4 68 Wickramasinghe E[1].D.T.S DNA barcoding of Tea
1. DNA Barcoding Of Tea Camellia sinensis (L)Kuntz In Sri Lanka E.D.T.S.Wickramasinghe(USJP) Neil D. Fernandopulle(Genetech) P.L.Hettiarachchi(USJP)
2.
3.
4.
5.
6.
7. It was not possible to extract DNA from processed tea leaf samples even by using modified CTAB method. Another extraction method described by Hupfer et al ., (1998); Hotzel et al ., (1999); Meyer et al ., (1997); Poms et al ., (2001) was used to extract DNA from processed tea leaves. Processed tea leaves and tea dust were used to extract DNA .
8.
9. Selection of a Barcoding region The trnH – PsbA spacer (~450 bp) of the plastid was selected as the barcoding region. This region is one of the most variable and easily amplified across a broad range of land plants.
10. W for A or T Y for C or T primer Sequence(5’-3’) Annealing temperature (ºC) Expected Product Size (bp) Forward primer Trn – H CGCGCATGGTGGATTCACAATCC 50 450 Reverse Primer Psb – A GTWATGCAYGAACGTAATGCC
11. PCR Agarose gel electrophoresis and gel purification Sequencing and editing
12. 2% agarose gel stained with ethidium bromide showing PCR amplified products of DNA extracted from fresh leaf sample using modified CTAB method. 450 bp marker
13. Lanes 1 – 16. DNA extracted from samples TRI 3063, TRI 3022, TRI 4006, TRI DN, TRI 4014, TRI 4021, TRI 3015, TRI 3018, TRI 4042, TRI 4052, TRI 2025, TRI 4028, TRI 2043, TRI DG7, TRI 3025, TRI 4046, respectively. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16