Induction of genetic varibilty
1.Mutation
2.recombination
INTRODUCTION
 The term mutation refers to a heritable change in
the genetic material
 Mutations provide allelic variatio...
DNA
Maintenance
 Mutation rate are
extremely low
 1 mutation out of 109
nucleotides per
generation
 Mutations can be divided into three main types
 1. Chromosome mutations
 Changes in chromosome structure
 2. Genome m...
 A point mutation is a change in a single base pair
 It involves a base substitution
Gene Mutations Change the DNA
Seque...
 Mutations may also involve the addition or deletion
of short sequences of DNA
Gene Mutations Change the DNA
Sequence
5’ ...
 Mutations in the coding sequence of a structural
gene can have various effects on the polypeptide
 Silent mutations are...
 Mutations in the coding sequence of a structural
gene can have various effects on the polypeptide
Gene Mutations Can Alt...
 In a natural population, the wild-type is the most
common genotype (may be encoded by a
dominant or recessive allele)
 ...
 Mutations can also be described based on their
effects on the wild-type phenotype
 When a mutation alters an organism’s...
 A second mutation will sometimes affect the
phenotypic expression of another
 These second-site mutations are called
su...
 Several human genetic diseases are caused by an
unusual form of mutation called trinucleotide repeat
expansion (TNRE)
 ...
 Certain regions of the chromosome contain
trinucleotide sequences repeated in tandem
 In normal individuals, these sequ...
 In some cases, the expansion is within the coding
sequence of the gene
 Typically the trinucleotide expansion is CAG (g...
 A chromosomal rearrangement may affect a gene
because the break occurred in the gene itself
 A gene may be left intact,...
Figure 16.2
Regulatory sequences
are often
bidirectional
 Geneticists classify the animal cells into two types
 Germ-line cells

Cells that give rise to gametes such as eggs an...
Figure 16.4
Therefore, the
mutation can be
passed on to future
generations
The size of the patch
will depend on the
timing...
 Mutations can occur spontaneously or be induced
 Spontaneous mutations
 Result from abnormalities in cellular/biologic...
 Are mutations spontaneous occurrences or
causally related to environmental conditions?
 This is a question that biologi...
 These two opposing theories of the 19th century
were tested in bacteria in the 1940s and 1950s
 Salvadore Luria and Max...
 Joshua and Ester Lederberg were also interested in
the relation between mutations and the environment
 At that time (19...
Figure 16.7 Replica plating
 A few tonr
colonies were
observed at the same
location on both plates!!!
 This indicates th...
 Spontaneous mutations can arise by three types
of chemical changes
 1. Depurination
 2. Deamination
 3. Tautomeric sh...
 Depurination involves the removal of a purine
(guanine or adenine) from the DNA
 The covalent bond between deoxyribose ...
Spontaneous depurinationFigure 16.8
Three out of four (A, T and G)
are the incorrect nucleotide
There’s a 75% chance
of a ...
 Deamination involves the removal of an amino
group from the cytosine base
 The other bases are not readily deaminated
F...
 Deamination of 5-methyl cytosine can also occur
 Thymine is a normal constituent of DNA
 This poses a problem for repa...
 A tautomeric shift involves a temporary change in
base structure (Figure 16.10a)
 The common, stable form of thymine an...
Figure 16.10
RareCommon
Figure 16.10
16-42
Figure 16.10
Temporary
tautomeric shift
Shifted back to
its normal fom
 An enormous array of agents can act as mutagens
to permanently alter the structure of DNA
 The public is concerned abou...
Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display
16-53
 Chemical mutagens come into three main types
 1. Base modifiers
 2. Intercalating agents
 3. Base analogues
Mutagens ...
 Base modifiers covalently modify the structure of
a nucleotide
 For example, nitrous acid, replaces amino groups with
k...
Mispairing of modified basesFigure 16.13
These mispairings
create mutations in the
newly replicated strand
 Intercalating agents contain flat planar structures
that intercalate themselves into the double helix
 This distorts th...
 Base analogues become incorporated into
daughter strands during DNA replication
 For example, 5-bromouracil is a thymin...
Figure 16.14
In this way, 5-bromouracil can promote a change
of an AT base pair into a GC base pair
 Physical mutagens come into two main types
 1. Ionizing radiation
 2. Nonionizing radiation
 Ionizing radiation
 Inc...
 Nonionizing radiation
 Includes UV light
 Has less energy
 Cannot penetrate deeply
into biological molecules
 Causes...
 Gene recombination originate as a result of
 Crossing over
 Orientation of chromosome during cell division
 Random fu...
 The rate of cancer increases with age
 Diseases caused by new point mutations usually
come from the father
 Testicular...
Lecture 4, gene mutation.ppt
Lecture 4, gene mutation.ppt
Upcoming SlideShare
Loading in …5
×

Lecture 4, gene mutation.ppt

1,322
-1

Published on

Published in: Education, Technology
0 Comments
2 Likes
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total Views
1,322
On Slideshare
0
From Embeds
0
Number of Embeds
0
Actions
Shares
0
Downloads
75
Comments
0
Likes
2
Embeds 0
No embeds

No notes for slide

Lecture 4, gene mutation.ppt

  1. 1. Induction of genetic varibilty 1.Mutation 2.recombination
  2. 2. INTRODUCTION  The term mutation refers to a heritable change in the genetic material  Mutations provide allelic variations  On the positive side, mutations are the foundation for evolutionary change  E.g. Light skin in high latitude human populations  On the negative side, mutations are the cause of many diseases  E.g. Hemophilia
  3. 3. DNA Maintenance  Mutation rate are extremely low  1 mutation out of 109 nucleotides per generation
  4. 4.  Mutations can be divided into three main types  1. Chromosome mutations  Changes in chromosome structure  2. Genome mutations  Changes in chromosome number  3. Single-gene mutations  Relatively small changes in DNA structure that occur within a particular gene  Types 1 and Type 2 had discussed in aberration  Type 3 will be discussed in this set of lecture notes 16.1 CONSEQUENCES OF MUTATIONS
  5. 5.  A point mutation is a change in a single base pair  It involves a base substitution Gene Mutations Change the DNA Sequence 5’ AACGCTAGATC 3’ 3’ TTGCGATCTAG 5’ 5’ AACGCGAGATC 3’ 3’ TTGCGCTCTAG 5’  A transition is a change of a pyrimidine (C, T) to another pyrimidine or a purine (A, G) to another purine  A transversion is a change of a pyrimidine to a purine or vice versa  Transitions are more common than transversions
  6. 6.  Mutations may also involve the addition or deletion of short sequences of DNA Gene Mutations Change the DNA Sequence 5’ AACGCTAGATC 3’ 3’ TTGCGATCTAG 5’ 5’ AACGCTC 3’ 3’ TTGCGAG 5’ 5’ AACGCTAGATC 3’ 3’ TTGCGATCTAG 5’ 5’ AACAGTCGCTAGATC 3’ 3’ TTGTCAGCGATCTAG 5’ Deletion of four base pairs Addition of four base pairs
  7. 7.  Mutations in the coding sequence of a structural gene can have various effects on the polypeptide  Silent mutations are those base substitutions that do not alter the amino acid sequence of the polypeptide  Due to the degeneracy of the genetic code  Missense mutations are those base substitutions in which an amino acid change does occur  Example: Sickle-cell anemia  If the substituted amino acid does not affect protein function (as measured by phenotype), the mutation is said to be neutral Gene Mutations Can Alter the Coding Sequence Within a Gene
  8. 8.  Mutations in the coding sequence of a structural gene can have various effects on the polypeptide Gene Mutations Can Alter the Coding Sequence Within a Gene  Nonsense mutations are those base substitutions that change a normal codon to a termination codon  Frameshift mutations involve the addition or deletion of nucleotides in multiples of one or two  This shifts the reading frame so that a completely different amino acid sequence occurs downstream from the mutation  Table 16.1 describes all of the above mutations
  9. 9.  In a natural population, the wild-type is the most common genotype (may be encoded by a dominant or recessive allele)  A forward mutation changes the wild-type genotype into some new variation  If it is beneficial, it may move evolution forward  Otherwise, it will be probably eliminated from a population  A reverse mutation has the opposite effect  It is also termed a reversion Gene Mutations and Their Effects on Genotype and Phenotype
  10. 10.  Mutations can also be described based on their effects on the wild-type phenotype  When a mutation alters an organism’s phenotypic characteristics, it is said to be a variant  Variants are often characterized by their differential ability to survive  Deleterious mutations decrease the chances of survival  The most extreme are lethal mutations  E.g. Homozygous polydactyly in cats  Beneficial mutations enhance the survival or reproductive success of an organism  Some mutations are called conditional mutants  They affect the phenotype only under a defined set of conditions
  11. 11.  A second mutation will sometimes affect the phenotypic expression of another  These second-site mutations are called suppressor mutations or simply suppressors  Suppressor mutations are classified into two types  Intragenic suppressors  The second mutant site is within the same gene as the first mutation  Intergenic suppressors  The second mutant site is in a different gene from the first mutation
  12. 12.  Several human genetic diseases are caused by an unusual form of mutation called trinucleotide repeat expansion (TNRE)  The term refers to the phenomenon that a sequence of 3 nucleotides can increase from one generation to the next Mutations Due to Trinucleotide Repeats
  13. 13.  Certain regions of the chromosome contain trinucleotide sequences repeated in tandem  In normal individuals, these sequences are transmitted from parent to offspring without mutation  However, in persons with TRNE disorders, the length of a trinucleotide repeat increases above a certain critical size  It also becomes prone to frequent expansion  This phenomenon is shown here with the trinucleotide repeat CAG CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG n = 11 n = 18
  14. 14.  In some cases, the expansion is within the coding sequence of the gene  Typically the trinucleotide expansion is CAG (glutamine)  Therefore, the encoded protein will contain long tracks of glutamine  This causes the proteins to aggregate with each other  This aggregation is correlated with the progression of the disease  In other cases, the expansions are located in noncoding regions of genes  These expansions are hypothesized to cause abnormal changes in RNA structure  Thereby producing disease symptoms
  15. 15.  A chromosomal rearrangement may affect a gene because the break occurred in the gene itself  A gene may be left intact, but its expression may be altered because of its new location  This is termed a position effect  There are two common reasons for position effects:  1. Movement to a position next to regulatory sequences  Refer to Figure 16.2a  2. Movement to a position in a heterochromatic region  Refer to Figure 16.2b AND 16.3 Changes in Chromosome Structure Can Affect Gene Expression
  16. 16. Figure 16.2 Regulatory sequences are often bidirectional
  17. 17.  Geneticists classify the animal cells into two types  Germ-line cells  Cells that give rise to gametes such as eggs and sperm  Somatic cells  All other cells  Germ-line mutations are those that occur directly in a sperm or egg cell, or in one of their precursor cells  Refer to Figure 16.4a  Somatic mutations are those that occur directly in a body cell, or in one of its precursor cells  Refer to Figure 16.4b AND 16.5 Mutations Can Occur in Germ-Line or Somatic Cells
  18. 18. Figure 16.4 Therefore, the mutation can be passed on to future generations The size of the patch will depend on the timing of the mutation The earlier the mutation, the larger the patch An individual who has somatic regions that are genotypically different from each other is called a genetic mosaic Therefore, the mutation cannot be passed on to future generations
  19. 19.  Mutations can occur spontaneously or be induced  Spontaneous mutations  Result from abnormalities in cellular/biological processes  Errors in DNA replication, for example  Induced mutations  Caused by environmental agents  Agents that are known to alter DNA structure are termed mutagens  These can be chemical or physical agents  Refer to Table 16.4 16.2 OCCURRENCE AND CAUSES OF MUTATION
  20. 20.  Are mutations spontaneous occurrences or causally related to environmental conditions?  This is a question that biologists have asked themselves for a long time   Jean Baptiste Lamarck  Proposed that physiological events (e.g. use and disuse) determine whether traits are passed along to offspring  Charles Darwin  Proposed that genetic variation occurs by chance  Natural selection results in better-adapted organisms Spontaneous Mutations Are Random Events
  21. 21.  These two opposing theories of the 19th century were tested in bacteria in the 1940s and 1950s  Salvadore Luria and Max Delbruck studied the resistance of E. coli to bacteriophage T1  tonr (T one resistance)  They wondered if tonr is due to spontaneous mutations or to a physiological adaptation that occurs at a low rate?  The physiological adaptation theory predicts that the number of tonr bacteria is essentially constant in different bacterial populations  The spontaneous mutation theory predicts that the number of tonr bacteria will fluctuate in different bacterial populations  Their test therefore became known as the fluctuation test
  22. 22.  Joshua and Ester Lederberg were also interested in the relation between mutations and the environment  At that time (1950s), there were two new theories  Directed mutation theory  Selected conditions could promote the formation of specific mutations allowing the organism to survive  This was consistent with Lamarck’s viewpoint  Random mutation theory  Environmental factors simply select for the survival of those individuals that happen to possess beneficial mutations  This was consistent with Darwin’s viewpoint Random Mutations Can Give an Organism a Survival Advantage
  23. 23. Figure 16.7 Replica plating  A few tonr colonies were observed at the same location on both plates!!!  This indicates that mutations conferring tonr occurred randomly on the primary (nonselective plate)  The presence of T1 in the secondary plates simply selected for previously occurring tonr mutants  This supports the random mutation theory  The Lederbergs developed a technique to distinguish between these two theories
  24. 24.  Spontaneous mutations can arise by three types of chemical changes  1. Depurination  2. Deamination  3. Tautomeric shift Causes of Spontaneous Mutations The most common
  25. 25.  Depurination involves the removal of a purine (guanine or adenine) from the DNA  The covalent bond between deoxyribose and a purine base is somewhat unstable  It occasionally undergoes a spontaneous reaction with water that releases the base from the sugar  This is termed an apurinic site  Fortunately, apurinic sites can be repaired  However, if the repair system fails, a mutation may result during subsequent rounds of DNA replication Causes of Spontaneous Mutations
  26. 26. Spontaneous depurinationFigure 16.8 Three out of four (A, T and G) are the incorrect nucleotide There’s a 75% chance of a mutation
  27. 27.  Deamination involves the removal of an amino group from the cytosine base  The other bases are not readily deaminated Figure 16.9  DNA repair enzymes can recognize uracil as an inappropriate base in DNA and remove it  However, if the repair system fails, a C-G to A-T mutation will result during subsequent rounds of DNA replication
  28. 28.  Deamination of 5-methyl cytosine can also occur  Thymine is a normal constituent of DNA  This poses a problem for repair enzymes  They cannot determine which of the two bases on the two DNA strands is the incorrect base  For this reason, methylated cytosine bases tend to create hot spots for mutation Figure 16.9
  29. 29.  A tautomeric shift involves a temporary change in base structure (Figure 16.10a)  The common, stable form of thymine and guanine is the keto form  At a low rate, T and G can interconvert to an enol form  The common, stable form of adenine and cytosine is the amino form  At a low rate, A and C can interconvert to an imino form  These rare forms promote AC and GT base pairs  Refer to Figure 16.10b  For a tautomeric shift to cause a mutation it must occur immediately prior to DNA replication  Refer to Figure 16.10c
  30. 30. Figure 16.10 RareCommon
  31. 31. Figure 16.10
  32. 32. 16-42 Figure 16.10 Temporary tautomeric shift Shifted back to its normal fom
  33. 33.  An enormous array of agents can act as mutagens to permanently alter the structure of DNA  The public is concerned about mutagens for two main reasons:  1. Somatic mutagens are often involved in the development of human cancers  2. Germ-line mutations may have harmful effects in future generations  Mutagenic agents are usually classified as chemical or physical mutagens  Refer to Table 16.5 Types of Mutagens
  34. 34. Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-53
  35. 35.  Chemical mutagens come into three main types  1. Base modifiers  2. Intercalating agents  3. Base analogues Mutagens Alter DNA Structure in Different Ways
  36. 36.  Base modifiers covalently modify the structure of a nucleotide  For example, nitrous acid, replaces amino groups with keto groups (–NH2 to =O)  This can change cytosine to uracil and adenine to hypoxanthine  Refer to Figure 16.1
  37. 37. Mispairing of modified basesFigure 16.13 These mispairings create mutations in the newly replicated strand
  38. 38.  Intercalating agents contain flat planar structures that intercalate themselves into the double helix  This distorts the helical structure  When DNA containing these mutagens is replicated, the daughter strands may contain single-nucleotide additions and/or deletions  Examples:  Acridine dyes  Proflavin  Ethidium bromide
  39. 39.  Base analogues become incorporated into daughter strands during DNA replication  For example, 5-bromouracil is a thymine analogue  It can be incorporated into DNA instead of thymine Figure 16.14 Normal pairing This tautomeric shift occurs at a relatively high rate Mispairing
  40. 40. Figure 16.14 In this way, 5-bromouracil can promote a change of an AT base pair into a GC base pair
  41. 41.  Physical mutagens come into two main types  1. Ionizing radiation  2. Nonionizing radiation  Ionizing radiation  Includes X rays and gamma rays  Has short wavelength and high energy  Can penetrate deeply into biological molecules  Creates chemically reactive molecules termed free radicals  Can cause  Base deletions  Single nicks in DNA strands  Cross-linking  Chromosomal breaks
  42. 42.  Nonionizing radiation  Includes UV light  Has less energy  Cannot penetrate deeply into biological molecules  Causes the formation of cross-linked thymine dimers  Thymine dimers may cause mutations when that DNA strand is replicated Figure 16.15
  43. 43.  Gene recombination originate as a result of  Crossing over  Orientation of chromosome during cell division  Random fusion of male and female gametes during fertilization  Read detail from book Pinciples of botany pg#472 Gene recombination
  44. 44.  The rate of cancer increases with age  Diseases caused by new point mutations usually come from the father  Testicular tissues undergoes many more rounds of DNA replication than ovarian tissue prior to meiosis  Cancers develop when one mutation promotes DNA replication and cell division  This promotes additional mutations  Some of the new mutations further promote DNA replication and cell division (or mutate genes that down-regulated replication and cell division)  This process continues to produce a malignant tumor DNA Replication itself is mutagenic
  1. A particular slide catching your eye?

    Clipping is a handy way to collect important slides you want to go back to later.

×