integrated approach to tree domestication and conservation of genetic resources

882
-1

Published on

integrated approach to tree domestication and conservation of genetic resources

Published in: Technology
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total Views
882
On Slideshare
0
From Embeds
0
Number of Embeds
0
Actions
Shares
0
Downloads
12
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

integrated approach to tree domestication and conservation of genetic resources

  1. 1. INTEGRATED APPROACH TO TREE DOMESTICATION AND CONSERVATION OF GENETIC RESOURCES DANIEL OFORI (GRP1 / EA) ICRAF 23 RD AUGUST 2011
  2. 2. Structure of presentation <ul><li>Introduction </li></ul><ul><li>Domestication and conservation strategies using Milicia sp. as a case study </li></ul><ul><ul><li>Field screening </li></ul></ul><ul><ul><li>Vegetative propagation </li></ul></ul><ul><ul><li>Molecular marker analysis </li></ul></ul><ul><ul><li>Seed orchard management </li></ul></ul><ul><li>Discussions/conclusions </li></ul><ul><li>Acknowledgements </li></ul>
  3. 3. Introduction <ul><li>Tree domestication i nvolves accelerated and human-induced evolution to bring species into wider cultivation through a farmer-driven or market-led process. This is a science-based and interactive procedure involving the identification, collection, evaluation, production, management and adoption of high quality germplasm </li></ul>
  4. 4. Introduction <ul><li>Conservation is the management and use of genetic resources so that they may yield the greatest sustainable benefit to the present generation, while maintaining their potential to meet the needs and aspirations of future </li></ul>
  5. 5. Introduction <ul><li>By 2050; food, shelter etc will be required for the sustenance of approximately 9 billion people. </li></ul><ul><li>Loss of plants leads to worsening food insecurity, increasing vulnerability to disease and deteriorating social relations   </li></ul>
  6. 6. Introduction <ul><li>Continued misuse of ecosystems is leading into crisis. </li></ul><ul><li>It is estimated that 60,000 to 100,000 plant species, with diverse economic uses, are under threat of extinction and need to be protected. </li></ul>
  7. 7. Introduction <ul><li>Domestication and conservation of species, particularly those which have direct impacts on human well being, have now attained paramount importance, in our efforts to provide for the sustainable utilization of biological resources </li></ul><ul><li>The choice of strategies and tools depends on a clear understanding of the problem and what needs to be achieved. </li></ul>
  8. 8. Objective <ul><li>The objective of this presentation is to share knowledge and experiences on techniques and tools employed in domestication and conservation of tree genetic resources. </li></ul>
  9. 9. THE IROKO (Mvule) STORY Milicia sp . (M. Excelsa & M. Regia) Considered as the most useful species in the family - MORACEAE
  10. 10. Forest condition in Ghana <ul><li>Rate of forest depletion 0.7-1.4% </li></ul><ul><li>1.7 m ha out of 8.2 m ha of forest was under reservation </li></ul><ul><li>Over 70% unreserved forest lost over 100 yrs </li></ul><ul><li>Solution was forest plantation programme </li></ul><ul><li>Target was 20,000 ha/ yr </li></ul><ul><li>Good quality planting materials required </li></ul>
  11. 11. Milicia-Phytolyma lata problem Extraction=172,983 m 3 yr -1 ; regeneration = 28,650 m 3 yr -1 ; Deficit =144,333 m 3 yr -1
  12. 12. Impact of Pest on Plant Growth
  13. 13. Mean growth rate of protected and unprotected Milicia after 18 months
  14. 14. Productivity loss of unprotected Milicia after 18 months
  15. 15. Screening for pest resistance 133 accessions from 4 Ghanaian provenances
  16. 16. Seedling response to pest attack
  17. 17. Selection of resistant individuals R S S R S Trees marked ‘R’ are resistant Trees marked ‘S’ are susceptible
  18. 18. Levels of resistance and Genetic Variation <ul><li>3 Levels of susceptibility </li></ul><ul><li>Resistance </li></ul><ul><li>Moderately resistance </li></ul><ul><li>Susceptible </li></ul>
  19. 19. Conservation of desirable genotypes Stem and root cuttings Rooted stem cuttings Root cuttings with shoots
  20. 20. Grafting Collection of scion Grafted plant
  21. 21. Air layering Ready for planting Girdled branch With ball of rooting medium
  22. 22. In vitro tissue culture Shoots grown from axillary buds Ex-situ conservation Serial propagation
  23. 23. Genetic gains from clonal trial at 12 months after establishment
  24. 24. Molecular DNA characterization <ul><li>Distinct morphological differences observed </li></ul>
  25. 25. DNA fingerprinting of Milicia M . excelsa M . regia M. excelsa M. regia
  26. 26. RAPD Cluster analysis
  27. 27. Analysis of variance components revealed most of the total variation was among populations (65%) SV df SS MSS Variance component % total variation Among pop 4 96.45 24.12 5.32 65.26 Within pop 15 42.50 2.83 2.83 34.75
  28. 28. Genetic distance among 5 populations Population ID GD GM GW CD GM 0.51 GW 0.71 0.46 CD 0.28 0.72 0.94 SW 0.62 0.43 0.31 0.88
  29. 29. Partitioning of M. regia according the populations sampled in Ghana and Sierra Leone . <ul><li>Accessions of M. regia clustered according to the populations </li></ul><ul><li>Suggesting the need to: </li></ul><ul><li>sample from different populations </li></ul><ul><li>Conserve different populations </li></ul>
  30. 30. Species verification <ul><li>Chloroplast microsatellite and DNA sequencing at 2 regions </li></ul><ul><ul><li>trnL intron </li></ul></ul><ul><ul><li>IGS between trnL and trnF </li></ul></ul>
  31. 31. Species verification
  32. 32. Cytotype frequency (%) and number of cytotypes in each population. Cytotype 2 is M. regia, and cytotypes 1 and 3 are M. excelsa . Provenances Cytotype1 (Ccmp2-M267) Cytotype2 (Ccmp2-M275) Cytotype3 (Ccmp2-M283) No. of cytotypes in population GD 0 23 77 2 GM 9.1 90.9 0 2 GW 0 100 0 1 CD 0 0 100 1 SW 0 100 0 1
  33. 33. DNA sequence (IGS) <ul><li>GDAB1-IGS </li></ul><ul><li>CCTAATTATTTATCCTACCTTCTCATTTCGTTAGCGGTTCAAAATTAGTTATCTTTCTCGTTCATTCTAATTCTACAAACGTATCTGAGCGAAAGTTTTTTTCTTATCACAAGCCTTGTGATATAGATGAAACACGTACAAATGAACATCTTTGAGAAAGGAATCCCAATGTTAAATTTGAATAATTAAAAATTCATTTTATTACTCGTACTGTACTGAAACTTACAAAGTCTTTTTTTTGAAGATCCAAGAAATTCCACCAGGACCTGGATAAGACTTTCCAATCCTCCTTTCGTCTTTTTAATTGACATAGACCCAAGTCCTCTATTAAAATGAGGATGGTGCGTGAGGAATGGTCGGGATACTGAAGAGCA GAGGACTGAA </li></ul>
  34. 34. Phylogenetic analysis using blast (NCBI)
  35. 35. <ul><li>Plus tree selection </li></ul>
  36. 36. Seed orchard management
  37. 37. Germination percentage
  38. 38. Cedrela seed orchard management
  39. 39. Seed orchard design and management <ul><li>Deployment of clones </li></ul><ul><li>Pollen contamination </li></ul>
  40. 40. <ul><li>Allanblackia mother block </li></ul><ul><li>(clone bank) </li></ul>
  41. 41. Quality germplasm = GRP1 CRP7 Climate change And agric GRP 6 Multifunctional Landscape (envt. Services) GRP4 Land health and restoration GRP3 Tree product marketing GRP2 on farm productivity CRP4 Agric nutrition and health GRP5 Climate change Partners CRP3. sustainable Production syt (Food Security) CRP5 Water, soil & ecosystems CRP1 Integrated agric. systems CRP6 Forests, trees and AF
  42. 42. Discussion/ conclusion <ul><li>Tree domestication & conservation strategies are required for the management of genetic resources for the benefit of humankind today and for future use. </li></ul><ul><li>Effective domestication and conservation require an interplay of several principles, practices and tools. </li></ul><ul><li>The choice of any of these depends on a clear understanding of the problem to be addressed </li></ul>
  43. 43. Discussion & conclusion <ul><li>With careful selection of strategies and tools, desired germplasm can be conserved and also made available for planting to combat poverty, food insecurity and provide health care needs, as well as to mitigate climate change, soil degradation, environmental sustainability etc. </li></ul>
  44. 44. Acknowledgements <ul><li>ITTO </li></ul><ul><li>EU </li></ul><ul><li>AFORNET </li></ul><ul><li>Gov’t Of </li></ul><ul><li>Ghana </li></ul>
  45. 45. Thank you very much Asanteni sana

×