensis
  15. 15. • Accepted name: Mespilodaphne Veraguensis • Mostly distributed in tropical and subtropical regions of the Americas including that Caribbean. • Can grow from 5 – 12 meters tall • Thrives in moist forest or thickets, mostly along stream banks, often on dry rocky hillsides Common Characteristics • No known medical use • The feature of the wooden stem makes Ocotea Veraguensis an ideal source of good quality wood •However, O. Veraguensis is not utilized to make wood because the dimension of stem is small, and the plant is only known to be produced in low yield. Uses • Ocotea Verageunsis should be able to flourish in Antigua • However, the occurrence of O. Veragenusis in Walling’s rain forest was observed to be less compared to other green trees and shrubs in the area • The near by steams in the area were dried up, there was no other evidence of water supply besides the occasional rainfall Climate change & Plant growth TPP5-Ocotea Veraguensis
  16. 16. TPP7- Tetrapterys Ambigua
  17. 17. • Native to the Caribbean and Latino America • Small trees, shrubs or vines • Toxic to livestock if consumed for long periods of time Common Characteristics • Some of the Tetrapterys species show hallucinogenic effects in humans and have been used by indigenous peoples in the preparations of ceremonial spiritual medicines. Uses • Flowers mostly during dry seasons, specially after fires. Climate change & Plant growth TPP7-Tetrapterys Ambigua
  18. 18. TPP9- Olyra Latifolia
  19. 19. • Common name: carrycillo • Found in: Mexico to Tropical America, Tropical Africa, Comoros, Madagascar • forest • woodland • savanna, • shrubland • native grassland. Common Characteristics • It has environmental uses and social uses, as animal food and a medicine and for food. Uses • adaptations to wet environment: • the roots and culms do have small air canals which help them survive in very wet soil • Requires a lot of water to grow, but well drained • adaptations to hot environment: • hairs to assist in water retention • waxy leaf to prevent easy diffusion of water out of leaf Climate change & Plant growth TPP9-Olyra Latifolia
  20. 20. TPP10- Carapa Guianensis
  21. 21. • Common name:Andiroba, Demerara Mahogany, Crabwood • Found in the north of South America, Central America, and the Caribbean, as well as Sub-Saharan Africa • Lowland rainforest • Marsh Edge • Swamp Forest • Alluvial River (means a manmade river) • Periodically flooded plains Common Characteristics • Medicinal ( itchy skin, fever and intestinal worms.) • Timber & Products (pulp and paper) Uses • adaptations to wet environment:  Grows in environments where the annual rainfall is above 3,000 mm with temperature between 20-35  Flowers depending on climate  More likely to be found in an occasionally flooded environment compared to a dry land  Tolerant of periodic flooding • adaption to hot environment:  Not much adaptions for hot environments but grows faster under direct overhead light Climate change & Plant growth TPP10-Carapa Guianensis
  22. 22. Phylogeny Tree
  23. 23. Discussion • Antigua experiences wet and dry seasons. Wet season being from mid-June to mid- November and dry season being the rest of the year. • As Earth's climate continues to warm, rainfall in Antigua and Barbuda is projected to decrease and temperature to increase.
  24. 24. Our predictions • We expect a decrease in the density of carapa guianesis and Ocotea Veraguensis which are adapted to great amounts of rainfall or are usually beside water sources. • The olyfa latifola, although prospers in temperate areas still requires a lot of rainfall for growth so scarcity in this plant may also be observed. • The presence of 3 subspecies of Petrea shows that these plants maybe already going through the process of natural selection, trying to adapt to the drier conditions they have been presented with in order to survive. • The presence of Tetrapterys Ambigua as this plant is numerous in times of drought.
  25. 25. What’s next? • To systematically track the density of these plants in the area as time progresses so we can see if our predictions are true. • Observe which plants are no longer in the area and which plants may have become invasive • We can see the firsthand effect of climate change on the biodiversity. • Intervention to curb climate change would be the best mode of action to preserve the plant life that currently inhabit this ecosystem.
  26. 26. THANK YOU Questions?

Editor's Notes

  • Talk about how the growth of the plant is stunted as no plants of that type were seen that were more than 1 meter tall
    Mention the feature of the stem
    Talk about how climate change could be the reason for the stunted growth
    Talk about the advantage of the plant being cultivated for production of wood
    Talk about an idea to genetically modify the plant to produce thicker stems
  • Talk about how the growth of the plant is stunted as no plants of that type were seen that were more than 1 meter tall
    Mention the feature of the stem
    Talk about how climate change could be the reason for the stunted growth
    Talk about the advantage of the plant being cultivated for production of wood
    Talk about an idea to genetically modify the plant to produce thicker stems
  • Talk about how the growth of the plant is stunted as no plants of that type were seen that were more than 1 meter tall
    Mention the feature of the stem
    Talk about how climate change could be the reason for the stunted growth
    Talk about the advantage of the plant being cultivated for production of wood
    Talk about an idea to genetically modify the plant to produce thicker stems
  • Talk about how the growth of the plant is stunted as no plants of that type were seen that were more than 1 meter tall
    Mention the feature of the stem
    Talk about how climate change could be the reason for the stunted growth
    Talk about the advantage of the plant being cultivated for production of wood
    Talk about an idea to genetically modify the plant to produce thicker stems
  • Talk about how the growth of the plant is stunted as no plants of that type were seen that were more than 1 meter tall
    Mention the feature of the stem
    Talk about how climate change could be the reason for the stunted growth
    Talk about the advantage of the plant being cultivated for production of wood
    Talk about an idea to genetically modify the plant to produce thicker stems
  • Talk about how the growth of the plant is stunted as no plants of that type were seen that were more than 1 meter tall
    Mention the feature of the stem
    Talk about how climate change could be the reason for the stunted growth
    Talk about the advantage of the plant being cultivated for production of wood
    Talk about an idea to genetically modify the plant to produce thicker stems
  • Talk about how the growth of the plant is stunted as no plants of that type were seen that were more than 1 meter tall
    Mention the feature of the stem
    Talk about how climate change could be the reason for the stunted growth
    Talk about the advantage of the plant being cultivated for production of wood
    Talk about an idea to genetically modify the plant to produce thicker stems

×