SlideShare a Scribd company logo
1 of 12
5/19/202
0
PROMOTER
SEQUENCEANALYSI
S
Isabella
BS biochemistry
Learning objectives
◦ Introduction
◦ Types of promoter elements
◦ Databases of Promoter elements
2
1
5/19/202
0
Two languages in our genes
◦ Protein coding information - indirect reading
◦ DNA  transcription  pre-mRNA  splicing  mRNA  translation 
protein
◦ Less than 2% of the human genome
◦ Regulatory information - direct reading
◦ DNA  binding of TF  gene activation
Indirect read-out through
transcription/translationDirect read-out by TFs
Cis 
Trans

3
cis-elements = Templates for assembly
The function of cis-elements is being templates for the assembly of
multiprotein complexes 4
2
5/19/202
0
Types of promoter elements
◦ Core Promoter elements
◦ Elements required to initiate the transcription e.g TATA box
◦ Regulatory promoter elements
◦ Responsive elements
◦ CRE, HSE, GRE - mediates response to cAMP, heat shock, glucocorticoids
◦ Cell type specific elements
◦ Location-- mixed with Upstream regulatory elements
(UPEs)
5
Three RNA polymerases
- three groups of promoters
◦RNA polymerase I
◦ rRNA (28S, 18S and 5.8S )
◦ RNA polymerase III
◦tRNAs and 5S rRNA
◦RNA polymerase II
◦ Protein-coding genes
80% of total
RNAsynthesis
from these
”Oddpols”
6
3
5/19/202
0
7
Transcription factors
Sequence-
specific DNA
binding
Non-DNA
binding
TF1 TF
2
TF
3
TF
4
adapter
HA
T
DNA
Layer I
Layer III
Co-activator
Layer II
8
4
5/19/202
0
Transcription factors recognition sites
◦ Typically 6-10 positions very selective and several others
show bias
◦ Often selectivity profile summarized by ‘motif’
9
Eukaryotic promoter databases
◦ TRANSFAC
◦ JASPAR
◦ PLANT
CARE
◦ PLACE
◦ Consite
10
5
5/19/202
0
11
JASPAR (http://jaspar.genereg.net/ )
10
6
5/19/202
0
13
14
Click on it
7
5/19/202
0
15
PLANT CARE
(http://bioinformatics.psb.ugent.be/
webtools/plantcare/html/ )
16
8
5/19/202
0
17
16
9
5/19/202
0
19
20
10
5/19/202
0
21
22
11
5/19/202
0
Class work
◦ Scan the following sequence in JASPAR and Plant CARE for identification of putative cis-acting
elements
◦ Save the results as pdf and email me today
◦ CTGGTCTACTTGGCATTGTAGAAACCATTGAAACTTAACCTGCCAACCTATGTGACCTCTTCCTTTTAG
AAACTTGGCTTACGATGCTACATCCCTAGTGGATGCTGATGCATACCTCTTACCCTTCTGGTCAGACT
GGTTATCCTTCAACATGTTAGCTGAAAAAAGTACTATGTTGCATGCCATCAATCTCAATAAAAGTTTTGA
TGACTTCCACCGACCCGGCAAAAAAAAAAAACAGATATATAGAATTGGCCTTATTAATAACAAGCC
TTATTAAGCTAATCGATCGACAGGACTAGCGTTCGGGACAGCCTGCATAAGTGTCCGTACCAGTA
CGGTCAGAGTGACATATGGGAAAACCAGTACAGTTAAACTGTATTTATTCTCCAGAAAAAAAAATTG
TAGTCTTTGTTACGCCTGTAATATTGCCAGTGAAAGTAATTAACCACTCCCCAGAAAAATGCATGGC
GTGTGACCAAGTAAATTTTTGACTAGTCTGCAGAGTGATCAGTGACAAAATTAATGATATGCTAAAAG
GTAGCAAAAGCTGCTCGTAATGTCCTTCTCATAATCCTTAATTACCGGCCGGTTCGAAACAATTTGATT
TGATCCCAAGATAATGGCGACCAAGTAAATGAAAAAGGTTGGAAACAATAGTTCTTTCGATCGATG
ACTTAGCATGCAGGTCATTGATTGATGATGCACGCTCGTTGGCCCTTTCTGCAGATCCGAACATAAC
TACTGCTATCCTTAATTTCCTTCAAAAAGAGATAAAAGATAACTACTCTATGCCATCGTCAAAATGTGT
GAAAACACAATCGACCACGTCAGGTTAGTTAGTAGTGCCGATACATATATTTTTAAGCTGAAAAGTTC
AACCTGCAGGCAGCAAATTGCAGACCATTTCAGTCTACTAGCTGACATCAGTTCAGATTAATTGACT
TGTTCAGTTGTTCACAAGTTCACGCTGCCGCGCCCCTGCGGCTATATAAGCACATTAATCCTCCAC
AGCCAAAGCATCACCCAACGATAACACAAGCAGTTAGCTAGCAGCTAGCTAGCTTCTCAGCCA
CCAGAGAAACAGCAAATAATTCAGCAGAGAAG 23
12

More Related Content

What's hot

7.2 transcription & gene expression slideshare
7.2 transcription & gene expression slideshare7.2 transcription & gene expression slideshare
7.2 transcription & gene expression slidesharedabagus
 
transcriptional gene silencing
transcriptional gene silencingtranscriptional gene silencing
transcriptional gene silencingSheetal Mehla
 
Characteristics of Genetic Code
Characteristics of Genetic CodeCharacteristics of Genetic Code
Characteristics of Genetic CodePankaj Kukreti
 
Gene expression in eukaryotes
Gene expression in eukaryotesGene expression in eukaryotes
Gene expression in eukaryotesDr.M.Prasad Naidu
 
Gene Expression in Eukaryotes
Gene Expression in EukaryotesGene Expression in Eukaryotes
Gene Expression in EukaryotesDr.M.Prasad Naidu
 
IB Biology 7.2-7.3 Slides: AHL Transcription & Translation
IB Biology 7.2-7.3 Slides: AHL Transcription & TranslationIB Biology 7.2-7.3 Slides: AHL Transcription & Translation
IB Biology 7.2-7.3 Slides: AHL Transcription & TranslationJacob Cedarbaum
 
Regulation of gene expression in prokaryotes and viruses
Regulation of gene expression in prokaryotes and virusesRegulation of gene expression in prokaryotes and viruses
Regulation of gene expression in prokaryotes and virusesNOOR ARSHIA
 
Fine Structure of Gene- Biotechnology, Microbiology PPT Download
Fine Structure of Gene- Biotechnology, Microbiology PPT DownloadFine Structure of Gene- Biotechnology, Microbiology PPT Download
Fine Structure of Gene- Biotechnology, Microbiology PPT DownloadEducation Bhaskar
 
7.2 transcription & gene expression
7.2 transcription & gene expression7.2 transcription & gene expression
7.2 transcription & gene expressionBob Smullen
 
Gene regulation eukaryote spptx
Gene regulation eukaryote spptxGene regulation eukaryote spptx
Gene regulation eukaryote spptxaljeirou
 
Gene rehulation in prokaryotes and eukaryotes
Gene rehulation in prokaryotes and eukaryotesGene rehulation in prokaryotes and eukaryotes
Gene rehulation in prokaryotes and eukaryotesSuresh Antre
 
Epigenetics- Transcription regulation of gene expression
Epigenetics- Transcription regulation of gene expressionEpigenetics- Transcription regulation of gene expression
Epigenetics- Transcription regulation of gene expressionakash mahadev
 
Control of gene expression in plants
Control of gene expression in plantsControl of gene expression in plants
Control of gene expression in plantsAbhilash Panju
 
Sequencing based approaches for profiling dna methylation
Sequencing based approaches for profiling dna methylationSequencing based approaches for profiling dna methylation
Sequencing based approaches for profiling dna methylationsciencelearning123
 

What's hot (20)

7.2 transcription & gene expression slideshare
7.2 transcription & gene expression slideshare7.2 transcription & gene expression slideshare
7.2 transcription & gene expression slideshare
 
transcriptional gene silencing
transcriptional gene silencingtranscriptional gene silencing
transcriptional gene silencing
 
Characteristics of Genetic Code
Characteristics of Genetic CodeCharacteristics of Genetic Code
Characteristics of Genetic Code
 
Gene expression in eukaryotes
Gene expression in eukaryotesGene expression in eukaryotes
Gene expression in eukaryotes
 
Gene Expression in Eukaryotes
Gene Expression in EukaryotesGene Expression in Eukaryotes
Gene Expression in Eukaryotes
 
Gene regulation
Gene regulationGene regulation
Gene regulation
 
IB Biology 7.2-7.3 Slides: AHL Transcription & Translation
IB Biology 7.2-7.3 Slides: AHL Transcription & TranslationIB Biology 7.2-7.3 Slides: AHL Transcription & Translation
IB Biology 7.2-7.3 Slides: AHL Transcription & Translation
 
Fine structure of gene
Fine  structure of  gene Fine  structure of  gene
Fine structure of gene
 
Regulation of gene expression in prokaryotes and viruses
Regulation of gene expression in prokaryotes and virusesRegulation of gene expression in prokaryotes and viruses
Regulation of gene expression in prokaryotes and viruses
 
gene to protein
 gene to protein gene to protein
gene to protein
 
Gene discovery
Gene discoveryGene discovery
Gene discovery
 
Fine Structure of Gene- Biotechnology, Microbiology PPT Download
Fine Structure of Gene- Biotechnology, Microbiology PPT DownloadFine Structure of Gene- Biotechnology, Microbiology PPT Download
Fine Structure of Gene- Biotechnology, Microbiology PPT Download
 
7.2 transcription & gene expression
7.2 transcription & gene expression7.2 transcription & gene expression
7.2 transcription & gene expression
 
Gene regulation eukaryote spptx
Gene regulation eukaryote spptxGene regulation eukaryote spptx
Gene regulation eukaryote spptx
 
The Genetic Code
The Genetic Code The Genetic Code
The Genetic Code
 
Gene rehulation in prokaryotes and eukaryotes
Gene rehulation in prokaryotes and eukaryotesGene rehulation in prokaryotes and eukaryotes
Gene rehulation in prokaryotes and eukaryotes
 
Epigenetics- Transcription regulation of gene expression
Epigenetics- Transcription regulation of gene expressionEpigenetics- Transcription regulation of gene expression
Epigenetics- Transcription regulation of gene expression
 
Control of gene expression in plants
Control of gene expression in plantsControl of gene expression in plants
Control of gene expression in plants
 
Sequencing based approaches for profiling dna methylation
Sequencing based approaches for profiling dna methylationSequencing based approaches for profiling dna methylation
Sequencing based approaches for profiling dna methylation
 
Regulation of gene expression -2
Regulation of gene expression -2Regulation of gene expression -2
Regulation of gene expression -2
 

Similar to Regulatory elements analysis handouts

presentation gene expression and regulation in eukaryotes.pptx
presentation gene expression and regulation in eukaryotes.pptxpresentation gene expression and regulation in eukaryotes.pptx
presentation gene expression and regulation in eukaryotes.pptxanilasajjad
 
Gene expresion transcription.pdf
 Gene expresion transcription.pdf Gene expresion transcription.pdf
Gene expresion transcription.pdfMohamed Alashram
 
RNA and Protein Synthesis
RNA and Protein Synthesis RNA and Protein Synthesis
RNA and Protein Synthesis Santanu Patsa
 
2.biology for medical students. gene expression
2.biology for medical students. gene expression2.biology for medical students. gene expression
2.biology for medical students. gene expressionRaj Vikram
 
Campbell6e lecture ch12
Campbell6e lecture ch12Campbell6e lecture ch12
Campbell6e lecture ch12chutchit1979
 
1.introduction to genetic engineering and restriction enzymes
1.introduction to genetic engineering and restriction enzymes1.introduction to genetic engineering and restriction enzymes
1.introduction to genetic engineering and restriction enzymesGetachew Birhanu
 
Eukaryotic Transcription.pptx
Eukaryotic Transcription.pptxEukaryotic Transcription.pptx
Eukaryotic Transcription.pptxAKHILRDONGA
 
Isolation of promoters and other regularly elements
Isolation of promoters and other regularly elementsIsolation of promoters and other regularly elements
Isolation of promoters and other regularly elementsSachin Ekatpure
 
Genetic code and Translation by Prof Viyatprajna Acharya, KIMS Bhubaneswar
Genetic code and Translation by Prof Viyatprajna Acharya, KIMS BhubaneswarGenetic code and Translation by Prof Viyatprajna Acharya, KIMS Bhubaneswar
Genetic code and Translation by Prof Viyatprajna Acharya, KIMS BhubaneswarProf Viyatprajna Acharya
 
Protein biosynthesis (translation)
Protein biosynthesis  (translation)Protein biosynthesis  (translation)
Protein biosynthesis (translation)Ashok Katta
 
Ch 17: From Gene to Protein
Ch 17: From Gene to Protein Ch 17: From Gene to Protein
Ch 17: From Gene to Protein veneethmathew
 
Biosynthesis of protein in eukariotes
Biosynthesis of protein in eukariotesBiosynthesis of protein in eukariotes
Biosynthesis of protein in eukariotesKAUSHAL SAHU
 

Similar to Regulatory elements analysis handouts (20)

presentation gene expression and regulation in eukaryotes.pptx
presentation gene expression and regulation in eukaryotes.pptxpresentation gene expression and regulation in eukaryotes.pptx
presentation gene expression and regulation in eukaryotes.pptx
 
Gene expresion transcription.pdf
 Gene expresion transcription.pdf Gene expresion transcription.pdf
Gene expresion transcription.pdf
 
Transcription
TranscriptionTranscription
Transcription
 
RNA and Protein Synthesis
RNA and Protein Synthesis RNA and Protein Synthesis
RNA and Protein Synthesis
 
2.biology for medical students. gene expression
2.biology for medical students. gene expression2.biology for medical students. gene expression
2.biology for medical students. gene expression
 
Campbell6e lecture ch12
Campbell6e lecture ch12Campbell6e lecture ch12
Campbell6e lecture ch12
 
Dna translation
Dna translationDna translation
Dna translation
 
Gene structure L2.pdf
Gene structure L2.pdfGene structure L2.pdf
Gene structure L2.pdf
 
1.introduction to genetic engineering and restriction enzymes
1.introduction to genetic engineering and restriction enzymes1.introduction to genetic engineering and restriction enzymes
1.introduction to genetic engineering and restriction enzymes
 
5.4 lecture 2019
5.4 lecture 20195.4 lecture 2019
5.4 lecture 2019
 
Eukaryotic Transcription.pptx
Eukaryotic Transcription.pptxEukaryotic Transcription.pptx
Eukaryotic Transcription.pptx
 
Da2 (1)
Da2 (1)Da2 (1)
Da2 (1)
 
Isolation of promoters and other regularly elements
Isolation of promoters and other regularly elementsIsolation of promoters and other regularly elements
Isolation of promoters and other regularly elements
 
Genetic code and Translation by Prof Viyatprajna Acharya, KIMS Bhubaneswar
Genetic code and Translation by Prof Viyatprajna Acharya, KIMS BhubaneswarGenetic code and Translation by Prof Viyatprajna Acharya, KIMS Bhubaneswar
Genetic code and Translation by Prof Viyatprajna Acharya, KIMS Bhubaneswar
 
Genetic control
Genetic controlGenetic control
Genetic control
 
Genetic control
Genetic controlGenetic control
Genetic control
 
Protein biosynthesis (translation)
Protein biosynthesis  (translation)Protein biosynthesis  (translation)
Protein biosynthesis (translation)
 
Ch 17: From Gene to Protein
Ch 17: From Gene to Protein Ch 17: From Gene to Protein
Ch 17: From Gene to Protein
 
Eukaryotic transcription
Eukaryotic transcription Eukaryotic transcription
Eukaryotic transcription
 
Biosynthesis of protein in eukariotes
Biosynthesis of protein in eukariotesBiosynthesis of protein in eukariotes
Biosynthesis of protein in eukariotes
 

More from isa bella

Types and classification of cancer
Types and classification of cancerTypes and classification of cancer
Types and classification of cancerisa bella
 
Topic 5 physical and chemical carcinogens
Topic 5 physical and chemical carcinogensTopic 5 physical and chemical carcinogens
Topic 5 physical and chemical carcinogensisa bella
 
Mechanism of cancer development pdf
Mechanism of cancer development pdfMechanism of cancer development pdf
Mechanism of cancer development pdfisa bella
 
microbes involved in nitrogen fixation
microbes involved in nitrogen fixationmicrobes involved in nitrogen fixation
microbes involved in nitrogen fixationisa bella
 
nitrogen fixation
 nitrogen fixation nitrogen fixation
nitrogen fixationisa bella
 
nitrogen assimilation
nitrogen assimilationnitrogen assimilation
nitrogen assimilationisa bella
 
plant alkaloids their functions and biosynthesis
plant alkaloids their functions and  biosynthesisplant alkaloids their functions and  biosynthesis
plant alkaloids their functions and biosynthesisisa bella
 
Biological functions of alkaloids
Biological functions of alkaloidsBiological functions of alkaloids
Biological functions of alkaloidsisa bella
 

More from isa bella (8)

Types and classification of cancer
Types and classification of cancerTypes and classification of cancer
Types and classification of cancer
 
Topic 5 physical and chemical carcinogens
Topic 5 physical and chemical carcinogensTopic 5 physical and chemical carcinogens
Topic 5 physical and chemical carcinogens
 
Mechanism of cancer development pdf
Mechanism of cancer development pdfMechanism of cancer development pdf
Mechanism of cancer development pdf
 
microbes involved in nitrogen fixation
microbes involved in nitrogen fixationmicrobes involved in nitrogen fixation
microbes involved in nitrogen fixation
 
nitrogen fixation
 nitrogen fixation nitrogen fixation
nitrogen fixation
 
nitrogen assimilation
nitrogen assimilationnitrogen assimilation
nitrogen assimilation
 
plant alkaloids their functions and biosynthesis
plant alkaloids their functions and  biosynthesisplant alkaloids their functions and  biosynthesis
plant alkaloids their functions and biosynthesis
 
Biological functions of alkaloids
Biological functions of alkaloidsBiological functions of alkaloids
Biological functions of alkaloids
 

Recently uploaded

Best Rate (Patna ) Call Girls Patna ⟟ 8617370543 ⟟ High Class Call Girl In 5 ...
Best Rate (Patna ) Call Girls Patna ⟟ 8617370543 ⟟ High Class Call Girl In 5 ...Best Rate (Patna ) Call Girls Patna ⟟ 8617370543 ⟟ High Class Call Girl In 5 ...
Best Rate (Patna ) Call Girls Patna ⟟ 8617370543 ⟟ High Class Call Girl In 5 ...Dipal Arora
 
Top Rated Bangalore Call Girls Majestic ⟟ 9332606886 ⟟ Call Me For Genuine S...
Top Rated Bangalore Call Girls Majestic ⟟  9332606886 ⟟ Call Me For Genuine S...Top Rated Bangalore Call Girls Majestic ⟟  9332606886 ⟟ Call Me For Genuine S...
Top Rated Bangalore Call Girls Majestic ⟟ 9332606886 ⟟ Call Me For Genuine S...narwatsonia7
 
Call Girls Rishikesh Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Rishikesh Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Rishikesh Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Rishikesh Just Call 8250077686 Top Class Call Girl Service AvailableDipal Arora
 
Top Rated Bangalore Call Girls Richmond Circle ⟟ 9332606886 ⟟ Call Me For Ge...
Top Rated Bangalore Call Girls Richmond Circle ⟟  9332606886 ⟟ Call Me For Ge...Top Rated Bangalore Call Girls Richmond Circle ⟟  9332606886 ⟟ Call Me For Ge...
Top Rated Bangalore Call Girls Richmond Circle ⟟ 9332606886 ⟟ Call Me For Ge...narwatsonia7
 
Call Girls in Delhi Triveni Complex Escort Service(🔝))/WhatsApp 97111⇛47426
Call Girls in Delhi Triveni Complex Escort Service(🔝))/WhatsApp 97111⇛47426Call Girls in Delhi Triveni Complex Escort Service(🔝))/WhatsApp 97111⇛47426
Call Girls in Delhi Triveni Complex Escort Service(🔝))/WhatsApp 97111⇛47426jennyeacort
 
Independent Call Girls In Jaipur { 8445551418 } ✔ ANIKA MEHTA ✔ Get High Prof...
Independent Call Girls In Jaipur { 8445551418 } ✔ ANIKA MEHTA ✔ Get High Prof...Independent Call Girls In Jaipur { 8445551418 } ✔ ANIKA MEHTA ✔ Get High Prof...
Independent Call Girls In Jaipur { 8445551418 } ✔ ANIKA MEHTA ✔ Get High Prof...parulsinha
 
Manyata Tech Park ( Call Girls ) Bangalore ✔ 6297143586 ✔ Hot Model With Sexy...
Manyata Tech Park ( Call Girls ) Bangalore ✔ 6297143586 ✔ Hot Model With Sexy...Manyata Tech Park ( Call Girls ) Bangalore ✔ 6297143586 ✔ Hot Model With Sexy...
Manyata Tech Park ( Call Girls ) Bangalore ✔ 6297143586 ✔ Hot Model With Sexy...vidya singh
 
Model Call Girls In Chennai WhatsApp Booking 7427069034 call girl service 24 ...
Model Call Girls In Chennai WhatsApp Booking 7427069034 call girl service 24 ...Model Call Girls In Chennai WhatsApp Booking 7427069034 call girl service 24 ...
Model Call Girls In Chennai WhatsApp Booking 7427069034 call girl service 24 ...hotbabesbook
 
Jogeshwari ! Call Girls Service Mumbai - 450+ Call Girl Cash Payment 90042684...
Jogeshwari ! Call Girls Service Mumbai - 450+ Call Girl Cash Payment 90042684...Jogeshwari ! Call Girls Service Mumbai - 450+ Call Girl Cash Payment 90042684...
Jogeshwari ! Call Girls Service Mumbai - 450+ Call Girl Cash Payment 90042684...Anamika Rawat
 
Night 7k to 12k Navi Mumbai Call Girl Photo 👉 BOOK NOW 9833363713 👈 ♀️ night ...
Night 7k to 12k Navi Mumbai Call Girl Photo 👉 BOOK NOW 9833363713 👈 ♀️ night ...Night 7k to 12k Navi Mumbai Call Girl Photo 👉 BOOK NOW 9833363713 👈 ♀️ night ...
Night 7k to 12k Navi Mumbai Call Girl Photo 👉 BOOK NOW 9833363713 👈 ♀️ night ...aartirawatdelhi
 
💕SONAM KUMAR💕Premium Call Girls Jaipur ↘️9257276172 ↙️One Night Stand With Lo...
💕SONAM KUMAR💕Premium Call Girls Jaipur ↘️9257276172 ↙️One Night Stand With Lo...💕SONAM KUMAR💕Premium Call Girls Jaipur ↘️9257276172 ↙️One Night Stand With Lo...
💕SONAM KUMAR💕Premium Call Girls Jaipur ↘️9257276172 ↙️One Night Stand With Lo...khalifaescort01
 
Top Rated Bangalore Call Girls Mg Road ⟟ 9332606886 ⟟ Call Me For Genuine S...
Top Rated Bangalore Call Girls Mg Road ⟟   9332606886 ⟟ Call Me For Genuine S...Top Rated Bangalore Call Girls Mg Road ⟟   9332606886 ⟟ Call Me For Genuine S...
Top Rated Bangalore Call Girls Mg Road ⟟ 9332606886 ⟟ Call Me For Genuine S...narwatsonia7
 
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...Arohi Goyal
 
Call Girls Kurnool Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Kurnool Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Kurnool Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Kurnool Just Call 8250077686 Top Class Call Girl Service AvailableDipal Arora
 
The Most Attractive Hyderabad Call Girls Kothapet 𖠋 9332606886 𖠋 Will You Mis...
The Most Attractive Hyderabad Call Girls Kothapet 𖠋 9332606886 𖠋 Will You Mis...The Most Attractive Hyderabad Call Girls Kothapet 𖠋 9332606886 𖠋 Will You Mis...
The Most Attractive Hyderabad Call Girls Kothapet 𖠋 9332606886 𖠋 Will You Mis...chandars293
 
Call Girls Raipur Just Call 9630942363 Top Class Call Girl Service Available
Call Girls Raipur Just Call 9630942363 Top Class Call Girl Service AvailableCall Girls Raipur Just Call 9630942363 Top Class Call Girl Service Available
Call Girls Raipur Just Call 9630942363 Top Class Call Girl Service AvailableGENUINE ESCORT AGENCY
 
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any TimeTop Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any TimeCall Girls Delhi
 
Call Girls Kakinada Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Kakinada Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Kakinada Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Kakinada Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
Call Girls Service Jaipur {8445551418} ❤️VVIP BHAWNA Call Girl in Jaipur Raja...
Call Girls Service Jaipur {8445551418} ❤️VVIP BHAWNA Call Girl in Jaipur Raja...Call Girls Service Jaipur {8445551418} ❤️VVIP BHAWNA Call Girl in Jaipur Raja...
Call Girls Service Jaipur {8445551418} ❤️VVIP BHAWNA Call Girl in Jaipur Raja...parulsinha
 
VIP Hyderabad Call Girls Bahadurpally 7877925207 ₹5000 To 25K With AC Room 💚😋
VIP Hyderabad Call Girls Bahadurpally 7877925207 ₹5000 To 25K With AC Room 💚😋VIP Hyderabad Call Girls Bahadurpally 7877925207 ₹5000 To 25K With AC Room 💚😋
VIP Hyderabad Call Girls Bahadurpally 7877925207 ₹5000 To 25K With AC Room 💚😋TANUJA PANDEY
 

Recently uploaded (20)

Best Rate (Patna ) Call Girls Patna ⟟ 8617370543 ⟟ High Class Call Girl In 5 ...
Best Rate (Patna ) Call Girls Patna ⟟ 8617370543 ⟟ High Class Call Girl In 5 ...Best Rate (Patna ) Call Girls Patna ⟟ 8617370543 ⟟ High Class Call Girl In 5 ...
Best Rate (Patna ) Call Girls Patna ⟟ 8617370543 ⟟ High Class Call Girl In 5 ...
 
Top Rated Bangalore Call Girls Majestic ⟟ 9332606886 ⟟ Call Me For Genuine S...
Top Rated Bangalore Call Girls Majestic ⟟  9332606886 ⟟ Call Me For Genuine S...Top Rated Bangalore Call Girls Majestic ⟟  9332606886 ⟟ Call Me For Genuine S...
Top Rated Bangalore Call Girls Majestic ⟟ 9332606886 ⟟ Call Me For Genuine S...
 
Call Girls Rishikesh Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Rishikesh Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Rishikesh Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Rishikesh Just Call 8250077686 Top Class Call Girl Service Available
 
Top Rated Bangalore Call Girls Richmond Circle ⟟ 9332606886 ⟟ Call Me For Ge...
Top Rated Bangalore Call Girls Richmond Circle ⟟  9332606886 ⟟ Call Me For Ge...Top Rated Bangalore Call Girls Richmond Circle ⟟  9332606886 ⟟ Call Me For Ge...
Top Rated Bangalore Call Girls Richmond Circle ⟟ 9332606886 ⟟ Call Me For Ge...
 
Call Girls in Delhi Triveni Complex Escort Service(🔝))/WhatsApp 97111⇛47426
Call Girls in Delhi Triveni Complex Escort Service(🔝))/WhatsApp 97111⇛47426Call Girls in Delhi Triveni Complex Escort Service(🔝))/WhatsApp 97111⇛47426
Call Girls in Delhi Triveni Complex Escort Service(🔝))/WhatsApp 97111⇛47426
 
Independent Call Girls In Jaipur { 8445551418 } ✔ ANIKA MEHTA ✔ Get High Prof...
Independent Call Girls In Jaipur { 8445551418 } ✔ ANIKA MEHTA ✔ Get High Prof...Independent Call Girls In Jaipur { 8445551418 } ✔ ANIKA MEHTA ✔ Get High Prof...
Independent Call Girls In Jaipur { 8445551418 } ✔ ANIKA MEHTA ✔ Get High Prof...
 
Manyata Tech Park ( Call Girls ) Bangalore ✔ 6297143586 ✔ Hot Model With Sexy...
Manyata Tech Park ( Call Girls ) Bangalore ✔ 6297143586 ✔ Hot Model With Sexy...Manyata Tech Park ( Call Girls ) Bangalore ✔ 6297143586 ✔ Hot Model With Sexy...
Manyata Tech Park ( Call Girls ) Bangalore ✔ 6297143586 ✔ Hot Model With Sexy...
 
Model Call Girls In Chennai WhatsApp Booking 7427069034 call girl service 24 ...
Model Call Girls In Chennai WhatsApp Booking 7427069034 call girl service 24 ...Model Call Girls In Chennai WhatsApp Booking 7427069034 call girl service 24 ...
Model Call Girls In Chennai WhatsApp Booking 7427069034 call girl service 24 ...
 
Jogeshwari ! Call Girls Service Mumbai - 450+ Call Girl Cash Payment 90042684...
Jogeshwari ! Call Girls Service Mumbai - 450+ Call Girl Cash Payment 90042684...Jogeshwari ! Call Girls Service Mumbai - 450+ Call Girl Cash Payment 90042684...
Jogeshwari ! Call Girls Service Mumbai - 450+ Call Girl Cash Payment 90042684...
 
Night 7k to 12k Navi Mumbai Call Girl Photo 👉 BOOK NOW 9833363713 👈 ♀️ night ...
Night 7k to 12k Navi Mumbai Call Girl Photo 👉 BOOK NOW 9833363713 👈 ♀️ night ...Night 7k to 12k Navi Mumbai Call Girl Photo 👉 BOOK NOW 9833363713 👈 ♀️ night ...
Night 7k to 12k Navi Mumbai Call Girl Photo 👉 BOOK NOW 9833363713 👈 ♀️ night ...
 
💕SONAM KUMAR💕Premium Call Girls Jaipur ↘️9257276172 ↙️One Night Stand With Lo...
💕SONAM KUMAR💕Premium Call Girls Jaipur ↘️9257276172 ↙️One Night Stand With Lo...💕SONAM KUMAR💕Premium Call Girls Jaipur ↘️9257276172 ↙️One Night Stand With Lo...
💕SONAM KUMAR💕Premium Call Girls Jaipur ↘️9257276172 ↙️One Night Stand With Lo...
 
Top Rated Bangalore Call Girls Mg Road ⟟ 9332606886 ⟟ Call Me For Genuine S...
Top Rated Bangalore Call Girls Mg Road ⟟   9332606886 ⟟ Call Me For Genuine S...Top Rated Bangalore Call Girls Mg Road ⟟   9332606886 ⟟ Call Me For Genuine S...
Top Rated Bangalore Call Girls Mg Road ⟟ 9332606886 ⟟ Call Me For Genuine S...
 
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...
 
Call Girls Kurnool Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Kurnool Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Kurnool Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Kurnool Just Call 8250077686 Top Class Call Girl Service Available
 
The Most Attractive Hyderabad Call Girls Kothapet 𖠋 9332606886 𖠋 Will You Mis...
The Most Attractive Hyderabad Call Girls Kothapet 𖠋 9332606886 𖠋 Will You Mis...The Most Attractive Hyderabad Call Girls Kothapet 𖠋 9332606886 𖠋 Will You Mis...
The Most Attractive Hyderabad Call Girls Kothapet 𖠋 9332606886 𖠋 Will You Mis...
 
Call Girls Raipur Just Call 9630942363 Top Class Call Girl Service Available
Call Girls Raipur Just Call 9630942363 Top Class Call Girl Service AvailableCall Girls Raipur Just Call 9630942363 Top Class Call Girl Service Available
Call Girls Raipur Just Call 9630942363 Top Class Call Girl Service Available
 
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any TimeTop Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
 
Call Girls Kakinada Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Kakinada Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Kakinada Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Kakinada Just Call 9907093804 Top Class Call Girl Service Available
 
Call Girls Service Jaipur {8445551418} ❤️VVIP BHAWNA Call Girl in Jaipur Raja...
Call Girls Service Jaipur {8445551418} ❤️VVIP BHAWNA Call Girl in Jaipur Raja...Call Girls Service Jaipur {8445551418} ❤️VVIP BHAWNA Call Girl in Jaipur Raja...
Call Girls Service Jaipur {8445551418} ❤️VVIP BHAWNA Call Girl in Jaipur Raja...
 
VIP Hyderabad Call Girls Bahadurpally 7877925207 ₹5000 To 25K With AC Room 💚😋
VIP Hyderabad Call Girls Bahadurpally 7877925207 ₹5000 To 25K With AC Room 💚😋VIP Hyderabad Call Girls Bahadurpally 7877925207 ₹5000 To 25K With AC Room 💚😋
VIP Hyderabad Call Girls Bahadurpally 7877925207 ₹5000 To 25K With AC Room 💚😋
 

Regulatory elements analysis handouts

  • 1. 5/19/202 0 PROMOTER SEQUENCEANALYSI S Isabella BS biochemistry Learning objectives ◦ Introduction ◦ Types of promoter elements ◦ Databases of Promoter elements 2 1
  • 2. 5/19/202 0 Two languages in our genes ◦ Protein coding information - indirect reading ◦ DNA  transcription  pre-mRNA  splicing  mRNA  translation  protein ◦ Less than 2% of the human genome ◦ Regulatory information - direct reading ◦ DNA  binding of TF  gene activation Indirect read-out through transcription/translationDirect read-out by TFs Cis  Trans  3 cis-elements = Templates for assembly The function of cis-elements is being templates for the assembly of multiprotein complexes 4 2
  • 3. 5/19/202 0 Types of promoter elements ◦ Core Promoter elements ◦ Elements required to initiate the transcription e.g TATA box ◦ Regulatory promoter elements ◦ Responsive elements ◦ CRE, HSE, GRE - mediates response to cAMP, heat shock, glucocorticoids ◦ Cell type specific elements ◦ Location-- mixed with Upstream regulatory elements (UPEs) 5 Three RNA polymerases - three groups of promoters ◦RNA polymerase I ◦ rRNA (28S, 18S and 5.8S ) ◦ RNA polymerase III ◦tRNAs and 5S rRNA ◦RNA polymerase II ◦ Protein-coding genes 80% of total RNAsynthesis from these ”Oddpols” 6 3
  • 4. 5/19/202 0 7 Transcription factors Sequence- specific DNA binding Non-DNA binding TF1 TF 2 TF 3 TF 4 adapter HA T DNA Layer I Layer III Co-activator Layer II 8 4
  • 5. 5/19/202 0 Transcription factors recognition sites ◦ Typically 6-10 positions very selective and several others show bias ◦ Often selectivity profile summarized by ‘motif’ 9 Eukaryotic promoter databases ◦ TRANSFAC ◦ JASPAR ◦ PLANT CARE ◦ PLACE ◦ Consite 10 5
  • 12. 5/19/202 0 Class work ◦ Scan the following sequence in JASPAR and Plant CARE for identification of putative cis-acting elements ◦ Save the results as pdf and email me today ◦ CTGGTCTACTTGGCATTGTAGAAACCATTGAAACTTAACCTGCCAACCTATGTGACCTCTTCCTTTTAG AAACTTGGCTTACGATGCTACATCCCTAGTGGATGCTGATGCATACCTCTTACCCTTCTGGTCAGACT GGTTATCCTTCAACATGTTAGCTGAAAAAAGTACTATGTTGCATGCCATCAATCTCAATAAAAGTTTTGA TGACTTCCACCGACCCGGCAAAAAAAAAAAACAGATATATAGAATTGGCCTTATTAATAACAAGCC TTATTAAGCTAATCGATCGACAGGACTAGCGTTCGGGACAGCCTGCATAAGTGTCCGTACCAGTA CGGTCAGAGTGACATATGGGAAAACCAGTACAGTTAAACTGTATTTATTCTCCAGAAAAAAAAATTG TAGTCTTTGTTACGCCTGTAATATTGCCAGTGAAAGTAATTAACCACTCCCCAGAAAAATGCATGGC GTGTGACCAAGTAAATTTTTGACTAGTCTGCAGAGTGATCAGTGACAAAATTAATGATATGCTAAAAG GTAGCAAAAGCTGCTCGTAATGTCCTTCTCATAATCCTTAATTACCGGCCGGTTCGAAACAATTTGATT TGATCCCAAGATAATGGCGACCAAGTAAATGAAAAAGGTTGGAAACAATAGTTCTTTCGATCGATG ACTTAGCATGCAGGTCATTGATTGATGATGCACGCTCGTTGGCCCTTTCTGCAGATCCGAACATAAC TACTGCTATCCTTAATTTCCTTCAAAAAGAGATAAAAGATAACTACTCTATGCCATCGTCAAAATGTGT GAAAACACAATCGACCACGTCAGGTTAGTTAGTAGTGCCGATACATATATTTTTAAGCTGAAAAGTTC AACCTGCAGGCAGCAAATTGCAGACCATTTCAGTCTACTAGCTGACATCAGTTCAGATTAATTGACT TGTTCAGTTGTTCACAAGTTCACGCTGCCGCGCCCCTGCGGCTATATAAGCACATTAATCCTCCAC AGCCAAAGCATCACCCAACGATAACACAAGCAGTTAGCTAGCAGCTAGCTAGCTTCTCAGCCA CCAGAGAAACAGCAAATAATTCAGCAGAGAAG 23 12