1. John Donlan Provost Grant Proposal
1
Developing a Beta-Clamp Loading Assay
Purpose/Outcomes:
DNA replication is an essential function in all domains of life. DNA polymerase processivity
factors, including sliding clamps and clamp loaders, play key roles in this function. Escherichia
coli (E. coli) has a β-clamp protein that is loaded onto DNA by a clamp loader protein complex
(ɣ-complex) comprising three ɣ, one δ, and one δ’ subunits. The ɣ-complex opens the closed-
ring β-clamp and loads it onto DNA using the energy of ATP (Park et al 2009). The β-clamp
encircles DNA and helps control traffic on DNA during DNA replication and repair. The β-
clamp is also a processivity factor, helping increase the efficiency of DNA replication and
ensuring all genomic DNA can be copied within each cell cycle.
The primary goal of this project is to develop an assay to determine the efficiency of E. coli ɣ-
complex loading E. coli β-clamp onto DNA. This will be accomplished by varying the ratio of β-
clamp to ɣ-clamp loader and time of reaction. The expected outcome of this study is the
successful development of an assay to determine efficiency of the ɣ-complex loading β-clamp
onto DNA under these different conditions to allow us to use loaded β-clamp in future
biophysical studies.
Significance/Originality:
Because errors in the crucial function of DNA replication could lead to cancers and other
diseases, understanding the β-clamp-clamp loader complex interactions and their role in DNA
replication is the focus of many studies. One challenge that such studies encounter is determining
the optimal ratio of ɣ-clamp loader to β-clamp and time of reaction to produce as much DNA
with β-clamp loaded onto it as possible. The conditions I determine to be optimal will then
enable many future experiments. This would conserve time and resources for such studies that
strive to further elucidate the structure and/or role of the β-clamp-clamp loader complex.
Because the E. coli β-clamp is similar to the human proliferating cell nuclear antigen (PCNA)
sliding clamp, understanding the β-clamp-clamp loader complex in E. coli may also further our
understanding of the clamp-clamp loader complex in humans (Paschall et al. 2011).
Methods/Research Design:
Transformation and Protein Expression
We already have in hand the DNA constructs, pET3c vector encoding the sequence for δ protein,
pET3c vector encoding the sequence for δ’ protein, pET28a-pp vector encoding the sequence for
ɣ, and pET11t encoding the β-clamp. E. coli BL21(DE3)pLysS competent cells will be
transformed with all three ɣ-complex subunits whereas the BL21(DE3) cells will be transformed
with β. Each transformation will be plated onto Luria Broth (LB) plates containing the
appropriate antibiotic. Plates will be grown in a 37°C incubator overnight. A colony from each

2. John Donlan Provost Grant Proposal
2
plate will be selected and used to inoculate 50 mL of LB medium containing the appropriate
antibiotic and then grown overnight at 37°C. Protein expression will be induced by adding
Isopropyl β-D-1-thiogalactopyranoside (IPTG) to 1 mM final concentration either overnight at
18°C (ɣ-subunit) or for 4 hours at 30°C. Cell culture will be spun down and pellets will be stored
at -80°C and subsequently used for purification. Protein expression levels will be determined via
sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE).
Protein Purification
Frozen cells will be thawed overnight on ice at 4°C. Lysis buffer containing lysozyme and
DNaseI will be added. After pellets are thoroughly resuspended, cells will be sonicated for 4
minutes, in 15 second on/off intervals. Cell debris will be pelleted by centrifugation. The lysate
will be filtered and loaded onto to the appropriate column for each protein. The δ lysate will be
loaded onto a HiTrap SP sepharose FF column then eluted using a gradient from 0 to 500 mM
NaCl. Fractions containing protein of interest will be pooled and stored at -80°C. The δ’ lysate
will be loaded onto a HiTrap Heparin HP column and eluted with 0 to 500 mM NaCl gradient.
Fractions containing protein of interest will then be pooled and loaded onto a HiTrap Q
sepharose FF column. Fractions containing the protein of interest will be then pooled and frozen
at -80°C. The ɣ lysate will be loaded onto a HisTrap FF column with 20 mM imidazole and
eluted using a linear gradient of 0 to 250 mM imidazole. Once all three subunits are purified, the
ɣ-complex will be assembled by mixing δ: δ’: ɣ in a 1:1:2 ratio and dialyzed overnight at 4°C.
The protein mixture will then be loaded onto a HiTrap Q sepharose FF column eluted using a 0
to 500 mM NaCl gradient. Fractions containing the ɣ-complex will be then pooled and frozen at
-80°C.
The β lysate will be loaded onto a DEAE column and eluted using a 0 to 1 M NaCl. Fractions
containing the protein of interest will be pooled and then loaded onto a HiTrap Phenyl high-
substitution FF column containing 1 M ammonium sulfate and eluted with a linear gradient to 0
mM ammonium sulfate. The fractions containing protein of interest will be concentrated using
VivaSpin 20, 10 MWCO, down to 2 mL and loaded onto a Superdex 75 SEC column. Fractions
containing the purified β-clamp will be then pooled and frozen at -80°C.
Determining Protein Concentration
The purified protein concentration will be determined using the Bio-Rad protein assay. A
standard curve will be created using known concentrations of bovine serum albumin (BSA) in 1x
Bradford reagent. The absorbance of the Coomassie Brilliant Blue G-250 dye binding to the
protein will be measured at 595 nm. The unknown protein concentration will be determined
using the standard curve.

3. John Donlan Provost Grant Proposal
3
β-Clamp Assay Development
Dynabeads M-280 Streptavidin beads will be used for tethering biotinylated oligonucleotides and
subsequently loading β-clamp protein onto the DNA bound to the streptavidin beads. The
magnetic Dynabeads are ideal for binding the biotinylated oligonucleotides as they require only a
magnet and short incubation period to separate DNA bound from unbound fractions. We will
have the two DNA oligonucleotide sequences shown below in Figure 1 synthesized by a
commercial service. The oligonucleotides will have sequence homology so that they will anneal
to each other resulting in a 5’ single-stranded (ss) DNA overhang onto which end the β-clamp
will be loaded. Each 5’ end of the oligonucleotide will be biotinylated which will bind to the
streptavidin-coated beads.
Figure 1. Biotinylated DNA Sequence.
The quantity of beads required to bind the DNA will be experimentally determined by adding
various amounts of DNA and quantifying the amount of DNA bound to beads. The streptavidin
beads will first be washed with Binding/Wash buffer (10 mM Tris-HCl pH 7.5, 1 mM EDTA, 1
M NaCl) to remove the storage buffer in which the beads are stored. Single-stranded biotinylated
DNA will be annealed using a thermal cycler by setting the temperature for 2 min at 95°C, 30
min at 50°C, and slowly cooling to room temperature to allow sufficient time for the DNA to
come together. We will run ss and double-stranded (ds) DNA on a polyacrylamide gel to verify
that sufficient annealing has occurred. Biotinylated dsDNA will be added to the washed
streptavidin beads. The time of incubation will be experimentally determined to ensure enough
DNA binds to the beads. Unbound DNA will be washed away with the Binding/Wash buffer.
Beads will then be resuspended in β-loading buffer (150 mM Hepes pH 7.5, 100 mM NaCl, 37.5
mM MgSO4, 10 mM βME) and β-clamp, ATP, and ɣ-complex will be added (Figure 2). The
optimal ratio of β-clamp, ATP, and ɣ-complex will be experimentally determined to ensure that
sufficient β-clamp is loaded onto the DNA. The time of incubation will also be optimized.
Samples will be analyzed by SDS-PAGE gel to verify the amount of β-clamp loaded and the
amount of time the β-clamp remains loaded.
Figure 2. ɣ-complex loading β-clamp onto DNA.
5’ - AGTTCTTCTGCAATAACTGGCCGTCGTTTGAAGATTTCG - 3’
3’ - CGTTATTGACCGGCAGCAAACTTCTAAAGCTTACAACTGACGCTTTTGGGACCGCAATGTCTTACC – 5’
Biotin Biotin
β-Clamp
γ- complex
ATP
Streptavidin
Bead
Streptavidin
Bead
Streptavidin
Bead
Streptavidin
Bead
Biotin Biotin BiotinBiotin

4. John Donlan Provost Grant Proposal
4
Challenges
We anticipate challenges to come up in every step of the development of the β-loading assay and
have plans to address them. Efficient annealing of the single-stranded oligonucleotides needs to
be achieved and the biotinylated-annealed oligos will need to be in the proper orientation in
order to bind to the magnetic streptavidin beads (see Figure 1). We will ensure that the double
stranded DNA is bound to the beads by analyzing the beads on a polyacrylamide gel. Optimizing
the ratio of ɣ-clamp loader proteins to the β-clamp dimer and ATP poses the biggest challenge as
the clamp loader when used in high concentration also serves as a clamp unloader. We plan to
use a range of concentrations of clamp loader and monitor many time points in order to optimize
the amount of clamp loader that allows sufficient loading without observing clamp unloading.
We will wash the beads gently to remove unbound proteins without removing bound proteins.
Determining the optimal time for the ɣ-complex to load the β-clamp onto the DNA is another
likely challenge and will be addressed by the time-course experiments. The β-clamp will need to
be loaded onto DNA and stay loaded for a sufficient amount of time in order to study its function
further.
Time Table
Action Time Needed
DNA Transformation/Protein expression and purification 1 week
Protein expression and purification 5-7 weeks
Optimizing ratio of proteins and time of reaction 7 weeks
Total 13-15 weeks
Dissemination:
Ongoing and final results of the study will be discussed during the weekly Beuning Laboratory
group meetings. We aim to present our findings at Northeastern University’s Honors Research
Showcase Event, RISE exposition in Spring 2016, and the American Chemical Society Chapter
at Northeastern.
Evaluation:
To analyze the results of the study, data will be discussed during the Beuning laboratory weekly
group meetings. Future experimentation will be planned based on conclusions made from the
results. Troubleshooting experiments will be designed accordingly. The assay will be redesigned
if an insufficient amount of β-clamp is loaded onto DNA.

5. John Donlan Provost Grant Proposal
5
Faculty Mentorship
This study will be conducted primarily under the mentorship of graduate student Bilyana Koleva
as well as the mentorship of principal investigator Dr. Penny Beuning.
References
Fang, Jing, Engen, John R., and Beuning, Penny J. "Escherichia coli Processivity Clamp β from
DNA Polymerase III Is Dynamic in Solution." Biochemistry 50.26 (2011): 5958-968.
Park, Mee Sook. and O’Donnell, Mike. “The Clamp Loader Assembles the β Clamp onto 3’ or 5’
Primer Terminus.” The Journal of Biological Chemistry 284.45 (2009): 31473-31483.
Paschall, Christopher O., Thompson, Jennifer A., Marzahn, Melissa R., Chiraniya, Ankita.,
Hayner, Jaclyn N., O’Donnell, Mike., Robbina, Arthur H., McKenna, Robert., and Bloom, Linda
B. “The Escherichia coli Clamp Loader Can Actively Pry Open the β-Sliding Clamp.” The
Journal of Biological Chemistry 286.49 (2011): 42704-42714.