Uploaded on

 

More in: Technology , Business
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Be the first to comment
    Be the first to like this
No Downloads

Views

Total Views
864
On Slideshare
0
From Embeds
0
Number of Embeds
0

Actions

Shares
Downloads
33
Comments
0
Likes
0

Embeds 0

No embeds

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
    No notes for slide

Transcript

  • 1. DNA Barcoding Of Tea Camellia sinensis (L)Kuntz In Sri Lanka E.D.T.S.Wickramasinghe(USJP) Neil D. Fernandopulle(Genetech) P.L.Hettiarachchi(USJP)
  • 2.
    • The tea plant C amellia sinensis( L ) kuntz is the plant of whose leaves and leaf buds are used to produce tea.
    • After water , tea is the most widely consumed beverage in the world.
    • Sri Lanka is world famous for its high quality tea
    • Today, Sri Lanka is the world's third biggest tea exporter.
    • The world tea production is dominated by five countries namely India, China, Sri Lanka, Indonesia and Kenya .
  • 3.
    • Sri Lankan tea is unique in its diversity in flavor, something that other tea producing countries do not have.
    • Low quality, non-Sri Lankan tea might be sold in the global market under the name “CEYLON TEA”.
    • There should be a method to identify all Sri Lankan tea clones.(Both fresh and processed samples).
    • Heterogeneity of samples can be used to classify them into various clones.
  • 4.
    • Methods used to identify species or taxa beyond species level by using short, standardized DNA sequence in a well-known gene known as "DNA barcode“ is DNA barcoding.
    • The DNA barcode sequence includes about 400-800 base-pairs. That is a tiny portion of the billons of base pairs that make up the entire genome of many organisms
  • 5. METHODOLOGY
    • DNA Extraction from fresh tea leaves
    • DNA extraction from tea is difficult due to the presence of high content of polyphenols. .
    • For barcoding, 16 samples of fresh tea leaves obtained by a Kahawatta plantation were used.
    • CTAB method described by Doyle and Doyle, 1987 has to be modified to extract DNA.
  • 6. Extraction protocol
    • Homogenization and Lysis [ 1.4 M sodium chloride, 1% pvp, 50.0 mM EDTA, 2% CTAB, 2% β - mercaptoethanol] .
    • Protein and RNA digestion
    • Peptide precipitation( 5 M potassium acetate)
    • Chloroform extraction :- Samples were extracted with equal volume of phenol : CHCl 3 : isoamyl alcohol (25:24:1)
    • NaCl containing PEG was added to increase the DNA yield. Precipitation of DNA and washing
    • Obtained pellet was dissolved in 60.0 µl of TE buffer [10 mM Tris (pH 8.0),
    • 0.1 mM EDTA] and stored at 20º C until use.
  • 7. It was not possible to extract DNA from processed tea leaf samples even by using modified CTAB method. Another extraction method described by Hupfer et al ., (1998); Hotzel et al ., (1999); Meyer et al ., (1997); Poms et al ., (2001) was used to extract DNA from processed tea leaves. Processed tea leaves and tea dust were used to extract DNA .
  • 8.
    • Homogenization
    • Protein and RNA digestion
    • Chloroform extraction .
    • Removal of Contaminants CTAB precipitation solution (5 g/L CTAB, 0.04 M NaCl)
    • Chloroform extraction
    • DNA Precipitation and washing
    • Pellet was dried and re-dissolve in 100.0 µl of sterile deionised water.
    Extraction protocol
  • 9. Selection of a Barcoding region The trnH – PsbA spacer (~450 bp) of the plastid was selected as the barcoding region. This region is one of the most variable and easily amplified across a broad range of land plants.
  • 10. W for A or T Y for C or T primer Sequence(5’-3’) Annealing temperature (ºC) Expected Product Size (bp) Forward primer Trn – H CGCGCATGGTGGATTCACAATCC 50 450 Reverse Primer Psb – A GTWATGCAYGAACGTAATGCC
  • 11. PCR Agarose gel electrophoresis and gel purification Sequencing and editing
  • 12. 2% agarose gel stained with ethidium bromide showing PCR amplified products of DNA extracted from fresh leaf sample using modified CTAB method. 450 bp marker
  • 13. Lanes 1 – 16. DNA extracted from samples TRI 3063, TRI 3022, TRI 4006, TRI DN, TRI 4014, TRI 4021, TRI 3015, TRI 3018, TRI 4042, TRI 4052, TRI 2025, TRI 4028, TRI 2043, TRI DG7, TRI 3025, TRI 4046, respectively. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16
  • 14.
  • 15. Sequencing data of sample TRI DG7 Sequencing data of sample TRI2025
  • 16. Alignment of psb-A region of six samples
  • 17. Phylogenetic tree obtained for sequenced samples and Camellia sinensis var. sinensis at NCBI . Genetic Distance
  • 18.
      • considerable variation among studied clones were observed.
      • According to the phylogenetic tree, genetic distances obtained ranged from 0.003 – 0.06, which is acceptable for intra specific taxa.
      • A very close relationship between Sri Lankan tea cultivars tested and Camellia sinensis var. sinensis was observed in the phylogenetic tree.
  • 19.
    • This is the first record of a method developed to extract and barcode processed tea samples.
    • Now, it’s possible to develop a data base of multiple, target DNA regions
    • To establish sequences unique to Sri Lankan tea
    • Using this, local tea cultivars can be patented.
    • Finally, the position of Sri Lankan tea in the global market could be secured.
  • 20.
    • THANK YOU!!