1. 2
Comparison of DNA binding properties and identification of putative
target genes for two apparently redundant, yet functionally distinct
Pinus taeda Myb homologues
Susan M. Rodzik*1 and Malcolm M. Campbell2
1Department of Biochemistry and The Forest Biotechnology Group, North Carolina State
University, 2500 Partners II, 840 Main Campus Drive, Centennial Campus, Box 7427, Raleigh, NC
27695, USA and 2Department of Plant Sciences, The University of Oxford, South Parks Road,
Oxford OX1 3RB, UK
*To whom correspondence should be addressed. Tel (919) 515-7799 or (919) 515-7800; Fax
(919) 515-7801; Email: smrodzik@unity.ncsu.edu

2. 3
ABSTRACT
Mybs are currently the largest known family of transcription factors in plants. Many
plants have multiple Mybs with seemingly identical DNA binding domains, yet
different functions. How these proteins with such highly-conserved DNA binding
domains have evolved different functions in plants is poorly understood. We have
approached this issue from a functional perspective, by comparing the DNA binding
properties of two Mybs from loblolly pine, Pt Myb 126 and Pt Myb 413, biochemically,
in vitro, and in silico. We demonstrated through in vitro binding site selection assays that
Mybs 126 and 413 target three identical DNA binding sites: ACCTACC, ACCAACC,
and ACCTAAC. We further deduced DNA consensus binding sites for Myb 126 (T/C)
(C/T)(C/t)ACCTACC(G/A) and Myb 413 (C/T)ACC(T/a)A(C/A)C(G/a)(C/t).
Through apparent binding constant determinations, we then showed that Mybs 126 and
413 target their identical DNA binding sites with different relative affinities. Finally, we
determined that sets of sequences from the Eukaryotic Promoter Database which
contained Myb 126 or Myb 413 consensus binding sites were similarly overlapping, yet
different. Our results indicate that Mybs 126 and 413 from loblolly pine have evolved
overlapping, yet different functions in part by evolving the ability to target identical
DNA sequences with different relative affinities.
KEYWORDS
Myb, plant, binding site selection, apparent binding constant, Eukaryotic Promoter
Database

3. 4
INTRODUCTION
Eukaryotic transcription factors generally evolve as families of proteins with highly-
conserved structural motifs (1). Some of these structural motifs mediate protein-protein
interactions. More often, however, they function within highly-conserved DNA binding
domains (1-3). Highly-conserved DNA binding domains often seem to function
identically, as many transcription factors within a family bind similar, if not identical
DNA sequences (1-4). Nonetheless, members of a given family of transcription factors
can function quite differently overall, even in the same organism or tissue (4-6). Thus,
an important question to answer for each family of transcription factors is how these
proteins with highly-conserved DNA binding domains and seemingly identical DNA
binding specificities evolve different functions.
The Myb family of transcription factors in plants provides an intriguing example of
this constrained, yet divergent evolution in eukaryotes. Myb transcription factors are
nuclear-localized, DNA binding proteins which regulate gene expression and are
known for their highly-conserved DNA binding motifs (1, 6-11). Each motif contains
two alpha helices which form a helix-turn-helix (HTH) structure and a third alpha helix
which recognizes bases in the DNA's major groove (12-15). Each motif tandemly repeats
itself in the Myb DNA binding domain (14). Animal Mybs typically have three motif
repeats (R1, R2, and R3; 5). Plant Mybs typically have two (R2 and R3; 6), although
several plant Mybs with three repeats have recently been identified (16). In addition, a
few plant and animal Mybs have only one repeat (R3; 17-20). Within plant and animal
Myb DNA binding domains, certain amino acids are also tightly conserved. Three
regularly-spaced tryptophans form the hydrophobic core of the domain, and a cysteine
residue often functions in redox regulation (12,21-25). Most significantly, six of eight

4. 5
putative base-contacting residues in the DNA binding domains of animal Mybs are
fully-conserved in all plant Mybs (6). The remaining two are 80 percent conserved.
Thus, plant and animal Mybs share DNA binding domains which are really quite
similar.
However, plant and animal Mybs clearly function differently. Relative to animals,
plants use Mybs more extensively to target a greater number of genes. More than 100
Myb proteins are currently known to exist in plants, whereas only a few have been
found in animals (6,7). At least 85 Myb homologues exist in Arabidopsis thaliana alone
(26). In fact, Mybs are currently the largest known family of transcription factors in
plants. Plant Mybs also regulate more processes than animal Mybs, and they regulate
these processes more specifically. Animal Mybs regulate cellular proliferation,
differentiation, and apoptosis (11,27,28). Plant Mybs regulate numerous processes
ranging from secondary metabolism to determination of cell shape to hormone-initiated
signals (6). Thus, the Myb family of transcription factors in plants provides an
important opportunity to examine the fundamental question of how Myb structure
confers Myb function. That is, how can so many proteins with such conserved DNA
binding domains evolve so many different functions within a single group of
organisms, or even a single species?
We examined this question by characterizing two Myb homologues from Pinus taeda
L. (loblolly pine). cDNAs encoding two Myb homologues, Pt Myb 126 and Pt Myb 413,
were previously cloned from differentiating P. taeda xylem (M. Campbell, manuscript in
preparation). Both proteins were abundantly expressed in xylem tissue. Both activated
transcription of a reporter gene from the bean PAL2 promoter in transgenic tobacco. The
PAL2 promoter contains plant Myb binding sites which are essential for xylem-localized

5. 6
gene expression (29,30). Thus, Pt Mybs 126 and 413 appeared to regulate xylem-
localized genes. The question was, did these two apparently functionally redundant
Mybs target identical genes in the same manner, or had they evolved different
functions?
In the present study, we approached this question from a functional and biochemical
perspective. We characterized full-length, purified recombinant proteins, Mybs 126T
and 413T in vitro to determine whether their DNA binding properties were the same.
We then compared Myb 126T and 413T consensus binding sites with the Eukaryotic
Promoter Database and known P. taeda lignin biosynthetic genes in silico to determine
whether Mybs 126T and 413T might target the same genes. Our results suggest that the
Myb family of transcription factors in plants evolved different functions in part by
evolving the ability to target identical DNA sequences with different relative affinities.

6. 7
MATERIALS AND METHODS
Protein expression and purification
Full-length cDNAs encoding the Myb 126T and 413T proteins were cloned in pET-
30c(+) between the Bam HI and Sal I restriction sites and expressed in E.coli (pET
expression system; Novagen). E.coli BL21(DE3) cells (Novagen) were transformed with
Myb 126T, 413T, or control (empty vector) constructs and grown from single colonies in
50 ml of TB at 37°C. Cells were grown for 3.5 hours to an A600 of 0.5-0.6, then induced
by adding IPTG to a final concentration of 1 mM. Induced cells were grown for 2.5
hours and pelleted by centrifugation for 5 minutes at 5,000 x g and 4°C, then frozen in
liquid nitrogen and stored at -80°C. Cell pellets were thawed on ice for 15 minures and
lysed in one-fifth volume of denaturing lysis buffer (8 M urea, 0.1 M NaH2PO4, 0.1 M
Tris-HCl, pH 8.0; Qiagen) for one hour at room temperature. Recombinant proteins
were purified from the cell lysates on Ni2+-NTA columns (Qiagen), then eluted in
denaturing elution buffer (8 M urea, 0.1 M NaH2PO4, 0.1 M Tris-HCl, pH 4.5; Qiagen).
Final eluates were frozen in liquid nitrogen and stored at -80°C. The concentration of
each protein eluate was determined using S·Tag assays (Novagen). Both purified
proteins migrated as single bands on SDS-PAGE gels.
Electrophoretic mobility shift assays
All electrophoretic mobility shift assays (EMSAs) in this study were performed
entirely at 4°C as follows. Prior to each experiment, protein preparations were thawed
on ice, diluted at least tenfold to the appropriate concentration, and allowed to renature
for 10-15 minutes. Reactions were then prepared in 27 µl of binding buffer (10 mM Tris-
HCl, pH 7.5, 50 mM NaCl, 1 mM EDTA, 1 mM DTT, 100 µg/ml BSA, 5% glycerol, 80

7. 8
µg/ml poly(dI-dC)·poly(dI-dC), 0.5 µg/ml antipain, pepstatin A, and phenyl methyl
sulfonyl flouride; 31). Reactions were preincubated with protein for 25 minutes to allow
for nonspecific binding to poly(dI-dC)·poly(dI-dC), then incubated with radiolabelled
probe for 30 minutes. Reactions were then loaded on 6% (37.5:1 acylamide: bis-
acrylamide), 0.5X TBE, 1.5 mm native polyacrylamide gels which had been pre-
electrophoresed for 20 minutes. Gels were run at 95 V (8 V/cm) constantly for 7.5 hours
at 4°C. Probe concentrations were determined by TCA precipitation and scintillation
counting (32). Gels were generally fixed, dried on Whatman 3MM chromatography
paper, and autoradiographed (32). Gels used for binding site selection were not fixed.
Binding site selection assays
Binding site selection assays for Mybs 126T and 413T were adapted from Pollock
and Treisman, 1990 (33). Five rounds of selection were performed; each employed an
EMSA. The first EMSA combined an E. coli cell lysate containing Myb 126T or 413T with
a 63 bp, randomized DNA probe: 5'ACATTGGGCGAGAAAAGC(N27)CCCTCCTCCTC
CGATCTG3'. This probe was prepared by annealing a primer to the 3’ end and
extending the primer with Klenow fragment and 20 µCi of [α-32P]dATP and [α-
32P]dCTP. The probe was purified on a Qiagen PCR-Quick column. EMSA gels were
dried, shifted bands were excised, and DNA was amplified from each dried gel slice in
a 100 µl PCR. Amplified DNA was then used as a probe for the next EMSA/round of
selection. PCR amplifications included a high-fidelity DNA polymerase (TaKaRa Ex
Taq, Pan Vera), end-labelled primer R5 (5'ACATTGGGCGAGAAAAGC3'), unlabelled
primer R12 (5'CAGATCGGAGGAGGAGGG3'), 100 µM dNTPs (all four), 10 µCi [α-
32P]dATP, and 10 µCi [α-32P]dCTP. PCRs were as follows: 45 sec at 98°C, 1 min at

8. 9
42°C, 30 sec at 72°C, repeated 19 times, followed by a 4 minute extension at 72°C and
purification of products on Qiagen PCR-Quick columns. Three parts of this procedure
were modified in each round to increase the stringency of selection. First, the amount of
purified protein was gradually reduced by 30%. Secondly, the amount of DNA probe
was gradually increased from 0.4 ng to 0.6 ng. Finally, PCR cycles were gradually
reduced from twenty to twelve. DNA from the last round of selection was amplified
using primers with EcoRI sites (R5EcoRI: 5'GCGAATTCACATTGGGCGAGAAAAGC
3' and R12EcoR1: 5'ATGAATTCCAGATCGGAGGAGGAGGG3') to facilitate cloning.
DNAs were cloned in pBSIIKS+ (Stratagene) and sequenced at Iowa State University.
Competition assays
Competition assays were performed as EMSAs in which radiolabelled ACI DNAs
were used as probes, and unlabelled ACI, ACII, or ACIII DNAs were used as
competitors. An additional DNA which contained an AP-1 transcription factor binding
site (TGACTCAG) was used as a negative control. All probe and competitor DNAs
were designed from a single DNA sequence recovered from binding site selection so
that each DNA’s binding site occurred in an identical sequence context. Double-
stranded probe or competitor DNAs were made from single-stranded, chemically-
synthesized oligonucleotide (Genosys Biotechnologies, Inc.). Radiolabelled probe DNAs
were made by amplifying an ACI oligonucleotide in twelve cycles of PCR, as described
in the previous section. Nonradiolabelled competitor DNAs were made by combining
sense and antisense strands of each oligonucleotide in a solution of 10 mM Tris-HCl, pH
7.5, 50 mM NaCl, and 1 mM EDTA. The strands were denatured for five minutes at
99°C, reannealed for 30 minutes at 88°C, and slowly cooled to room temperature.

9. 10
Competitor DNAs were purified from single bands on separate, 3%, 1XTBE, MetaPhor
agarose gels (FMC Bio Products). DNA was recovered from the bands using JetSorb
beads (Genomed), then precipitated with pellet paint (Novagen), resuspended in 10
mM Tris-HCl, pH 7.5, and quantitated by ethidium bromide staining. Ethidium
bromide was removed by extraction with H2O-saturated butanol, and a Hoefer
fluorometer was used to verify the final DNA concentrations. The EMSAs were carried
out as previously described, except that radiolabelled probe and nonradiolabelled
competitors were mixed and added together in the second step of the reaction.
Relative affinity assays and apparent binding constant determinations
Relative affinity assays and binding constant determinations were also performed
using EMSAs. These EMSAs employed purified proteins and the same DNA probes
which were used in competition assays. Every EMSA was repeated at least three times.
Relative affinity assays combined a constant amount of radiolabelled DNA with
increasing amounts of purified protein. Apparent binding constant determinations
employed a constant amount of purified protein and increasing concentrations of
radiolabelled DNA. The wide range of DNA concentrations in the latter assays was
created by diluting the specific activity of each radiolabelled DNA using gel-purified,
non-radiolabelled DNA of identical sequence. Free and bound DNAs were quantitated
by phosphorimaging; resulting data were analyzed using ImageQuant v.1.1 (Molecular
Dynamics). Apparent dissociation constants (Kds) were estimated by nonlinear
regression and verified by linear Scatchard plots (KaleidaGraph™ 3.0; Synergy
Software). Apparent Kds were reported as means of three independently-determined
values.

10. 11
Identification of putative Myb 126T and 413T binding sites in plant and animal
promoter sequences
Eukaryotic Promoter Database 50 (EPD50) was searched to identify plant and
animal promoter sequences which contained putative Myb 126T or 413T DNA binding
sites (34,35; http://www.epd.isb-sib.ch). First, Myb 126T and 413T DNA binding site
consensus matrices were generated from binding site selection data using the software
algorithm MatInd (36). Each consensus matrix was then compared against EPD50 under
stringent search conditions using MatInspector (36). Final matrix threshold levels for
these searches (0.88 for Myb 126T, 0.90 for Myb 413T) were chosen to maximize the
absolute number of hits while minimizing detection of mismatches. A consensus core
search (threshold = 0.80) was conducted for the Myb 413T search but omitted from the
Myb 126T search. This allowed more putative binding sites to be detected in each case
(36). All data from these searches were analyzed as described in the Results section.
Three P. taeda lignin biosynthetic genes were also searched for sequences which
contained putative Myb 126T or 413T binding sites. P. taeda phenylalanine ammonia-
lyase(pal), cinnamyl alcohol dehydrogenase (cad), and 4-coumarate: CoA ligase (4cl)
genomic clones were compared with the Myb 126T and 413T consensus matrices using
MatInspector (36-40 and R. Whetten and R. Schaffer, unpublished data). Matrices were
compared with sequences upstream of the coding region in pal and 4cl, and with
sequences upstream and downstream of the coding region in cad. Final matrix
thresholds were chosen as described above.

11. 12
RESULTS
Mybs 126T and 413T target identical DNA binding sites in vitro
Binding site selection assays were performed to determine which DNA sequences
Mybs 126T and 413T targeted in vitro. From the very first round of selection, a Myb
126T or 413T-DNA complex was visible on the autoradiograph. By the fifth round of
selection, the amount of DNA in each complex had increased significantly, as probe
DNAs were clearly enriched for sequences which contained Myb 126T or 413T binding
sites (Fig. 1). Cloning and sequencing DNA from these complexes revealed the extent of
this enrichment: every DNA which was sequenced contained at least one Myb 126T or
413T binding site. Alignment of these final DNA sequences further revealed that Mybs
126T and 413T targeted the same three DNA binding sites in vitro: ACCTACC,
ACCAACC, and ACCTAAC (ACI, ACII, and ACIII, respectively; Tables 1 and 2). Both
proteins also targeted five other binding sites at very low frequencies: ACCCACC,
ACCCAAC, ACCTACT, ACCTAAT, and ACCAATC. No other binding sites were
selected by either protein. Thus, binding site selection assays revealed that Mybs 126T
and 413T targeted a small, identical set of DNA binding sites in vitro.
Mybs 126T and 413T have different DNA consensus binding sites
Final, selected DNA sequences were analyzed to identify Myb 126T and 413T
consensus binding sites. Only DNA sequences which contained a single Myb binding
site (noncomplex sequences) were used. These sequences were examined in two sets.
The first set included all noncomplex selected DNAs. The second set included only

12. 13
noncomplex selected DNAs which contained no bases from the constant region of the
original probe in the specified window (positions -7 to 10, Table 3). Both sets of
sequences yielded similar results, with four of the seven bases in each consensus core -
the ACC trinucleotide at position -2, and the A at position 3 – being 100% conserved
(Table 3). Thus, the Myb 126T and 413T DNA consensus binding sites were identified as
(T/C)(C/T)(C/t)ACCTACC(G/A) and (C/T)ACC(T/a)A(C/A)C(G/a)(C/t),
respectively.
Closer examination revealed that the Myb 126T and 413T DNA consensus binding
sites were different. Differences were seen most clearly in the core of each consensus
(bold, Table 3). A single base in each position of the Myb 126T core was 85% or more
conserved. Other bases in the same positions were no more than 8% conserved.
However, in the Myb 413T core, positions 2 and 4 were quite variable. The frequency
with which either A or T occurred in position 2 was more than 21%. The frequency with
which either A or C occurred in position 4 was more than 49%. The Myb 126T and 413T
consensus binding sites also differed elsewhere. At position –7, Myb 126T tolerated any
residue, whereas Myb 413T bound primarily adenine. At position –5, Myb 126T
recognized T more frequently than C, whereas Myb 413T did not. And at position –4,
Myb 126T recognized primarily C residues, whereas Myb 413T tolerated any base.
Thus, consensus binding site calculations confirmed the qualitative results of binding
site selection: although Mybs 126T and 413T targeted the same three DNA sequences,
each protein targeted these sequences in different relative proportions (Tables 1, 2, and
3). Thus, the Myb 126T and 413T DNA consensus binding sites were quantitatively
different.

13. 14
Binding to the targeted DNA sequences is specific and reversible
Competition assays were used to assess whether Mybs 126T and 413T bound the in
vitro-selected DNA sequences specifically and reversibly. In each competition,
radiolabelled ACI DNA was used as a probe, and nonradiolabelled ACI, ACII, ACIII, or
AP-1 DNAs were used as competitors. Each probe or competitor DNA contained one
binding site in a sequence context which was identical to all the others. AP-1 DNA,
whose binding site differed greatly from the selected ACI, ACII, and ACIII Myb
binding sites, was used as a negative control. Competitions with Myb 126T and 413T
produced nearly identical results: nonradiolabelled ACI, ACII, and ACIII DNAs
competed for binding to the protein. Nonradiolabelled AP-1 DNA did not (Fig. 2A and
2B). Similarly, radiolabelled AP-1 DNA did not bind either protein in vitro (data not
shown). Finally, high concentrations of nonradiolabelled ACI, ACII, and ACIII DNAs
completely reversed binding to the radiolabelled probe. High concentrations of
nonradiolabelled AP-1 DNA did not. Thus, competition assays demonstrated that Mybs
126T and 413T bound their targeted DNA sequences specifically and reversibly.
Mybs 126T and 413T target identical DNA binding sites with different relative
affinities
EMSAs were also carried out to determine whether Mybs 126T and 413T targeted
their identical DNA binding sites with different relative affinities. In each assay, a
constant amount of DNA probe (0.15 ng) was titrated with increasing amounts of
purified protein. Each titration was repeated at least three times, in different pairwise
combinations (ACI and ACII, ACI and ACIII, etc.). These titrations confirmed the
previous data, which showed that Mybs 126T and 413T targeted ACI, ACII, and ACIII

14. 15
binding sites differently (Tables 1 and 2; Fig. 3). Myb 126T targeted primarily ACI, and
less of ACIII or ACII (Figs. 3A, 3C). However, Myb 413T appeared to recognize all three
sequences with more or less equal affinity (Figs. 3B, 3C). Thus, these titrations
qualitatively demonstrated that Mybs 126T and 413T targeted identical DNA binding
sites with different relative affinities.
The differences in relative affinity can be quantitated
Variable DNA titrations were used to determine apparent dissociation constants
(Kds) for interactions between Myb 126T or 413T and two of the previously-selected
DNA binding site sequences (Tables 1 and 2). Sequences used in these assays were
DNAs which were bound with the greatest and least affinities in the preceding
titrations (ACI and ACII, Fig. 3A; ACIII and ACII, Fig. 3B, respectively). Final apparent
Kds confirmed that Mybs 126T and 413T bound each of these sequences specifically (Kd
≤ 10^-8
M; Fig. 4, Table 4). Apparent Kds also showed that Myb 126T bound ACI with
greater affinity than ACII (24.3 ± 2.3 nM vs. 35.6 ± 6.6 nM), confirming previous,
qualitative results (Table 1; Fig. 3). Apparent Kds for the 413T-ACII and 413T-ACIII
interactions were not significantly different (30.6 ± 8.3 nM vs. 19.9 ± 8.0 nM; Table 4).
Thus, previous results for Myb 413T were also confirmed (Table 2; Fig. 3). Measured
apparent dissociation constants thus confirmed that Mybs 126T and 413T targeted their
identical DNA binding sites specifically, and with different relative affinities.
Myb 126T and 413T binding sites are specifically conserved in promoters of
certain eukaryotic genes
Eukaryotic Promoter Database 50 (EPD50) was searched for sequences which
contained putative Myb 126T or 413T binding sites. Matrices representing Myb 126T

15. 16
and 413T consensus binding sites were generated using MatInd (36). Myb 126T and
413T matrices were then compared with EPD50 using MatInspector to locate promoter
sequences which contained putative Myb 126T and 413T binding sites (36). Data from
these searches showed two apparent trends. First, putative Myb 126T and 413T binding
sites were present in promoters of genes which functioned in plant secondary product
metabolism (data not shown). Eight of twelve EPD50 promoters which functioned in
plant secondary metabolism contained sequences which matched the Myb 126T or 413T
matrix at a threshold of 0.88 or higher. Second, putative Myb 126T and 413T binding
sites were present in sequences of promoters which functioned in plant
phenylpropanoid metabolism: chalcone synthase (chs), pal, 4cl, and maize anthocyanin
(data not shown). Seven of ten EPD50 promoters which functioned in phenylpropanoid
metabolism contained sequences which matched the Myb 126T or 413T matrix at a
threshold of 0.88 or higher. Chi-square tests of independence were used to assess the
significance of apparent associations between EPD50 plant secondary metabolic genes
or phenylpropanoid genes and the presence of Myb 126T or 413T binding sites. The null
hypothesis of independence was rejected at a significance level of p<0.001 in each case.
No other trends were detected among the matching EPD50 promoter sequences’
hierarchical classifications (34). Thus, putative Myb 126T and 413T binding sites were
specifically conserved in promoters of genes which functioned in plant secondary
metabolism and phenylpropanoid biosynthesis.
EPD50 promoters which contained sequences that matched the Myb 126T or 413T
matrix also showed apparent trends in gene expression (Table 5). Keywords from the
gene expression fields of Myb 126T or 413T matrix-matching promoter sequences were
grouped, along with synonyms and abbreviations listed in the EPD50 User Manual (37).

16. 17
These keywords were used to define seventeen original gene expression categories for
EPD50 (Table 5). The gene expression categories were chosen to reflect either the stage
of development, physiological system, tissue type, or signaling mechanism under which
a given EPD50 gene was expressed. EPD50 promoters which matched the keyword set
for each gene expression category were counted using PERL strings. These PERL strings
will be provided by the corresponding author upon request. EPD50 promoters whose
sequences matched the Myb 126T or 413T matrix as well as a given gene expression
category were counted manually. A chi-square test was then used to assess whether
putative Myb 126T or 413T binding sites occurred in EPD50 promoter sequences
independently of the gene expression category associated with each promoter. For Myb
126T, the null hypothesis of independence was rejected (p<0.001) for normal cell
division, embryogenesis, light-regulation, hormonal regulation, and genes expressed
within the endocrine system. For Myb 413T, the null hypothesis of independence was
rejected (p<0.001) for normal cell division, viral gene expression, light regulation,
hormonal regulation, genes expressed in the endocrine system, and genes expressed
within the nervous system. Thus, the presence of putative Myb 126T or 413T binding
sites in EPD50 promoter sequences was specifically associated with certain patterns of
gene expression. The patterns of gene expression associated with Myb 126T and 413T
binding sites were overlapping, but different.
Myb 126T and 413T binding sites are conserved in sequences of P. taeda lignin
biosynthetic genes
Three P. taeda genomic clones encoding the lignin biosynthetic enzymes PAL, CAD,
and 4CL were searched to identify putative Myb 126T and 413T binding sites (Table 6).

17. 18
Myb 126T and 413T matrices were compared with sequences upstream of the
translation start site in pal and 4cl, and with sequences upstream and downstream of the
translation start site in cad (R. Whetten and R. Schaffer, unpublished data; 40). Matches
to the Myb 126T or 413T matrix were detected at a threshold of 0.80 or higher in all
three genes. All matrix matches occurred upstream of the transcription start site in pal
(Table 6, and A. Morse, unpublished data). Two of the four matrix matches for Myb
126T, and four of the eight matrix matches for Myb 413T occurred upstream of the
transcription start site in cad (Table 6; 40). At least four Myb 126T or 413T matrix
matches were found in each gene. Thus, putative Myb 126T and 413T binding sites were
clearly conserved in two P. taeda lignin biosynthetic gene promoters, pal and cad, as well
as in sequences upstream of the translation start site in a third P. taeda lignin
biosynthetic gene, 4cl.
DISCUSSION
Myb 126T and 413T DNA binding specificities overlap with, but are distinct from
those of other Myb proteins
Binding site selection assays with full-length, recombinant, purified proteins
revealed that P. taeda Mybs 126T and 413T bound the same three DNA sequences in
vitro: ACCTACC, ACCAACC, and ACCTAAC. These three AC-rich DNA sequences are
known as AC elements: ACI, ACII, and ACIII, respectively (29). Initially, AC elements
were characterized as cis-acting sequences in promoters of plant flavonoid biosynthetic
genes (29,42-45). AC elements are now known to occur in promoters of genes
throughout the plant phenylpropanoid pathway (45-50). Certain other plant Mybs also

18. 19
recognize AC elements in vitro: snapdragon Mybs 305 and 340, maize Mybs P and C1,
Arabidopsis Mybs 6 and 7 and Pea Myb 26 (47,51-55). It is not known whether Pt Mybs
126 and 413 would recognize AC elements in planta. In vivo footprinting and
transcriptional activation assays in P. taeda would be needed to clarify this. However, all
three AC elements were detected in promoter sequences from P. taeda (Table 6). And
AC elements in promoters from certain other plant species are known to function in vivo
(29,42). Moreover, Mybs 126T and 413T activated expression of a reporter gene from AC
elements in a heterologous system (bean PAL2 promoter and tobacco mesophyll
protoplasts; M. Campbell, manuscript in preparation). Finally, in vitro binding site
selection assays have been shown to identify sequences which closely resemble a
protein’s native binding sites in the cases of SRF1 and MCM1 (33,56-58). Thus, it
appears likely that Mybs 126T and 413T would recognize AC elements as their natural
targets in vivo. And the present data clearly show that Myb 126T and 413T’s in vitro
DNA binding specificities overlap with those of other plant Mybs.
By contrast, Myb 126T and 413T consensus binding sites clearly differed from those
of other Mybs in plants and animals. Consensus binding sites have only been assigned
for two other plant Mybs: maize protein P and Petunia Myb.Ph3 (60,61). Maize P
recognizes ACC(T/A)ACC as its consensus binding site (53). Petunia Myb.Ph3
recognizes two distinct consensus binding sites: aaaAaaC(G/C)GTTA and aaaAG
TTAGTTA (61). The Myb 413T consensus binding site, (C/T)ACC(T/a)A(C/A)C(G/a),
was similar to the maize P consensus site, but was longer, and differed from the P
consensus site in the sixth position (C/A vs C). The difference translates into the fact
that maize P recognizes two binding sites (ACI and ACII) equally well, whereas Myb
413T recognized three sites (ACI, ACII, and ACIII) equally well. Similarly, Myb 126T’s

19. 20
consensus binding site, (T/C)(C/T)(C/t)ACCTACC(G/A) resembled the maize P
consensus site, but was more constant in the same region, translating into the fact that
Myb 126T recognized primarily one binding site: ACI. Myb 126T and 413T consensus
binding sites differed from the Myb.Ph3 consensus sites even more, as these sequences
had very few conserved bases in common. Finally, Myb 126T and 413T consensus
binding sites also differed from the consensus sites for v-Myb ((T/C)AAC(T/G)G) and
c-Myb (GTTGG(G/T)GG) from animals (62,63). Thus, the Myb 126T and 413T DNA
consensus binding sites, sequences which should reflect the relative affinity with which
each protein binds its selected sites, clearly differed from consensus binding sites of
other Mybs from plants and animals.
Myb 126T and 413T DNA binding specificities overlap, but are distinct from one
another
The DNA binding specificities of Mybs 126T and 413T were similarly overlapping,
yet distinct. This observation was immediately apparent from binding site selection
data, which showed that Mybs 126T and 413T selected three identical binding sites,
ACI, ACII, and ACIII in different relative proportions. The differences were confirmed
by the measured apparent binding constants (apparent Kds), which indicated that Mybs
126T and 413T bound these sequences with different relative affinities in vitro. This in
vitro data may not reflect the true affinities of Mybs 126T and 413T for ACI, ACII, and
ACIII in vivo. The relative affinities of Pt Myb 126 or Pt Myb 413 for ACI, ACII, and
ACIII in vivo could be modulated by post-translational modifications of the protein’s
DNA binding domain or transcriptional activation domain, or through interactions with
other proteins. However, we did demonstrate that Mybs 126T and 413T bound ACI,

20. 21
ACII, and ACIII specifically and reversibly, a key requirement for measuring apparent
Kds. Moreover, the apparent Kds we measured for binding of Myb 126T or 413T to an
ACII sequence agreed with the apparent Kd measured for binding of a similar plant
Myb, maize P, to a similar ACII sequence: 35 ± 2.3 nM for Myb 126T and 30.6 ± 8.3 nM
for Myb 413T vs. 28.3 ± 3 nM for maize P (64). Thus, it is likely that the apparent Kds we
measured for the Myb 126T and 413T-binding site interactions are a reasonable
approximation for these reactions in vitro. Absolute differences between Myb 126T and
413T-DNA binding affinities could not be compared, as we did not determine the
percentage of active protein in each binding assay. However, the data were suitable for
estimating the relative affinities with which Mybs 126T and 413T bound their targeted
DNA sequences. Estimated relative affinities confirmed that Myb 413T bound its
targeted DNA sequences with roughly equal affinities, whereas Myb 126T had greatest
affinity for ACI. Thus, the DNA binding specificities of Mybs 126T and 413T were
overlapping, but quantitatively different.
Differences in Myb 126T and 413T DNA binding specificities may lead to selection
of different target genes
Differences in Myb 126T and 413T DNA binding specificities were also reflected in
searches which compared the Myb 126T and 413T consensus binding sites to
experimentally-characterized promoter sequences in the Eukaryotic Promoter Database,
release 50 (EPD50). EPD50 is a specialized database of experimentally-verified promoter
sequences from the EMBL Data Library (34,35,41). We chose EPD50 for our searches
because EPD50 sequences meet rigorously-defined criteria for classification as
promoters (41). The criteria include demonstration that the transcription start site of the

21. 22
promoter has been mapped by nuclease protection and primer extension with a
precision of at least ± 5 bp and experimental characterization of the promoter as a
biologically relevant sequence which is functionally distinct from other promoters in the
database. We conducted EPD50 searches using MatInd and MatInspector (36).
Consensus binding site searches which employ MatInd-generated matrices and the
matrix-matching software MatInspector allow the researcher to detect fewer false
positive consensus binding site matches and more functional binding sites in a database
than would be detected using the BLAST algorithm with IUPAC strings (36). EPD50
searches showed that the set of EPD50 sequences which contained Myb 126T consensus
binding sites overlapped with, but was distinct from the set which contained Myb 413T
consensus binding sites. Thus, it appeared that differences in Myb 126T and 413T DNA
binding specificities might allow each protein to select different target genes.
This trend was more apparent when we analyzed gene expression patterns among
the EPD50 sequences which matched either the Myb 126T or 413T matrix. Promoters of
genes expressed during normal cell division, light regulation, hormonal regulation, or
in the endocrine system contained both Myb 126T and Myb 413T consensus binding
sites. Promoters of genes expressed during embryogenesis contained Myb 126T
consensus binding sites, but not Myb 413T binding sites. Promoters of genes expressed
in the nervous system or during viral infection contained Myb 413T consensus binding
sites, but not Myb 126T consensus binding sites. Thus, patterns of gene expression
associated with EPD50 sequences which contained Myb 126T or 413T consensus
binding sites were overlapping, but different. Thus, it appeared that differences in Myb
126T and 413T DNA binding specificities might also allow Mybs 126T and 413T to bind
promoters with different patterns of gene expression.

22. 23
Myb 126T and 413T consensus binding sites appear in experimentally-
characterized promoter sequences from plants and animals
Myb 126T and 413T consensus binding sites were detected in EPD50 sequences from
both plants and animals. Both proteins’ consensus binding sites were detected in
promoters of genes which are specific to plants, such as genes which encode monocot
seed storage proteins, enzymes involved in phenylpropanoid metabolism, or glycine-
rich cell wall proteins (data not shown). Myb 126T and 413T consensus binding sites
were also detected in promoters of genes which are specific to animals, such as genes
which encode actin, tropomysin, hepatic lipase, thyroid stimulating hormone, or
neuroendocrine peptides (data not shown). It is not certain why Myb 126T and 413T
consensus binding sites occurred in promoters of genes which are specific to animals,
as animal Mybs are not known to bind AC elements or DNA sequences which resemble
the Myb 126T and 413T consensus binding sites (62-64). Moreover, no plant-like myb
gene has ever been identified in animals (5). This raises the possibility that a functional
homologue of a plant Myb, containing only the R2 and R3 repeats of the Myb DNA
binding domain exists in animals but has yet to be identified. Alternatively, the
presence of Myb 126T and 413T consensus binding sites in promoters of animal genes
could indicate that these binding sites evolved prior to the divergence of plants and
animals. In this case, it is also possible that these plant Myb binding sites are no longer
functional in promoters of animal genes. In any case, the presence of plant Myb 126T
and 413T binding sites in promoters of genes from animals poses some interesting
evolutionary questions about how Mybs arose in plants and animals, and how their
functions diverged within each kingdom.

23. 24
Myb 126T and 413T may regulate genes in the lignin biosynthetic pathway
Myb 126T and 413T consensus binding sites were also detected in genes from the P.
taeda lignin biosynthetic pathway. Two of the P.taeda genes which contained Myb 126T
and 413T consensus binding sites, pal and 4cl, function as part of the general plant
phenylpropanoid pathway, of which lignin biosynthesis is one branch (66). It was not
surprising that Myb 126T and 413T consensus binding sites occurred in these genes, as
most of the EPD50 genes which function in the phenylpropanoid pathway also
contained Myb 126T and 413T consensus binding sites, and as other plant Mybs are
known to function in phenylpropanoid metabolism (6). However, one of the P.taeda
genes which contained Myb 126T and 413T consensus binding sites, cad, specifically
functions in lignin biosynthesis (38,66,67). Cad encodes an enzyme which catalyzes the
final step in the synthesis of lignin subunits (monolignols, 68). This is intriguing in light
of the fact that two other plant Mybs from snapdragon, Am Myb 305, and Am Myb 340
were recently found to reduce the overall lignin content of the plant when ectopically
overexpressed in transgenic tobacco (69). However, Am Myb 305 and Am Myb 340 are
not normally expressed in tissues which actively synthesize lignin, whereas Pt Mybs
126 and 413 are. Pt Mybs 126 and 413 are actively and abundantly expressed in xylem
(M. Campbell, manuscript in preparation). Thus, our study presents the first evidence
of Mybs which are actively synthesized in lignifying tissues and whose consensus
binding site sequences are present in lignin biosynthetic genes which were cloned from
the same tissues. Thus, Pt Mybs 126 and 413 may specifically regulate genes in the
lignin biosynthetic pathway.
Enzymes in the lignin biosynthetic pathway are normally coordinately expressed

24. 25
(70). If Pt Mybs 126 and 413 do regulate genes in the lignin biosynthetic pathway, the
overlapping, yet different DNA binding specificities of these two proteins could point
to a mechanism by which Pt Mybs 126 and 413 coordinately, yet differentially regulate
expression of lignin biosynthetic genes.
CONCLUSION
We have shown that Mybs 126 and 413, two DNA binding proteins which are from
the same plant tissue and which posess structurally similar DNA binding domains,
have identical DNA binding sites, yet distinct DNA binding specificities. The two
proteins appear to target an overlapping, yet distinct set of genes which are associated
with different patterns of gene expression. Thus, it appears that these two plant Myb
homologues have evolved distinct functions in part by evolving the ability to target
identical DNA binding sites differently.
ACKNOWLEDGEMENTS
We are very grateful to Ross Whetten for helpful insights he gave us throughout this
work through many personal discussions; we thank him especially for his advice on
database analyses, which saved us a great deal of time. We are also grateful to Ronald
Sederoff for providing guidance to us as members of his Forest Biotechnology Group at
North Carolina State University. We also thank the other members of this group,
including Alison Morse, for helpful discussions throughout this work, Ying-Hsuan Sun
for help with PhosphorImager analyses, and Yi Zhang and David O’Malley for helpful
discussions on statistics. Finally, we thank Chris Lombardo of UNC-Chapel Hill for
helpful discussions on apparent binding constant determinations, and Ronald Sederoff,
David O’Malley, and Allan Wenck for their very helpful comments on this manuscript.

25. 26
This work was supported by a grant from the United States Department of Energy,
Division of Energy Biosciences (DE-FG05-92ER20085, to R. Sederoff, M. Campbell, D.
O’Malley, and R. Whetten), a Patricia Roberts Harris Fellowship to S. Rodzik from the
United States Department of Education, and funding from the Forest Biotechnology
Industrial Consortium at North Carolina State University.
Figure 1. Summary of binding site selection EMSAs. (A and B) Probes from each round
of selection were combined with 35ng (Myb 126T) or 50ng (Myb 413T) of purified
protein as shown in lanes 4-9. Lane 2 contained crude protein shifted with a probe
which contained two Myb binding sites (ACI and ACII). Lanes 1 and 3 contained the
same probe alone, or shifted with boiled protein, respectively. Lanes 10 and 11
contained shifts with the round 5 probe and boiled protein or lysate from cells
transformed with empty vector, respectively.
Tables 1 and 2. DNAs recovered after five rounds of selection with Myb 126T or 413T.
Conserved regions appear in bold and were detected in 100% of the sequenced DNAs.
DNAs which contained more than one conserved region were termed “complex” and
grouped separately. Numbers to the right of each DNA identify individual clones.

26. 27
Lowercase bases indicate PCR primer annealing regions of each DNA.
Table 3. The top row lists relative positions of bases within each consensus sequence.
Columns denote the number of sequences which contained the given base in each
position. “Totally random“ indicates sequences contained no bases from the PCR
primer annealing region in the specified window. Column numbers were converted to
percentages of the total sample, and consensus sequences were assigned by the method
of Huang et al., 1996 (71): (1) "A" means A > 50%, no others > 20%; (2) "A/T" means
(A+T) > 70%, and A and T differ by less than 20%; (3) "A/t" means (A+T) > 70%, but A
> T by more than 20%; (4) "-A" means A < 10%, and each other base > 20%; (5) "N"
means none of the bases are > 50%, no two combined exceed 70%, and each is >10%.
Where data were ambiguous, the closest matching rule was applied.
Figure 2. Competition Assays. (A and B) Three selected binding sites were tested: ACI
(ACCTACC), ACII (ACCAACC) and ACIII (ACCTAAC). Full sequences of each probe
are given in (C). The AP-1 binding site (TGACTCAG) was used to test for nonspecific
binding. The molar excess of cold competitor appears above each lane. Shifts with
boiled protein, or protein prepared from cells transformed with empty vector are shown
in the last two lanes, respectively. A reaction with radiolabelled probe alone appears in
Lane 1 (B). Shifts without cold competitor appear in Lane 2 (A and B). The lower shifted
band in (B) appeared as an artifact of the probe purification process; thus it is not a
protein-DNA complex (data not shown).
Figure 3. Relative affinity assays. (A and B) Radiolabelled ACI, ACII, or ACIII probes

27. 28
(0.15ng) were incubated with increasing amounts of purified protein: 0, 10, 20, 40, 60,
80, 100, and 140ng of Myb 126T (A), or 0, 10, 20, 40, 80, 160, 240, 320, 400, and 560 ng of
Myb 413T (B). (C) Purified Myb 413T (50ng) or 126T (30ng) was incubated with 0.35ng
of radiolabelled ACI, ACII, ACIII, API probe, or with a fifth probe, C, which contained
an infrequently-selected variation of ACI (ACCCACC). Boiled Myb 126T(1B) or Myb
413T(4B) and empty vector transformant lysates (EV) were used as negative controls.
Figure 4. Measurement of apparent Kds, representative examples (A and B) Purified
Myb 126T (40ng) or 413T (60ng) was incubated with increasing concentrations of
radiolabelled probe DNA (5, 15, 30, 45, 60, 75, 90, 180, 360, 540 and 630nM for Myb
126T, and 5, 15, 30, 45, 60, 75, 90, 180, 360, and 500 nM for Myb 413T). Nonradiolabelled
probe was added to the radiolabelled probe in order to dilute its specific activity to the
required range. The lower shifted band in these gels occurred as an artifact of this
probe addition (data not shown). The signal from these bands was quantitated, but
excluded from the fraction of bound DNA as well as subtracted from the total amount
of probe in each reaction. (C and D) Saturation curves for (A) and (B), respectively.
Individual apparent Kds were determined from these curves and verified by Scatchard
plots as shown. Similar titrations were done with ACI and ACIII (data not shown). Final
apparent Kds for these titrations are given in Table 4.
Table 4. Average apparent Kds for selected Myb 126T and 413T-DNA interactions.
Table 5. Trends in gene expression among plant and animal promoters which contained
putative Myb 126T (A) or 413T (B) binding sites. Putative Myb 126T or 413T binding

28. 29
sites were identified in promoter sequences from the Eukaryotic Promoter Database,
Release 50 (EPD50). A chi-square test was used to assess whether putative Myb 126T or
413T binding sites occurred in a given set of EPD50 promoter sequences independently
of the gene expression category which was associated with those sequences. Gene
expression categories were defined using keywords from the expression fields of
promoter sequences which contained putative Myb 126T or 413T binding sites. The total
number of the 1308 EPD50 promoter sequences which matched a given category of gene
expression is listed in column 2. The total number of promoter sequences which
matched a given category of gene expression and contained at least one putative Myb
126T or 413T binding site is given in column 3. Chi-square tests of independence were
performed separately for each gene expression category, rather than between different
gene expression categories because many of the promoter sequences in the data set
were experimentally characterized as having more than one type of gene expression.
Table 6. Occurrence of putative Myb 126T and 413T binding sites in P.taeda lignin
biosynthetic genes. Sequence positions of Myb 126T or 413T matrix matches are given
relative to the transcription start site for pal and cad, and relative to the translation start
site for 4cl. Sequence orientations are designated in parentheses. The sequence of the
matrix core for Myb 413T was assigned by MatInd. Core similarities, where applicable,
and Matrix similarities were assigned by MatInspector.
REFERENCES
1. Meshi, T. and Iwabuchi, M. (1995) Plant Cell Phys., 36, 1405-1420.
2. Mitchell, P. and Tjian, R. (1989) Science, 245, 371-378.

29. 30
3. Katagiri, F. and Chua, N.-H. (1992) Trends Genet., 8, 22-27.
4. Struhl, K. (1989) Trends Biol. Sci., 14, 137-140.
5. Lipsick, J. S. (1996) Oncogene, 13, 223-235.
6. Martin, C. and Paz-Ares, J. (1997) Trends Genet., 13, 67-73.
7. Shen-Ong, G. L. C. (1990) Biochim. Biophys. Acta, 1032, 39-52.
8. Thompson, M. A. and Ramsay, R. G. (1995) BioEssays, 17, 341-350.
9. Ness, S. A. (1996) Biochim. Biophys. Acta, 1288, F123-F139.
10. Martin, C. (1996) Curr. Opin. Biotech., 7, 130-138.
11. Weston, K. (1998) Curr. Opin. Genet. Dev., 8, 76-81.
12. Frampton, J., Leutz, A., Gibson, T. J. and Graf, T. (1989) Nature, 342, 134-134.
13. Gabrielsen, O. S., Sentenac, A. and Fromageot, P. (1991) Science, 253, 1140-1143.
14. Ogata, K., Hojo, H., Aimoto, S., Nakai, T., Nakamura, H., Sarai, A., Ishii, S. and
Nishimura, Y. (1992) Proc. Natl. Acad. Sci. USA, 89, 6428-6432.
15. Ogata, K., Morikawa, S., Nakamura, H., Sekikawa, A., Inoue, T., Kanai, H., Sarai,
A., Ishii, S. and Nishimura, Y. (1994) Cell, 79, 639-648.
16. Kranz, H., Scholz, K. and Weisshaar, B. (2000) Plant J., 21, 231-235.
17. England, B. P., Admon, A. and Tjian, R. (1992) Proc. Natl. Acad. Sci. USA, 89, 683-
687.
18. Baranowskij, N., Frohberg, C., Prat, S. and Willmitzer, L. (1994) EMBO J., 13, 5383-
5392.
19. Silva, O. D. E., Klein, L., Schmelzer, E., Trezzini, G. F. and Hahlbrock, K. (1993)
Plant J., 4, 125-135.
20. Lugert, T. and Werr, W. (1994) Plant Mol. Biol., 25, 493-506.
21. Anton, I. A. and Frampton, J. (1988) Nature, 336, 719-719.

30. 31
22. Saikumar, P., Murali, R. and Reddy, E. P. (1990) Proc. Natl. Acad. Sci. USA, 87, 8452-
8456.
23. Grasser, F. A., LaMontagne, K., Whittaker, L., Stohr, S. and Lipsick, J. S. (1992)
Oncogene, 7, 1005-1009.
24. Guehmann, S., Vorbrueggen, G., Kalkbrenner, F. and Moelling, K. (1992) Nucleic
Acids Res., 20, 2279-2286.
25. Myrset, A. H., Bostad, A., Jamin, N., Lirsac, P. N., Toma, F. and Gabrielsen, O. S.
(1993) EMBO J., 12, 4625-4633.
26. Romero, I., Fuertes, A., Benito, M. J., Malpica, J. M., Leyva, A. and Paz-Ares, J.
(1998) Plant J., 14, 273-284.
27. Frampton, J., Ramqvist, T. and Graf, T. (1996) Genes Dev., 10, 2720-2731.
28. Taylor, D., Badiani, P. and Weston, K. (1996) Genes Dev., 10, 2732-2744.
29. Hatton, D., Sablowski, R., Yung, M.-H., Smith, C., Schuch, W. and Bevan, M. (1995)
Plant J., 7, 859-876.
30. Leyva, A., Liang, X., Pintor-Toro, J. A., Dixon, R. A. and Lamb, C. J. (1992) Plant
Cell, 4, 263-271.
31. Garcia, A., LaMontagne, K., Reavis, D., Stober-Grässer, U. and Lipsick, J. S. (1991)
Oncogene, 6, 265-273.
32. Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory
Manual, Second Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
New York.
33. Pollock, R. and Treisman, R. (1990) Nucleic Acids Res., 18, 6197-6204.

31. 32
34. Cavin, R., Junier, T. and Bucher, P. (1997) The Eukaryotic Promoter Database
(EPD), Release 50, Swiss Institute for Experimental Cancer Research, 1066
Epalinges s/Lausanne, Switzerland.
35. Perier, R. C., Praz, V., Junier, T., Bonnard, C. and Bucher, P. (2000) Nucleic Acids
Res., 28, 302-303.
36. Quandt, K., Frech, K., Karas, H., Wingender, E. and Werner, T. (1995) Nucleic Acids
Res., 23, 4878-4884.
37. Whetten, R. W. and Sederoff, R. R. (1992) Plant Physiol., 98, 380-386.
38. O'Malley, D. M., Porter, S. and Sederoff, R. R. (1992) Plant Physiol., 98, 1364-1371.
39. Voo, K. S., Whetten, R. W., O'Malley, D. M. and Sederoff, R. R. (1995) Plant Physiol.,
108, 85-97.
40. MacKay, J. J. (1996) A mutation in lignin biosynthesis in loblolly pine: Genetic,
molecular, and biochemical analysis. Genetics, North Carolina State University,
Raleigh, North Carolina.
41. Bucher, P. (1999) Eukaryotic Promoter Database User Manual, Bio-informatique,
Institut Suisse de Recherches Experimentales sur le Cancer, Switzerland.
42. Lois, R., Dietrich, A., Hahlbrock, K. and Schulz, W. (1989) EMBO J., 8, 1641-1648.
43. Schulze-Lefert, P., Dangl, J. L., Becker-Andre, M., Hahlbrock, K. and Schulz, W.
(1989) EMBO J., 8, 651-656.
44. Loake, G. J., Faktor, O., Lamb, C. J. and Dixon, R. (1992) Proc. Natl. Acad. Sci. USA,
89, 9230-9234.
45. Logemann, E., Parniske, M. and Hahlbrock, K. (1995) Proc. Natl. Acad. Sci. USA, 92,
5905-5909.
46. Hatton, D., Smith, C. and Bevan, M. (1996) Plant Mol. Biol., 31, 393-397.

32. 33
47. Sainz, M. B., Grotewold, E. and Chandler, V. L. (1997) Plant Cell, 9, 611-625.
48. Kobayashi, H., Oikawa, Y., Koiwa, H. and Yamamura, S. (1998) Plant Sci., 131, 173-
180.
49. Gray-Mitsumune, M., Molitor, E. K., Cukovic, D., Carlson, J. E. and Douglas, C. J.
(1999) Plant Mol. Biol., 39, 657-669.
50. Neustaedter, D. A., Lee, S. P. and Douglas, C. J. (1999) Plant J., 18, 77-88.
51. Sablowski, R. W. M., Baulcombe, D. C. and Bevan, M. (1995) Proc. Natl. Acad. Sci.
USA, 92, 6901-6905.
52. Moyano, E., Martinez-Garcia, J. F. and Martin, C. (1996) Plant Cell, 8, 1519-1532.
53. Grotewold, E., Drummond, B. J., Bowen, B. and Peterson, T. (1994) Cell, 76, 543-
553.
54. Li, S. F. and Parish, R. W. (1995) Plant J., 8, 963-972.
55. Uimari, A. and Strommer, J. (1997) Plant J., 12, 1273-1284.
56. Passmore, S., Elble, R. and Tye, B. K. (1989) Genes & Dev., 3, 921-935.
57. Hayes, T. E., Sengupta, P. and Cochran, B. H. (1988) Genes & Dev., 2, 1713-1722.
58. Wynne, J. and Treisman, R. (1992) Nucleic Acids Res., 20, 3297-3303.
59. Grotewold, E., Athma, P. and Peterson, T. (1991) Proc. Natl. Acad. Sci. USA, 88,
4587-4591.
60. Cone, K. C., Cocciolone, S. M., Burr, F. A. and Burr, B. (1993) Plant Cell, 5, 1795-
1805.
61. Solano, R., Nieto, C. and Paz-Ares, J. (1995) Plant J., 8, 673-682.
62. Biedenkapp, H., Borgmeyer, U., Sippel, A. E. and Klempnauer, K.-H. (1988) Nature,
335, 835-837.
63. Howe, K. M. and Watson, R. J. (1991) Nucleic Acids Res., 19, 3913-3919.

33. 34
64. Williams, C. E. and Grotewold, E. (1997) J. Biol. Chem., 272, 563-571.
65. Douglas, C. J. (1996) Trends Plant Sci., 1, 171-177.
66. MacKay, J. J., O'Malley, D. M., Presnell, T., Booker, F. L., Campbell, M. M.,
Whetten, R. W. and Sederoff, R. R. (1997) Proc. Natl. Acad. Sci. USA, 94, 8255-8260.
67. Ralph, J., MacKay, J. J., Hatfield, R. D., O'Malley, D. M., Whetten, R. W. and
Sederoff, R. R. (1997) Science, 277, 235-239.
68. Whetten, R. W., MacKay, J. J. and Sederoff, R. R. (1998) Annu. Rev. Plant Physiol.
Plant Mol. Biol., 49, 585-609.
69. Tamagnone, L., Merida, A., Parr, A., Mackay, S., Culianez-Macia, F. A., Roberts, K.
and Martin, C. (1998) Plant Cell, 10, 135-154.
70. Fukuda, H. (1996) Annu. Rev. Plant Physiol. Plant Mol. Biol., 47, 299-325.
71. Huang, H., Tudor, M., Su, T., Zhang, Y., Hu, Y. and Ma, H. (1996) Plant Cell,88,
81-94.