The document discusses key topics in developmental biology, including the three fundamental processes of development (cell division, cell differentiation, and morphogenesis), the role of totipotency and changes from blastula to gastrula. It also covers homeotic genes, examining their role in determining appendage identity in fruit flies and the evolution of form in segmented animals. Finally, it mentions morphogenesis in plants and organ identity genes in flower development.

1. Molecular and Organismal
Development

2. Topics in Development
• 1. totipotency: development depends on selective expression of
the whole genome present in every cell.
• 2. blastula to gastrula: comparative analysis yields insights into
the general nature of development
• 3. the three fundamental processes:
– cell division (differential rates of division are critical,
programmed cell death is significant)
– cell differentiation (changes in integration and shape are
critical; targeting cells with signals is a critical part of the
process)
– morphogenesis of tissues and organs (includes defining the
individual’s polarities, dividing the organism into segments,
and – in animals -- migration of cells in tissue origin)

3. Figure 21.2 Some key stages of development in animals and plants

4. Topics in Development
• 1. totipotency: development depends on selective expression of
the whole genome present in every cell.
• 2. blastula to gastrula: comparative analysis yields insights into
the general nature of development
• 3. the three fundamental processes:
– cell division (differential rates of division are critical,
programmed cell death is significant)
– cell differentiation (changes in integration and shape are
critical; targeting cells with signals is a critical part of the
process)
– morphogenesis of tissues and organs (includes defining the
individual’s polarities, dividing the organism into segments,
and – in animals -- migration of cells in tissue origin)

5. Figure 47.6 Cleavage in an echinoderm (sea urchin) embryo

6. Figure 47.9 Sea urchin gastrulation (Layer 3)

7. Figure 47.8x Cleavage in a frog embryo

8. Figure 47.8d Cross section of a frog blastula

9. Figure 47.10 Gastrulation in a frog embryo

10. Figure 47.12
Gastrulation in a
frog embryo

11. Figure 47.12 Cleavage, gastrulation, and early organogenesis in a chick embryo

12. The cells in the three germ layers have
defined fates in the adult:

13. Topics in Development
• 1. totipotency: development depends on selective expression of
the whole genome present in every cell.
• 2. blastula to gastrula: comparative analysis yields insights into
the general nature of development
• 3. the three fundamental processes:
– cell division (differential rates of division are critical,
programmed cell death is significant)
– cell differentiation (changes in integration and shape are
critical; targeting cells with signals is a critical part of the
process)
– morphogenesis of tissues and organs (includes defining the
individual’s polarities, dividing the organism into segments,
and – in animals -- migration of cells in tissue origin)

14. Figure 21.4 Cell lineage in C. elegans

15. C. elegans cell targeting

16. C. elegans cell targeting

17. Figure 47.14 Organogenesis in a frog embryo

18. Figure 47.16 Change in cellular shape during morphogenesis

19. Apoptosis in development

20. Topics in Development
4. Homeotic genes
a. the determination of appendage identity
on fruitfly segments
b. the evolution of form in segmented
animals
4. Morphogenesis in Plants
5. Organ identity genes in flower development

21. Figure 21.11 Key developmental events in the life cycle of Drosophila

22. Figure 21.12 The effect of the bicoid gene, a maternal effect (egg-polarity) gene
Drosophila

23. Figure 21.13 Segmentation genes in Drosophila

24. Figure 21.13 Homeotic mutations and abnormal pattern
formation in Drosophila

25. The homeodomain - 60 amino acids of the homeotic
gene product that remain very similar in all proteins
made by homeotic genes.
Homeotic genes:the DNA sequence of the gene (blue)
contains a 180 bp sequence—the homeobox—(red) that
is highly conserved.

26. Figure 17.7 The initiation of transcription at a eukaryotic promoter

27. control of transcription in
C.elegans lin-3
|
tctctccctattcaatgcacctgtgtattttatgctggttttttcttgtgaccctgaa
aactgtacacacaggtgttcttaccaatgtctcaggcatttttggaaaagta
atattaagaaaattatacatattttcttgaatacgaaaaatttaaATGTTC
GGTAAATCGATTCCTGAACGACTTCTAGTCGCATTT
HLH-2 binding site
NHR binding site
EXON is in uppercase letters.

28. Figure 21.14 Homologous genes that affect pattern formation in a fruit fly and a
mouse

29. Topics in Development
4. Homeotic genes
a. the determination of appendage identity
on fruitfly segments
b. the evolution of form in segmented
animals
4. Morphogenesis in Plants
5. Organ identity genes in flower development

30. Topics in Development
4. Homeotic genes
a. the determination of appendage identity
on fruitfly segments
b. the evolution of form in segmented
animals
4. Morphogenesis in Plants
5. Organ identity genes in flower development

31. Topics in Development
4. Homeotic genes
a. the determination of appendage identity
on fruitfly segments
b. the evolution of form in segmented
animals
4. Morphogenesis in Plants
5. Organ identity genes in flower development