2. 2
Introduction
Synechocystis sp. PCC 6803 is a cyanobacterium with two significant features relevant to this experiment.
It has natural transformability meaning that it is readily available for the uptake of foreign DNA, in this
case the pKCP43 plasmid. However, only a single genome copy out of the possible 6-12 copies may be
transformed. The pKCP43 plasmid confers a kanamycin resistance gene which enables selection of
transformed cells. After a series of gradual but steep additions of kanamycin to the growth medium,
eventually the transformed Synechocystis will be completely mutant in all genome copies.1
Additionally,
Synechocystis has the gene psbC which encodes for CP43, a chlorophyll-binding protein responsible for
photosystem II. This enables the bacterium to grow without an added carbon source because it uses light
for energy to produce sugars from carbon dioxide and water.1
The experiment is designed around this
concept.
Two concurrent experiments are eventually integrated. The first part (A) introduces a mutation to the
psbC gene via double homologous recombination with the pKCP43 plasmid. The kanamycin resistance
gene disrupts the psbC gene. This change results in two important consequences, first the mutation
inhibits photosystem II so that the transformed Synechocystis cells need added sugar to survive, second
the cells are resistant to the antibiotic kanamycin. These two factors help to select transformed cells.
The second part (B) of the experiment entails PCR amplifying and cloning part of the wild type psbC
gene into the pUC19 plasmid. E. coli is transformed with the recombinant plasmid because it synthesizes
beta-galactosidase which cleaves lactose. This detail enables identification and selection with a blue-
white screening system, because transformed E. coli. cannot catabolize the color-inducing substrate X-gal
in the medium. The isolated plasmid is then sequenced and eventually used to transform the mutant
Synechocystis bacteria from the first part of the experiment. This restores the photosystem II functionality.
At the end of the experiment, the re-transformed mutant Synechocystis is plated on a medium without
glucose and is observed to confirm the occurrence of photosynthesis. Growth indicates that the mutant
cells have been transformed with the psbC gene.
Materials and Methods
Transformation of wild-type Synechocystis
Part A of experiment II consists of transforming Synechocystis with the pKCP43 plasmid and selecting
for transformants by gradually increasing the antibiotic concentration of the growth medium. First, 2 mcL
of pKCP43 plasmid was added to a prepared culture of Synechocystis sp. PCC 6803 in growth medium.
The mixture was incubated at room temperature for 30 minutes. The suspension was then spread onto a
filter on a BG–11+5 mM glucose agar plate in a vertical flow hood. The plate was incubated at 30°C
under light. It was then transferred to a plate containing glucose and 5 mcg/mL kanamycin. After two
weeks, the filter with the cell culture was transferred to a plate with a higher antibiotic concentration (BG-
11+glucose+kanamycin 20 mcg/mL) in sterile flow hood. The plate was again incubated at 30°C in the
light. The colonies were transferred to a BG-11+glucose+kanamycin 50 mcg/mL plate after another two
weeks, then to BG-11+glucose+kanamycin 75 mcg/mL after two more weeks, in the same fashion. After
yet another two weeks, the colonies were transferred to BG-11+glucose+kanamycin 100 mcg/mL by
making zigzag streaks in each of four quadrants of the new plate. Sterile loops were used to continue one
quadrant’s streak into the next quadrant. Consistent with preceding transfers, the plate was incubated at
30°C in the light.
3. 3
Analysis of Synechocystis wild-type and psbC-transformant
Part A of the experiment was continued with genomic DNA extraction. A loopful of cells from the psbC-
mutant plate, as well as a loopful from a plate with wild type, were each mixed with 200 mcL of TE. 150
mcL glass beads and 150 mcL more TE were added. They were blended and settled, and the supernatant
was removed. An additional 100 mcL TE was added, mixed and settled. Supernatant was again removed.
The samples were centrifuged, and the supernatant from these was removed. 250 mcL of a phenol:
chloroform: isoamyl alcohol concoction was added to each sample, and they were vortexed and
centrifuged. The upper layers of the samples were removed, and 125 mcL of 7.5 M ammonium acetate
and 325 mcL ethanol were added to them and mixed. The samples were centrifuged and the supernatant
was discarded. The pellets were washed with 400 mcL 70% ethanol. Supernatant was again discarded and
the pellet was dried in the Speed Vac for 10 minutes. The pellets were resuspended in 20 mcL of TE.
2 mcL of each sample was added to 50 mcL of a PCR reaction mixture of buffers, dNTPs, Taq
Polymerase, and primers that flank the interruption region of the psbC gene. The entire mixtures were run
through the Thermal Cycler as follows:
1. 94°C x 3 min
2. 94°C x 1 min
3. 58°C x 1 min
4. 72°C x 1 min
Repeat steps 2-4 x 30 cycles
5. 4°C soak
10 mcL of each PCR product was mixed with 2 mcL of loading dye and loaded into wells 2 and 3 of an
agarose gel. 120 volts were run through the gel electrophoresis for 30 minutes. The gel was viewed under
u.v. light and photographed.
PCR and Gel Electrophoresis of wild-type Synechocystis psbC gene
Part B of the experiment consists of amplifying the wild-type psbC gene and using it to transform the
mutant Synechocystis from part A, restoring it to its natural state. First, 2 mcL of Synechocystis genomic
DNA was added to a prepared PCR reaction mix, and the samples went through the 4 PCR cycles and a
soak cycle.
5 mcL of the PCR product was added to 1 mcL of loading dye. This mixture was placed into a well and
ran against 4 mcL of the kb DNA ladder at 70 volts for 40 to 50 minutes. The ladder was viewed and
photographed under the Alphamager UV light. The PCR product was purified using the QIAquick PCR
Purification Kit. To bind the DNA, Buffer PBI was added to the PCR sample at a 5:1 ratio and
centrifuged in a QIAquick column for 30 to 60 seconds. The mixture was drained and 0.75 mL Buffer PE
was added to wash the sample. It was again centrifuged and drained. After a third centrifuge, a pure DNA
fragment was eluted by adding 30 mcL Buffer EB and centrifuging.
Restriction Digestion of psbC gene and pUC19 plasmid
4 mcL of pUC19 plasmid was mixed with a total 16 mcL of ddH20, NEB CutSmart 10X buffer mix, and
the SmaI and HindIII-HF restriction enzymes. The vector plasmid digest sample was incubated at room
temperature for an hour, then at 37°C for another hour.
4. 4
15 mcL of the PCR product of psbC gene was mixed with 5 mcL digest mix (also containing ddH20,
NEB buffer mix and ScaI-HF/HindIII-HF restriction enzymes). This sample was incubated at 37°C for an
hour and a half.
Both digestion reaction mixes were then incubated at 70°C for 20 minutes to inactivate the restriction
enzymes. Then, 4 mcL of the pUC19 digestion mix was added to 8.75 mcL of the PCR digestion mix, 1.5
mcL of ligase buffer and 0.75 mcL of ligase enzyme. The sample was mixed and incubated at room
temperature for 2 hours.
Transforming E. coli with recombinant plasmid pUC19
15 mcL of the ligation mixture was carefully mixed with 50 mcL of NEB 5-alpha competent E. coli cells.
The sample was iced for 30 minutes, heat shocked at 42°C for 30 seconds, then iced again for 5 minutes.
1 mL of SOC was added and the sample was rotated at 37°C for an hour. 450 mcL of the transformation
cell mixture was spread with a sterilized glass spreader onto an LB-AMP-Xgal-IPTG plate. The plates
were stored inverted at 37°C for one day. Two white colonies were picked and put in 5 mL of LB-Amp
liquid medium and incubated at 37°C for another day.
Preparing the recombinant plasmid pUC19
1.4 mL of the E. coli cell culture was centrifuged for one minute and the supernatant discarded. The
sample was microfuged for 5 seconds and the rest of the supernatant was removed. The remaining pellet
was resuspended in 50 mcL sterile water, and 300 mcL of NS solution (0.5% SDS and 0.1M NaOH) was
added. The sample was gently mixed and incubated at room temperature for 90 seconds. 200 mcL of
7.5M ammonium acetate was mixed in and the sample was put on ice for 3 minutes. The sample tube was
centrifuged for 5 minutes and the supernatant was added to 330 mcL isopropanol. This mixture was
centrifuged for 7 minutes and the supernatant was discarded. The remaining pellet was washed with 0.5
mL of 70% ethanol. It was then centrifuged for 2 minutes and decanted. The pellet was dried in a heat
block at 50°C for 5 minutes. The pellet was resuspended in 30 mcL water, and 1 mcL RNase was added.
The tube was incubated at 37°C for 15 minutes.
The sample was mixed with 15 mcL of 7.5M ammonium acetate and 45 mcL isopropanol. The mixture
was iced for 3 minutes and centrifuged for 5 minutes. The supernatant was discarded and the pellet was
washed with 0.5 mL of 70% ethanol. The tube was centrifuged for 2 minutes and decanted. Again, the
pellet was heat-blocked for 5 minutes. The DNA pellet was resuspended with 20 mcL of sterile water.
Restriction digest and electrophoresis of recombinant plasmid
5 mcL of the sample was added to 15 mcL of an enzyme premix containing ddH2O, NEB 10X CutSmart
Buffer, HindIII-HF, and EcoRI-HF. The mixture was incubated at 37°C for an hour. 2 mcL of loading dye
was added and the sample was pipeted into lane 5 of an agarose gel. The gel was electrophoresed at 80
volts for 30 minutes, then photographed under u.v. light.
Transform psbC- Synechocystis with recombinant plasmid and wild-type DNA
A liquid culture of psbC- Synechocystis from part A was spun down and resuspended in 1/50 of the
original culture volume of BG – 11+ glucose. 200 mcL was transferred into 4 different tubes. The first
tube served as a negative control and no DNA was added. 1 mcL wild-type Synechocystis DNA was
added to a second tube, 1 mcL psbC recombinant plasmid DNA from part B was added to a third, and 1
mcL psbC- Synechocystis DNA was added to the fourth tube. After 30 minutes, the cells were plated on
BG – 11 agar plates, with no added glucose. The next week plates were observed and photographed.
5. 5
Results
Transformation of wild-type Synechocystis
In part A, observations of transformed Synechocystis colonies were made over time (about every two
weeks). Figures 1 through 5 capture images of the surviving colonies from a gradual increase in the
kanamycin antibiotic. There is considerable growth in each phase.
Figure 1.Week 3 Part A. Synechocystis
transformation plate: green colonies of
cyanobacteria are observed. The plate contains
BG – 11+glucose growth medium with 5
mcg/mL kanamycin.
Figure 2.Week 6 Part A. Synechocystis
transformation plate: individual colonies of
cyanobacteria are observed. The plate contains
BG – 11+glucose growth medium with 20
mcg/mL kanamycin.
Figure 3.Week 8 Part A. Synechocystis
transformation plate: individual colonies of
cyanobacteria are observed. The plate contains
BG – 11+glucose growth medium with 50
mcg/mL kanamycin.
Figure 4.Week 10 Part A. Synechocystis
transformation plate: individual colonies of
cyanobacteria are observed. The plate contains
BG – 11+glucose growth medium with 75
mcg/mL kanamycin.
6. 6
Analysis of Synechocystis wild-type and psbC-transformant
Samples were placed in lanes 2 and 3 of the agarose gel. Lane 2 has the wild-type DNA and lane 3 has the
psbC- DNA. The sample washed out of lane 3 and there is no visible band because of this misstep. Both
samples should have displayed a band at 586, and the sample in lane 3 should have a band at about 1500.
PCR and Gel Electrophoresis of wild-type Synechocystis psbC gene
In part B, PCR and gel electrophoresis of the psbC gene were successful. The band above the arrow
indicated the size just above 2 kilobase pairs (see figure 7 below).
Figure 7. Week 3 Part B. Gel
electrophoresis picture for the PCR of
part of the wild-type psbC.
CP1 forward primer (662) and CP2
reverse primer (2819) = 2157 bp.
Figure 5. Week 12 Part A.
Synechocystis transformation plate:
individual colonies of cyanobacteria
are observed. The plate contains BG –
11+glucose growth medium with 100
mcg/mL kanamycin.
Figure 6. Week 14 Part A. Gel
electrophoresis of PCR products from
DNA of wild type and psbC-
transformant of Synechocystis.
Sample is in lane two under red arrow.
7. 7
Transforming E. coli with Recombinant plasmid pUC19
Many E. coli cells were successfully transformed with the recombinant pUC19 plasmid. Both blue and
white colonies grew on the LB-AMP-Xgal-IPTG medium plate (see figure 8 below). White colonies were
picked after a week and cultured.
Gel Electrophoresis of Recombinant pUC19 Plasmid
The purified recombinant pUC19 plasmid was isolated from the culture. When the plasmid was digested
with HindIII and EcoRI, it left the cloned 1544 base pair fragment from the psbC gene plus another 16
base pairs to the EcoRI restriction site (see figure 13 in the discussion section). The remaining section of
the HindIII/EcoRI digestion should be about 1560 base pairs long. Results confirmed the DNA segment
size. The digest sample was electrophoresed and photographed under UV light (see figure 9 below). The
ladder in gel 1 is not visible, so the picture of gel 2 is shown for comparison. The sample in lane 5 of gel
1 shows a band at about 1.5 kb.
Figure 8. Week 9 Part B. LB-AMP-Xgal-
IPTG plate with many blue and white
colonies, representing untransformed
and transformed E. coli cells.
Figure 9. Comparison 1
Kb ladder and gel
electrophoresis pictures
in Alphalmager of
recombinant plasmids.
Arrow points to sample
in gel 1, lane 5. Ladders
are in first lanes of the
two gels.
Gel 1 Gel 2
8. 8
Transform psbC- Synechocystis with recombinant plasmid and wild-type DNA
There are cells in each of the four quadrants, however quandrant 3 has the greatest concentration of cells.
Quandrant 1 is the negative control, with no added DNA; quandrant 2 has wild-type Synechocystis DNA;
quandrant 3 has psbC recombinant plasmid DNA; and quadrant 4 has psbC- Synechocystis DNA.
Discussion
Transformation of wild-type Synechocystis
In part A of the experiment, Synechocystis was transformed by double-homologous recombination with
the pKCP43 plasmid. The plasmid has a kanamycin resistance gene disrupting part of the psbC gene.
Figure 1 shows growth of Synechocystis in week 3 (1 week after transformation). The BG – 11+glucose
plate provided the carbon source for the transformed Synechocystis which no longer encodes the protein
for photosystem II and cannot grow photoautotrophically. Figures 1 through 5 show growth of
Synechocystis over time, with a gradual increase in the kanamycin antibiotic. The gradual increase in
antibiotic concentration allows for only the transformed Synechocystis with the resistance to kanamycin to
grow. Eventually, the surviving Synechocystis cells are fully mutant in every genome copy.
Analysis of Synechocystis wild-type and psbC-transformant
Using the Cyanobase and NEBCutter toolkits, the PCR primers used were found to flank a 586 nucleotide
sequence (See figure 11 below), so both the wild-type and psbC- PCR samples should have bands at that
size. Also, because the primers flank the interruption region of the psbC gene, the psbC- sample should
also have an additional band at about 1500 base pairs.
Figure 10. Week 14. Parts A and B.
Testing restoration of
photoautotrophic phenotype in
transformed psbC- mutant.
9. 9
PCR and Gel Electrophoresis of wild-type Synechocystis psbC gene
In part B of the experiment, a section of the psbC gene was PCR amplified and used to transform the
mutant Synechocystis back to its original state at the end. Figure 7 is the gel electrophoresis picture of part
of the wild-type psbC gene. Polymerase chain reaction, PCR, was conducted to amplify the sequence of
psbC between 662 and 2819 base pairs by using CP1 and CP2 primers, making millions or billions of
copies of this segment. The PCR product was then purified to remove unused primers and excess dNTPs.
After PCR, the amplified psbC segment was separated from the rest of the DNA by gel electrophoresis.
Gel electrophoresis separates DNA fragments based on size and charge. An electric field is applied to the
gel, and the negatively charged fragments migrate, with shorter ones moving faster and farther than
longer ones. In figure 7, there is a faint band in column 2. This band indicates a segment size of just over
2 kb (kilobase pairs), which was to be expected with the primers used (CP1 forward primer at 662 and
CP2 reverse primer at 2819 produces 2157 base pairs).
Restriction Digestion of psbC gene and pUC19 plasmid
The psbC gene PCR product was restricted with HindIII and ScaI restriction enzymes (flanking the ends
of part of the psbC gene). It was cloned into pUC19 through ligation with sticky-ends of HindIII on one
end and blunt ends of ScaI and SmaI on the other end. The pUC19 plasmid was digested with HindIII and
SmaI. These are restriction enzymes in the polylinker cloning site that overlaps with the lacZ gene, which
codes for a protein that catabolizes lactose. So PCR fragments successfully cloned into the polylinker
disrupted lacZ.
The sizes of the bands in the gel electrophoresis could be predicted by analyzing the restriction enzymes
used in the reaction mix. The Synechocystis psbC gene was cut with HindIII and ScaI. According to
NEBCutter, ScaI cuts at 468 and HindIII cuts at 2012 on the psbC gene (see figure 12)2
. This digestion
leaves a 1544 base pair length segment. pUC19 was restricted with SmaI and HindIII, cutting at 412 and
447 on the plasmid respectively. The psbC gene fragment was cloned into pUC19 when blunt ends of
ScaI and SmaI were ligated, as were the sticky ends of HindIII (see figure 13 below).
Figure 11. Results from NEBCutter2
. Using the Cyanobase and NEBCutter toolkits, primers were found
to flank a 586 nucleotide sequence.
10. 10
Transforming E. coli with Recombinant plasmid pUC19
The recombinant pUC19 plasmids were then used to transform E. coli. Transformed cells were selected
using the “blue-white” screening procedure. The cells with intact pUC19 effectively catabolized the X-gal
in the medium and colonies turned blue, whereas the transformed cells had the recombinant plasmid with
a disrupted lacZ gene and the colonies stayed white. White colonies were then chosen with this “blue-
white” screening procedure because they contained part of the psbC gene (see figure 8). An alkaline lysis
plasmid prep and reprecipitation were performed to isolate the DNA for sequencing. A high-quality
purified sample is important to the success of automated sequencing reactions.
Restriction digestion and electrophoresis of recombinant plasmid
When the isolated recombinant plasmid was digested with EcoRI and HindIII, the resulting fragment was
about 1560 base pairs. This includes the 1544 base pairs inserted from the psbC gene during the previous
digestion (see figure 12), plus a few more base pairs to the EcoRI site (see figure 13 below).
Figure 13. pUC19 plasmid
polylinker site where psbC
gene fragment is cloned
into. Restriction enzyme
sites and resulting fragment
sizes from digestion are
noted. Polylinker site map is
from the lab protocol.
Figure 12. Results from NEBCutter2
. With the forward primer, 5' GTTGGATCATCAGTGTCAACAACATGG 3'
and reverse primer 5' GCTACCTAAACAGAGTATCTAACG 3', PCR amplified a psbC gene segment 2158 bp
long. The CyanoBase toolkit calculated the DNA sequence based on the primers3
. The sequence was then
input into the NEBCutter toolkit which mapped it out with corresponding restriction enzymes sites. The
ScaI and HindII enzymes cut at 468 and 2012 respectively, creating a fragment 1544 bp long.
11. 11
Transform psbC- Synechocystis with recombinant plasmid and wild-type DNA
Parts A and B of the semester-long experiment merge together in this last section. The purpose is to
observe if the psbC- Synechocystis cells become re-transformed, and regain their ability to grow
autotrophically. Since the final plate contained no glucose, any surviving cells would have the psbC gene
that encodes for CP43, a chlorophyll-binding protein that enables photosystem II functionality.
Conversely, there was growth in the negative control sample with no added DNA to complement the
psbC- mutation. This was unexpected because in the psbC- mutant, part of the psbC gene had been
interrupted by a kanamycin resistance gene. A series of steep increases of kanamycin in the growth
medium helped to segregate mutants. Nevertheless, Synechocystis has multiple copies of the genome in its
cells, and if there was not a complete segregation then there would be an existing copy that carries the
wild-type psbC gene. This would allow the cells to grow on a medium without glucose. Because of this
reason, there was cell growth in all four quandrants, including the negative control section.
The most growth occurred in the third quandrant, which has the psbC recombinant plasmid DNA added.
This makes sense, because the recombinant plasmid has the psbC gene re-inserted into pUC19. The psbC
gene is complementary to the mutant, and restores the cell’s ability to live without glucose in the medium.
Synechocystis cells were directly observed to lose their photosynthetic capabilities and regain them by
systematically disrupting the psbC gene and reintroducing it through genetic recombination methods.
References
1. Shen, G., Vermaas W. (1994) Chlorophyll in a Synechocystis sp. PCC 6803 Mutant without
Photosystem I and Photosystem II Core Complexes. The Journal of Biological Chemistry 269(19), 13904-
13910.
2. NEBcutter V2.0. New England Biolabs Inc. Retrieved from http://nc2.neb.com/NEBcutter2.
3. CyanoBase Genome Annotation Database. Retrieved from http://genome.kazusa.or.jp/cyanobase.
