Recommended
More Related Content
Similar to ssDNA RECOMBINEERING IN L.LACTIS presentation
Similar to ssDNA RECOMBINEERING IN L.LACTIS presentation (20)
Recently uploaded
Recently uploaded (17)
ssDNA RECOMBINEERING IN L.LACTIS presentation
- 1. ssDNA RECOMBINEERING IN L. LACTIS COMPLETE PROTOCOL AND TECHNIQUE VERIFICATION February 2015 Blanca Vallejo Noguer Outgoing tutor: Jan Kok / Sjoerd van der Meulen Intern Tutor: Juan Tomás Magaña 01/20
- 2. Index • Research group • DNA Recombineering • Project approach • Objectives • Method and results • Discussion 02/20
- 3. Research group DNA Recombineering Project approach Objectives Method and results Discussion 03/20
- 4. Research group • Rijksuniversiteit Groningen • Research line: • Molecular biology of gram positive bacteria (Bacillus subtilis i Lactococcus lactis). Functional and comparative genomics • Some pathogens are also investigated (Bacillus cereus, Streptococcus pneumoniae i Enterococcus faecalis) • My role: • Recombineering •Faculty of Mathematics and Natural Sciences •Molecular genetics department 04/20
- 5. Research group DNA Recombineering Project approach Objectives Method and results Discussion 05/20
- 6. DNA Recombineering • Recombineering: Genetic engineering employing phage- derived proteins. 1. Ds-DNA Recombineering: Lambda (λ) phage-derived proteins: BET ssDNA-binding protein GAM inhibition of host nucleases EXO 5’-3’ exonuclease 2. Ss-DNA recombineering: Beta (lambda phage) or recombinase RecT (Rac prophage). Overview of bacteriophage recombination system used for recombineering- Nature protocols 06/20
- 7. ssDNA recombineering: RecT /mediated oligonucleotide recombineering RecT recombinase binds single stranded DNA oligos and target them to the lagging strand of the DNA replicon fork. – modified from Yale 2012 -Electroporation of DNA oligos with L.lactis pGHost::Pnis::RecT. If this cell is induced with nisin it synthesis RecT recombinase. Modified from van Pijkeren JP, Britton RA, 2012 07/20
- 8. Research group DNA Recombineering Project approach Objectives Method and results Discussion 08/20
- 9. OBJECTIVES: • Testing the recombineering system in L. Lactis • Create a complete protocol for recombineering in L.lactis • Delete the putative sRNACes X1 by recombineering • Design a new plasmid curable from L. Lactis with pJP005 recombineering system pGHost:Pnis:RecT * •Problem: pJP005 is practically not curable from L. Lactis Project approach 09/20
- 10. Research group DNA Recombineering Project approach Objectives Method and results Discussion 10/20
- 11. Construction of new plasmid pGHostpJP005 Fw oligo Pnis RecT XhoI Rv oligo 11/20
- 12. RESULTS Restriction, ligation and transformation • Select colonies with plasmid: Plate on GM17 chloramphenicol • Select the desired plasmid: gel restriction 1. Sample 3 (positive sample) 2. Sample 20 (positive sample) 3. Sample 21 (negative sample) 4. pGHost Insert No insert 12/20
- 13. RESULTS Sequencing • Samples 3 and 20 to sequencing: Positives ! ! 13/20
- 14. RESULTS RECOMBINEERING protocol 1. MAKING COMPETENT CELLS 1. SM17GG chloramphenicol media O/N 2. Induce with NISIN (when O.D. 0,2-0,3) 2. OLIGO DESIGN 1. Complement to the lagging strand sequence 2. 5 Nucleotides with PTOs at 5’ termini 3. 5’ [ 40-45 n / deletion or mutation / 40-45 n ] 3’ 3. TRANSFORMATION WITH OLIGO 1. SCREENING OF MUTANT 1. cPCR 2. MAMA-PCR 14/20
- 15. Verification of recombineering • Mutate four nucleotides in the RNA polymerase gene (rpoB) that results in an amino acid change yielding a rifampicin-resistant phenotype • Oligonucleotide oJP1147 (Complementary to the RpoB gene, with a 4 mismatches) • 5’-G*A*G*A*T*ACCACCAGGTCCTAAGGCAGAGAAACGACGTTTGTTGCTAAGCTCAGACAAAGGATTATGTT • GGTCCATAAATTGT 3’ 5’ 3’ mutation Rifampicin-resistant 5’ 3’ 5’3’ 16/20
- 16. RESULTS Verification of recombineering • Colonies derived from transformation were patched onto GM17 agar without antibiotic selection and onto GM17 agar containing rifampicin. GM17 GM17+RIF GM17 GM17+RIF L. lactis (pGHost:pNis:recT) 14% L. lactis (pJP005) 19%
- 17. Applying recombineering to delete CesX1 • Design oligonucleotides with 5 phosphorothioate (PT) linkages on 5’-end • 5’- C*T*G*A*T*TTATAGTACATTCAGTAGACAGTCCATACCACATATTGCATTGGTATAACAACAAATAAAAAATA • ACTTTCAAAAACCATCC -3’ 5’ 3’ 5’ 3’ 5’3’ // delation CesX1 inactive 17/20
- 18. Research group DNA Recombineering Project approach Objectives Method and results Discussion 18/20
- 19. Conclusions and discussion • ✓ L.lactis (pGHost::Pnis::RecT) construction • ✓ ssDNA recombineering complete protocol for L.lactis • ✓ ssDNA recombineering validated • ✗ CesX1 deletion with ssDNA recombineering • ✓Grow curves GM17, GSM17, GSM17GG • ✓ RecT production • ✓ Also tried with pJP005 • Low efficiency? • CesX1 difficult to delete? Is essential? 19/20
- 21. RESULTS Growth curves •Nisin induction at O.D. 0.2-0.3 has a negative effect in the growth RecT production •GM17 is the best media for growing L.lactis, but glycine and sucrose are necessary for making electrocompetent cells.
- 22. FUTURE WORK The experiment should be repeated: • Designing new oligonucleotides • Using a well-known gene, with no effects in the development of the cell •Trying smaller deletions Study CesX1 function further •Try the knock-out with another technique •Overexpress CesX1
Editor's Notes
- This is the different things I will show. First of all try to explain the recombineering technique and how it works. Then I will present you my project related with recombineering, the results , the problems and we can discuss them and consider new experiments. And finally I prepared a recombineering protocol
- This is the different things I will show. First of all try to explain the recombineering technique and how it works. Then I will present you my project related with recombineering, the results , the problems and we can discuss them and consider new experiments. And finally I prepared a recombineering protocol
- This is the different things I will show. First of all try to explain the recombineering technique and how it works. Then I will present you my project related with recombineering, the results , the problems and we can discuss them and consider new experiments. And finally I prepared a recombineering protocol
- Recombineering is a technique based on homologous recombination system,it consist in introduce linear DNA substrates using enzymes that are coded by bacteriophages There are two types of recombieering in function of the linear DNA iif its be single or double strand dsDNA: If the DNA introduced it’s double strand we need the expression 3 proteins in the cell. The DNA substrate will have the desired change in the middle and in the sides short homologies to the target. EXO will generate single-stranded overhangs and BET will bound them into the target site, and then it will occure an homologous recombination. ssDNA: Recent application of recombineering involves singlestrandedDNA oligonucleotides and only expression of Bet, or the functional homolog RecT of the Rac prophage is necessary to incorporate the ssDNA into the genome Ref image: http://www.nature.com/nprot/journal/v4/n2/fig_tab/nprot.2008.227_F1.html
- So for ssDNA, if we have a cell expressing RecT, it can be transformed with recombineering oligonucleotides. The green circle represent a bacterial cell and there’s a expression vector that contains RecT. Wavy black lines are the recombineering oligo and the red dot represent a zone with some mutation, or can be a delation zone. The black double helix represents chromosomal DNA. It is known that Rec T binds the oligo binds the DNA at the replication fork during the recombination, to his target site, the highest efficiency is when is complementary to the lagging strand and not the leading strand *because it’s more easily annealed by RecT for the larger gaps present in the lagging strand due to okazaki fragments). If it works, after recombination 1 of the 2 strands will have the modification.
- This is the different things I will show. First of all try to explain the recombineering technique and how it works. Then I will present you my project related with recombineering, the results , the problems and we can discuss them and consider new experiments. And finally I prepared a recombineering protocol
- So the aim of my project is testing the recombineering system, for this I use a small RNA, CesX1 present in l.lactis genome. I tried to make a deletion in CesX1 sequence of 30 nucleotides. So I needed to use a RecT expression vector but pJP005 is not curable, is really stable and it will be difficult in the end of the experiment to eliminate the plasmid from the cell. My first work was construct a plasmid curable from L. lactis with recombineering system, for this I cloned the recombineering fragment of pJP005 into pGHost plasmid.
- This is the different things I will show. First of all try to explain the recombineering technique and how it works. Then I will present you my project related with recombineering, the results , the problems and we can discuss them and consider new experiments. And finally I prepared a recombineering protocol
- I Followed a restriction protocol for cloning, I restricted pGHost and the amplicon with BamHI and XhoI and after 30 minutes I purificated the fragments and ligated them. The DNA was concentrated and purified, ready for transformation. Finally, the transformation of the recombinant plasmid into l.lactis NZ9000 was done with an electroporation and it was verifyed by cPCR. These are the results after cPCR. The first to columns are samples 3 and 20, positive samples for the transformation, the third column is a negative sample, and the last column is a negative control, with the original plasmid pGHOst. So the 2 first columns have a biggest size due to the nisin-promoter-RecT-insert and the other ones doesn’t have the insert. It’s a difference of 1,5 kb
- I sequenced both samples 3 and 20 by sending to macrogen the plasmid isolated mixed with the FW primer of cPCR and also the plasmid with the RV primer. I compare the sequenced provided by macrogen with the sequence of nisinpromoter:recT fragment and they matched exactly. With this, I can say that I have the plasmid desired.
- I made a complete protocol for ssDNA recombineering, that maybe we can upload on molgen website or something. So the cells have to be grown overnight in SM17 glucose and glycin with 5 micrograms/ml chloramphenicol. Next day you inoculate the ON culture in SM17GG (100:5) and let it grow until a O.D between 0.2 and 0.3, when you can induce it adding nisin. After 30 minuts you do some washings and cells are ready for electroporation or can be stored at -80 For the best efficiency it’s important that the oligo is identical in sequence to the lagging stran, to have 5 PT linkages at 5’ termini, and it will be ordered like this () And also is important the size of the oligo, the part that fits in each side has to be about 40 and 45 nucleotides. 100 micrograms of competent cells can be transformed with 100 micrograms of oligonucleotide and inmediately incubated in recobery medium. After 2 hours we can plate them and when the colonies start to grow we can make a cPCR and find mixed genotype colonies (wt and mutant) and a second cPCR to fins a pure genotype mutant.
- Once I have the plasmid, I started with the recombineering. This is the oligo that I design for Recombineering, to delete Ces X1. so on both sides we have complementnary nucleotides with Ces X1 sequence and in the middle we have a delation zone Complementary zone to CesX1 gene / deletion or mutation zone / 40-45 n complementaries to CesX1 gene. In a way that during replication RecT will bind the oligo to the lagging strand and transcription will occure with the modification of the sequence in one of the strands. As I said the highest efficiency is with oligos complementary to the lagging strand and it also increase the efficiency in l.lactis when the first 5 nuclotides on 5’end has PT linkages. They are nucleotides witch the oxygen atom have been replaced for a sulfur atom in the phosphate backbone. *PTOs are oligonucleotides that contain a phosphorothioate (PT) bond by replacing an oxygen atom with a sulfur atom in the phosphate backbone of the oligonucleotide, which yields a nuclease-resistant oligonucleotide.
- Once I have the plasmid, I started with the recombineering. This is the oligo that I design for Recombineering, to delete Ces X1. so on both sides we have complementnary nucleotides with Ces X1 sequence and in the middle we have a delation zone Complementary zone to CesX1 gene / deletion or mutation zone / 40-45 n complementaries to CesX1 gene. In a way that during replication RecT will bind the oligo to the lagging strand and transcription will occure with the modification of the sequence in one of the strands. As I said the highest efficiency is with oligos complementary to the lagging strand and it also increase the efficiency in l.lactis when the first 5 nuclotides on 5’end has PT linkages. They are nucleotides witch the oxygen atom have been replaced for a sulfur atom in the phosphate backbone. *PTOs are oligonucleotides that contain a phosphorothioate (PT) bond by replacing an oxygen atom with a sulfur atom in the phosphate backbone of the oligonucleotide, which yields a nuclease-resistant oligonucleotide.
- Once I have the plasmid, I started with the recombineering. This is the oligo that I design for Recombineering, to delete Ces X1. so on both sides we have complementnary nucleotides with Ces X1 sequence and in the middle we have a delation zone Complementary zone to CesX1 gene / deletion or mutation zone / 40-45 n complementaries to CesX1 gene. In a way that during replication RecT will bind the oligo to the lagging strand and transcription will occure with the modification of the sequence in one of the strands. As I said the highest efficiency is with oligos complementary to the lagging strand and it also increase the efficiency in l.lactis when the first 5 nuclotides on 5’end has PT linkages. They are nucleotides witch the oxygen atom have been replaced for a sulfur atom in the phosphate backbone. *PTOs are oligonucleotides that contain a phosphorothioate (PT) bond by replacing an oxygen atom with a sulfur atom in the phosphate backbone of the oligonucleotide, which yields a nuclease-resistant oligonucleotide.
- This is the different things I will show. First of all try to explain the recombineering technique and how it works. Then I will present you my project related with recombineering, the results , the problems and we can discuss them and consider new experiments. And finally I prepared a recombineering protocol
- So which is the problem? Actually there were problems with the the grow, the grow of the strain was really poor , and I tried with different media so maybe the nisin induction or RecT production was not efficicent. was Is the efficiency that low that I couldn’t find any colony? Or maybe Cesx1 can’t be delated because its rule is essential in l.lactis.... The problem of this technique it’s that the screening is difficult. Is 100 micrograms enough DNA? Is 500 micrograms too much?