SlideShare a Scribd company logo
1 of 12
Download to read offline
Biomolecular design laboratory
11491014 Yusuke Sakashita
Effect of DNA structure on
graphene oxide–DNA
interaction
Property of graphene oxide (GO)
Properties of GO
○quenching fluorescence due to large aromatic surface
○Water soluble due to functional groups introduced on GO
○Interaction with biomolecules
Graphene
Oxidization
Graphene oxide (GO)
GO is promising material for biological applications.
R. Li et al., Int. J. Mol. Sci., 14, 12863-12872 (2013).
M. Wu et al., Langmuir, 27, 2731–2738 (2011).
Z. Zhang et al., Analyst, 139, 4805-4809 (2014).
H. Volvusha et al., J. Phys. Chem. Lett, 4, 3710−3718 (2013).
Biosencer based on GO for detection of DNA
Adsorption
Probe DNA
with FAM
Desorption
Target DNA
1. π-π stacking
2. Hydrogen bonding
GO-DNA interaction is useful to develop biosensors.
Fluorescence
quenching
Fluorescence
recovery
Biosencer based on GO for detection of DNA
GO-DNA interaction is useful to develop biosensors.
Z. Zhang et al., Analyst, 139, 4805-4809 (2014).
H. Volvusha et al., J. Phys. Chem. Lett, 4, 3710−3718 (2013).
Adsorption
ssDNA with FAM
Desorption
Target DNA
1. π-π stacking
2. Hydrogen bonding
Fluorescence
quenching
Fluorescence
recovery
Mechanism of interaction between GO and DNA
The mechanism of GO–DNA interaction has been
elucidated for single strand DNA.
The interaction between DNA and GO was performed
by some mechanisms.
T. Paul et al., J. Phys. Chem. B, 20(45),11628-11636 (2016).
Problem
How is the secondary structure involved in the interaction
between GO and DNA?
Base paired
region
Unpaired
region
Hairpin loop
DNA
G-quadruplex
DNA
Single strand
DNA
Hoogsteen
Base pair
Problem
How is the secondary structure involved in the interaction
between GO and DNA?
Base paired
region
Unpaired
region
Hairpin loop
DNA
G-quadruplex
DNASingle strand
DNA
Hoogsteen
Base pair
Materials and methods
Probe DNA : ssDNA (random coil)
5’- [FAM] - GATCCTACTGCTTTCTCTATCG -3’
hpDNA (hairpin loop)
5’- [FAM] - TTCTCTTCTTTTTAGAAGAGAA -3’
gqDNA (G-quadruplex)
5’- [FAM] - AGGGTTAGGGTTAGGGTTAGGG -3’
Target DNA : T-ssDNA (random coil)
5’- ACT GGG GGA GGC GCA AGG -3’
T-hpDNA (hairpin loop)
5’- TTC TCT TTT TAG AGA A -3’
Molecular weight of GO unit
Τ𝟕𝟐. 𝟎𝟔 𝟐 = 𝟑𝟔. 𝟎𝟑
ssDNA hpDNA gqDNA
Table. Dissociation constant (𝐾 𝑑) of the probeDNAs with
GO at 24℃ in 100 mM NaCl and 50 mM Tris buffer.
𝑭 = −∆𝑭
𝑮𝑶 𝒏
𝑲 𝒅
𝒏
+ 𝑮𝑶 𝒏
+ 𝑭𝒊𝒏𝒕
∆𝑭 : Final fluorescence intensity change
𝑭𝒊𝒏𝒕 : Initial fluorescence intensity
𝑲 𝒅 : Dissociation constant
n : Hill constant
0
5000
10000
15000
20000
503 511 519 527 535 543 551 559
probe-DNAs
Fluorescenceintencity
GO (mM)
0 mM GO
1 mM
Figure. Fluorecsence spectra of the 5 nM FAM-labeled
ssDNA with 0 – 1 mM GO in 100 mM NaCl and 50 mM Tris
buffer (left).
Effects of the structure of probe DNA
on the GO–DNA adsorption
Kd (mM) n
ssDNA 0.57 ± 0.005 2.2 ± 0.4
hpDNA 0.13 ± 0.008 2.6 ± 0.4
gqDNA 0.091 ± 0.018 1.5 ± 0.5
Secondary structure does not affext the GO-DNA adsorption.
⇒ DNAs may not form secondary structure on GO surface.
Effects of salt concentration
on the GO–DNA adsorption
Figure. Fluorescence intensity of 5 nM probe-ssDNA
(left), probe-hpDNA (right) and 0.001 -1 mM GO in a
0(yellow), 10(red), 30(blue), 50(green), 80(violet),
100(orange) mM NaCl and 50 mM Tris buffer (pH 7.5).
ssDNA hpDNA
NaCl
(mM)
Kd
(mM)
n Kd
(mM)
n
0 0.13±0.02 2.1±0.6 0.12±0.02 2.1±0.6
10 0.10±0.02 2.4±0.7 0.27±0.04 3.6±1.3
30 0.072±0.015 1.5±0.4 0.17±0.02 2.6±0.5
50 0.072±0.008 1.8±0.4 0.13±0.007 3.0±0.4
80 0.015±0.004 0.82±0.16 0.11±0.01 1.8±0.4
100 0.056±0.35 2.1±0.4 0.13±0.008 2.6±0.4
F.I.at520nm
Salt concentration does not affect the GO-DNA adsorption.
⇒ Electrostatic repulsion between DNA and GO
does not inhibit the GO-DNA adsorption.
F.I.at520nm
Table 2. Dissociation constnt (Kd) and hill coeffient of
the GO-DNA adsorption with various salt concentration
0
1000
2000
3000
4000
5000
6000
0 200 400 600 800 1000
probe-DNAs and target-DNAs
F.I.at520nm
target-DNA (nM)
ssnc
ƒGƒ‰•[’l
320.61301.17m1
0.221630.68979m2
22756538.6m3
193.18319.93m4
NA2.1554e+5ƒJƒC‚Q•æ
NA0.99497R
sshp
ƒGƒ‰•[’l
891.09397.47m1
0.203010.49785m2
1580.22816.2m3
109.75300.05m4
NA53499ƒJƒC‚Q•æ
NA0.99061R
hpnc
ƒGƒ‰•[’l
143.08207.86m1
0.170950.69479m2
1240.95560.6m3
146.94242.11m4
NA1.1948e+5ƒJƒC‚Q•æ
NA0.9967R
hphp
ƒGƒ‰•[’l
1696.9719.72m1
0.241360.57993m2
2390.93368.9m3
99.086282.68m4
NA50597ƒJƒC‚Q•æ
NA0.99247R
gqnc
ƒGƒ‰•[’l
6.070270.98m1
0.114391.1058m2
151.433884.5m3
56.612650.72m4
NA24152ƒJƒC‚Q•æ
NA0.99928R
gqhp
ƒGƒ‰•[’l
373.26118.73m1
0.682620.60882m2
19622174.8m3
342.24359.33m4
NA5.4954e+5ƒJƒC‚Q•æ
NA0.91777R
Figure. Fluorescence intensity at 520 nm of ssDNA and
T-ssDNA(yellow),ssDNA and T-hpDNA(red), hpDNA and
T-ssDNA(sky blue), hpDNA and T-hpDNA(green), gqDNA
and T-ssDNA(orange) and gqDNA and T-hpDNA(violet) in
100 mM NaCl and 50 mM Tris buffer.
𝑭 = −∆𝑭
𝑫𝑵𝑨 𝒏
𝑲 𝟎.𝟓
𝒏
+ 𝑫𝑵𝑨 𝒏
+ 𝑭𝒊𝒏𝒕
Effects of the structure of target DNAs
on the GO–DNA desorption
Probe DNA Target DNA K0.5 (nM) n
ssDNA T-ssDNA 3.0×102 0.69
T-hpDNA 4.0×102 0.50
hpDNA
T-ssDNA 2.1×102 0.70
T-hpDNA 7.2×102 0.58
gqDNA
T-ssDNA 7.1×102 1.1
T-hpDNA 1.2×102 0.61
●ssDNA + T-ssDNA
●hpDNA + T-ssDNA
●gqDAN + T-ssDNA
●ssDNA + T-hpDNA
●hpDNA + T-hpDNA
●gqDNA + T-hpDNA
DNA desorption from GO depends on
secondary structure of target DNA.
Discussion and conclusions
The DNA–GO adsorption does not depend on probe DNA structure
and salt concentration.
DNA may be denatured when it adsorbs onto GO surface.
Secondary structure of the target DNA largely affect the its desorption
from GO.
Sensitivity of target DNA detection may be controlled by its
structure.
ssDNA hpDNA gqDNA
It is necessary to elucidate the adsorption / desorption mechanisms of
DNA forming secondary structures. More systematic and kinetic
studies will be performed.
Future works

More Related Content

What's hot

Antibacterial Application of Novel Mixed-Ligand Dithiocarbamate Complexes of ...
Antibacterial Application of Novel Mixed-Ligand Dithiocarbamate Complexes of ...Antibacterial Application of Novel Mixed-Ligand Dithiocarbamate Complexes of ...
Antibacterial Application of Novel Mixed-Ligand Dithiocarbamate Complexes of ...IOSR Journals
 
1. Synthesis of Polystyrene-Silica Composite Particles via One-Step Nanoparti...
1.	Synthesis of Polystyrene-Silica Composite Particles via One-Step Nanoparti...1.	Synthesis of Polystyrene-Silica Composite Particles via One-Step Nanoparti...
1. Synthesis of Polystyrene-Silica Composite Particles via One-Step Nanoparti...huanma
 
Lab talk 020710 comparing bac r_rel 1 with e coli rrel 1 for use in fret assay
Lab talk 020710 comparing bac r_rel 1 with e coli rrel 1 for use in fret assayLab talk 020710 comparing bac r_rel 1 with e coli rrel 1 for use in fret assay
Lab talk 020710 comparing bac r_rel 1 with e coli rrel 1 for use in fret assayLaurence Dawkins-Hall
 
PhD Thesis Presentation_RT
PhD Thesis Presentation_RTPhD Thesis Presentation_RT
PhD Thesis Presentation_RTRaquel Teixeira
 
Preparation of Mixed Phase (Anatase/Rutile) TiO2 Nanopowder by Simple Sol Gel...
Preparation of Mixed Phase (Anatase/Rutile) TiO2 Nanopowder by Simple Sol Gel...Preparation of Mixed Phase (Anatase/Rutile) TiO2 Nanopowder by Simple Sol Gel...
Preparation of Mixed Phase (Anatase/Rutile) TiO2 Nanopowder by Simple Sol Gel...IJLT EMAS
 
Ph.D. Project Summary
Ph.D. Project SummaryPh.D. Project Summary
Ph.D. Project Summarybillyfleming
 
Dr. Jesús Jiménez Barbero - Simposio Internacional 'Química: respuestas para ...
Dr. Jesús Jiménez Barbero - Simposio Internacional 'Química: respuestas para ...Dr. Jesús Jiménez Barbero - Simposio Internacional 'Química: respuestas para ...
Dr. Jesús Jiménez Barbero - Simposio Internacional 'Química: respuestas para ...Fundación Ramón Areces
 
News Release: Commerce Resources Corp. (TSXv: CCE) Updates Metallurgy Test Wo...
News Release: Commerce Resources Corp. (TSXv: CCE) Updates Metallurgy Test Wo...News Release: Commerce Resources Corp. (TSXv: CCE) Updates Metallurgy Test Wo...
News Release: Commerce Resources Corp. (TSXv: CCE) Updates Metallurgy Test Wo...Commerce Resources Corp. (TSXv:CCE)
 
Ibu validation(tanmoy) new
Ibu  validation(tanmoy)  newIbu  validation(tanmoy)  new
Ibu validation(tanmoy) newTanmoy Das
 
Kai Bester - Aarhus University, Denmark - Removal of pharmaceuticals in diffe...
Kai Bester - Aarhus University, Denmark - Removal of pharmaceuticals in diffe...Kai Bester - Aarhus University, Denmark - Removal of pharmaceuticals in diffe...
Kai Bester - Aarhus University, Denmark - Removal of pharmaceuticals in diffe...European Sustainable Phosphorus Platform
 
Challenges in measuring comparability of aggregation and conformation for bio...
Challenges in measuring comparability of aggregation and conformation for bio...Challenges in measuring comparability of aggregation and conformation for bio...
Challenges in measuring comparability of aggregation and conformation for bio...KBI Biopharma
 
Poster-mAbChem-ppt file
Poster-mAbChem-ppt filePoster-mAbChem-ppt file
Poster-mAbChem-ppt fileRongliang Lou
 
Biotechnology experiments 2nd semester (LNMU Darbhanga)
Biotechnology experiments  2nd semester (LNMU Darbhanga)Biotechnology experiments  2nd semester (LNMU Darbhanga)
Biotechnology experiments 2nd semester (LNMU Darbhanga)Abhishek Kaushik
 
4' bromo-2'-methylacetophenone
4' bromo-2'-methylacetophenone4' bromo-2'-methylacetophenone
4' bromo-2'-methylacetophenoneSwasti Chemex
 
EPA Summer 2013_Portable Pharmacokinetic Parameter Prediction Tool
EPA Summer 2013_Portable Pharmacokinetic Parameter Prediction ToolEPA Summer 2013_Portable Pharmacokinetic Parameter Prediction Tool
EPA Summer 2013_Portable Pharmacokinetic Parameter Prediction ToolEmerald Feng
 
Darshi_MSthesis_presentatio_for linkedIn
Darshi_MSthesis_presentatio_for linkedInDarshi_MSthesis_presentatio_for linkedIn
Darshi_MSthesis_presentatio_for linkedInDarshi Dissanayake
 

What's hot (20)

Antibacterial Application of Novel Mixed-Ligand Dithiocarbamate Complexes of ...
Antibacterial Application of Novel Mixed-Ligand Dithiocarbamate Complexes of ...Antibacterial Application of Novel Mixed-Ligand Dithiocarbamate Complexes of ...
Antibacterial Application of Novel Mixed-Ligand Dithiocarbamate Complexes of ...
 
1. Synthesis of Polystyrene-Silica Composite Particles via One-Step Nanoparti...
1.	Synthesis of Polystyrene-Silica Composite Particles via One-Step Nanoparti...1.	Synthesis of Polystyrene-Silica Composite Particles via One-Step Nanoparti...
1. Synthesis of Polystyrene-Silica Composite Particles via One-Step Nanoparti...
 
Electrophoresis
ElectrophoresisElectrophoresis
Electrophoresis
 
Lab talk 020710 comparing bac r_rel 1 with e coli rrel 1 for use in fret assay
Lab talk 020710 comparing bac r_rel 1 with e coli rrel 1 for use in fret assayLab talk 020710 comparing bac r_rel 1 with e coli rrel 1 for use in fret assay
Lab talk 020710 comparing bac r_rel 1 with e coli rrel 1 for use in fret assay
 
PhD Thesis Presentation_RT
PhD Thesis Presentation_RTPhD Thesis Presentation_RT
PhD Thesis Presentation_RT
 
Preparation of Mixed Phase (Anatase/Rutile) TiO2 Nanopowder by Simple Sol Gel...
Preparation of Mixed Phase (Anatase/Rutile) TiO2 Nanopowder by Simple Sol Gel...Preparation of Mixed Phase (Anatase/Rutile) TiO2 Nanopowder by Simple Sol Gel...
Preparation of Mixed Phase (Anatase/Rutile) TiO2 Nanopowder by Simple Sol Gel...
 
Ph.D. Project Summary
Ph.D. Project SummaryPh.D. Project Summary
Ph.D. Project Summary
 
Isotopic labeling
Isotopic labelingIsotopic labeling
Isotopic labeling
 
Dr. Jesús Jiménez Barbero - Simposio Internacional 'Química: respuestas para ...
Dr. Jesús Jiménez Barbero - Simposio Internacional 'Química: respuestas para ...Dr. Jesús Jiménez Barbero - Simposio Internacional 'Química: respuestas para ...
Dr. Jesús Jiménez Barbero - Simposio Internacional 'Química: respuestas para ...
 
News Release: Commerce Resources Corp. (TSXv: CCE) Updates Metallurgy Test Wo...
News Release: Commerce Resources Corp. (TSXv: CCE) Updates Metallurgy Test Wo...News Release: Commerce Resources Corp. (TSXv: CCE) Updates Metallurgy Test Wo...
News Release: Commerce Resources Corp. (TSXv: CCE) Updates Metallurgy Test Wo...
 
Ibu validation(tanmoy) new
Ibu  validation(tanmoy)  newIbu  validation(tanmoy)  new
Ibu validation(tanmoy) new
 
Kai Bester - Aarhus University, Denmark - Removal of pharmaceuticals in diffe...
Kai Bester - Aarhus University, Denmark - Removal of pharmaceuticals in diffe...Kai Bester - Aarhus University, Denmark - Removal of pharmaceuticals in diffe...
Kai Bester - Aarhus University, Denmark - Removal of pharmaceuticals in diffe...
 
Challenges in measuring comparability of aggregation and conformation for bio...
Challenges in measuring comparability of aggregation and conformation for bio...Challenges in measuring comparability of aggregation and conformation for bio...
Challenges in measuring comparability of aggregation and conformation for bio...
 
Poster-mAbChem-ppt file
Poster-mAbChem-ppt filePoster-mAbChem-ppt file
Poster-mAbChem-ppt file
 
Biotechnology experiments 2nd semester (LNMU Darbhanga)
Biotechnology experiments  2nd semester (LNMU Darbhanga)Biotechnology experiments  2nd semester (LNMU Darbhanga)
Biotechnology experiments 2nd semester (LNMU Darbhanga)
 
4' bromo-2'-methylacetophenone
4' bromo-2'-methylacetophenone4' bromo-2'-methylacetophenone
4' bromo-2'-methylacetophenone
 
Final Report
Final ReportFinal Report
Final Report
 
Ijetr011832
Ijetr011832Ijetr011832
Ijetr011832
 
EPA Summer 2013_Portable Pharmacokinetic Parameter Prediction Tool
EPA Summer 2013_Portable Pharmacokinetic Parameter Prediction ToolEPA Summer 2013_Portable Pharmacokinetic Parameter Prediction Tool
EPA Summer 2013_Portable Pharmacokinetic Parameter Prediction Tool
 
Darshi_MSthesis_presentatio_for linkedIn
Darshi_MSthesis_presentatio_for linkedInDarshi_MSthesis_presentatio_for linkedIn
Darshi_MSthesis_presentatio_for linkedIn
 

Similar to 研究テーマ概要 坂下裕介

Oxidative stress response of Daphnia magna exposed to silver nanoparticles - ...
Oxidative stress response of Daphnia magna exposed to silver nanoparticles - ...Oxidative stress response of Daphnia magna exposed to silver nanoparticles - ...
Oxidative stress response of Daphnia magna exposed to silver nanoparticles - ...Tea Crnkovi?
 
PNAS-1998-Barawkar-11047-52
PNAS-1998-Barawkar-11047-52PNAS-1998-Barawkar-11047-52
PNAS-1998-Barawkar-11047-52Dinesh Barawkar
 
Nanostructured Electromaterials for Energy Applications
Nanostructured Electromaterials for Energy ApplicationsNanostructured Electromaterials for Energy Applications
Nanostructured Electromaterials for Energy ApplicationsTrinity College Dublin
 
Pawan ncnre presentation final r
Pawan ncnre presentation final rPawan ncnre presentation final r
Pawan ncnre presentation final rPawan Kumar
 
Nucleic Acids Research (1995) 23, 159-164
Nucleic Acids Research (1995) 23, 159-164Nucleic Acids Research (1995) 23, 159-164
Nucleic Acids Research (1995) 23, 159-164Dinesh Barawkar
 
Au-Pd Supported on 3D Hybrid Strontium-Substituted Lanthanum Manganite Perovs...
Au-Pd Supported on 3D Hybrid Strontium-Substituted Lanthanum Manganite Perovs...Au-Pd Supported on 3D Hybrid Strontium-Substituted Lanthanum Manganite Perovs...
Au-Pd Supported on 3D Hybrid Strontium-Substituted Lanthanum Manganite Perovs...Hamid Arandiyan
 
NaI:Tl-based radiation detector with improved light output and energy resolution
NaI:Tl-based radiation detector with improved light output and energy resolutionNaI:Tl-based radiation detector with improved light output and energy resolution
NaI:Tl-based radiation detector with improved light output and energy resolutionLawrence Berkeley National Laboratory
 
Tyler Johnston Thesis Defence
Tyler Johnston Thesis DefenceTyler Johnston Thesis Defence
Tyler Johnston Thesis DefenceTyler Johnston
 
Acetone gas sensors based on graphene zn fe2o4 composite prepared
Acetone gas sensors based on graphene zn fe2o4 composite preparedAcetone gas sensors based on graphene zn fe2o4 composite prepared
Acetone gas sensors based on graphene zn fe2o4 composite preparedUğur Acar
 
Sulfonium-Ion Glycosidase Inhibitors and Their Derivatives
Sulfonium-Ion Glycosidase Inhibitors and Their DerivativesSulfonium-Ion Glycosidase Inhibitors and Their Derivatives
Sulfonium-Ion Glycosidase Inhibitors and Their DerivativesAndeChennaiah
 
Synthesis of 2-aminocyclopent-1-ene-1-carbodithioic acid (ACA) Capped Silver ...
Synthesis of 2-aminocyclopent-1-ene-1-carbodithioic acid (ACA) Capped Silver ...Synthesis of 2-aminocyclopent-1-ene-1-carbodithioic acid (ACA) Capped Silver ...
Synthesis of 2-aminocyclopent-1-ene-1-carbodithioic acid (ACA) Capped Silver ...IJERA Editor
 
Poster For Mrs Spring 2010
Poster For Mrs Spring 2010Poster For Mrs Spring 2010
Poster For Mrs Spring 2010anindarupa
 
Babloo presentation
Babloo presentationBabloo presentation
Babloo presentationaaaa zzzz
 
Genetic Mapping of QTL controlling salt tolerance and glucosinolates in Brass...
Genetic Mapping of QTL controlling salt tolerance and glucosinolates in Brass...Genetic Mapping of QTL controlling salt tolerance and glucosinolates in Brass...
Genetic Mapping of QTL controlling salt tolerance and glucosinolates in Brass...PGS
 
The chelate formation of thorium with 1, 2-naphthoquinone, 1-oxime
The chelate formation of thorium with 1, 2-naphthoquinone, 1-oximeThe chelate formation of thorium with 1, 2-naphthoquinone, 1-oxime
The chelate formation of thorium with 1, 2-naphthoquinone, 1-oximeIOSR Journals
 
Roadshow2014 - presentazione Giovanna Fragneto (4 giugno 2014)
Roadshow2014 - presentazione Giovanna Fragneto (4 giugno 2014)Roadshow2014 - presentazione Giovanna Fragneto (4 giugno 2014)
Roadshow2014 - presentazione Giovanna Fragneto (4 giugno 2014)Roadshow2014
 

Similar to 研究テーマ概要 坂下裕介 (20)

Oxidative stress response of Daphnia magna exposed to silver nanoparticles - ...
Oxidative stress response of Daphnia magna exposed to silver nanoparticles - ...Oxidative stress response of Daphnia magna exposed to silver nanoparticles - ...
Oxidative stress response of Daphnia magna exposed to silver nanoparticles - ...
 
PNAS-1998-Barawkar-11047-52
PNAS-1998-Barawkar-11047-52PNAS-1998-Barawkar-11047-52
PNAS-1998-Barawkar-11047-52
 
Nanostructured Electromaterials for Energy Applications
Nanostructured Electromaterials for Energy ApplicationsNanostructured Electromaterials for Energy Applications
Nanostructured Electromaterials for Energy Applications
 
Pawan ncnre presentation final r
Pawan ncnre presentation final rPawan ncnre presentation final r
Pawan ncnre presentation final r
 
Nucleic Acids Research (1995) 23, 159-164
Nucleic Acids Research (1995) 23, 159-164Nucleic Acids Research (1995) 23, 159-164
Nucleic Acids Research (1995) 23, 159-164
 
5
55
5
 
Au-Pd Supported on 3D Hybrid Strontium-Substituted Lanthanum Manganite Perovs...
Au-Pd Supported on 3D Hybrid Strontium-Substituted Lanthanum Manganite Perovs...Au-Pd Supported on 3D Hybrid Strontium-Substituted Lanthanum Manganite Perovs...
Au-Pd Supported on 3D Hybrid Strontium-Substituted Lanthanum Manganite Perovs...
 
Natural Radioactivity
Natural RadioactivityNatural Radioactivity
Natural Radioactivity
 
NaI:Tl-based radiation detector with improved light output and energy resolution
NaI:Tl-based radiation detector with improved light output and energy resolutionNaI:Tl-based radiation detector with improved light output and energy resolution
NaI:Tl-based radiation detector with improved light output and energy resolution
 
Tyler Johnston Thesis Defence
Tyler Johnston Thesis DefenceTyler Johnston Thesis Defence
Tyler Johnston Thesis Defence
 
Acetone gas sensors based on graphene zn fe2o4 composite prepared
Acetone gas sensors based on graphene zn fe2o4 composite preparedAcetone gas sensors based on graphene zn fe2o4 composite prepared
Acetone gas sensors based on graphene zn fe2o4 composite prepared
 
2006_JSC
2006_JSC2006_JSC
2006_JSC
 
Sulfonium-Ion Glycosidase Inhibitors and Their Derivatives
Sulfonium-Ion Glycosidase Inhibitors and Their DerivativesSulfonium-Ion Glycosidase Inhibitors and Their Derivatives
Sulfonium-Ion Glycosidase Inhibitors and Their Derivatives
 
Temozolomide And Doxorubicin Delivery
Temozolomide And Doxorubicin DeliveryTemozolomide And Doxorubicin Delivery
Temozolomide And Doxorubicin Delivery
 
Synthesis of 2-aminocyclopent-1-ene-1-carbodithioic acid (ACA) Capped Silver ...
Synthesis of 2-aminocyclopent-1-ene-1-carbodithioic acid (ACA) Capped Silver ...Synthesis of 2-aminocyclopent-1-ene-1-carbodithioic acid (ACA) Capped Silver ...
Synthesis of 2-aminocyclopent-1-ene-1-carbodithioic acid (ACA) Capped Silver ...
 
Poster For Mrs Spring 2010
Poster For Mrs Spring 2010Poster For Mrs Spring 2010
Poster For Mrs Spring 2010
 
Babloo presentation
Babloo presentationBabloo presentation
Babloo presentation
 
Genetic Mapping of QTL controlling salt tolerance and glucosinolates in Brass...
Genetic Mapping of QTL controlling salt tolerance and glucosinolates in Brass...Genetic Mapping of QTL controlling salt tolerance and glucosinolates in Brass...
Genetic Mapping of QTL controlling salt tolerance and glucosinolates in Brass...
 
The chelate formation of thorium with 1, 2-naphthoquinone, 1-oxime
The chelate formation of thorium with 1, 2-naphthoquinone, 1-oximeThe chelate formation of thorium with 1, 2-naphthoquinone, 1-oxime
The chelate formation of thorium with 1, 2-naphthoquinone, 1-oxime
 
Roadshow2014 - presentazione Giovanna Fragneto (4 giugno 2014)
Roadshow2014 - presentazione Giovanna Fragneto (4 giugno 2014)Roadshow2014 - presentazione Giovanna Fragneto (4 giugno 2014)
Roadshow2014 - presentazione Giovanna Fragneto (4 giugno 2014)
 

Recently uploaded

Kantar AI Summit- Under Embargo till Wednesday, 24th April 2024, 4 PM, IST.pdf
Kantar AI Summit- Under Embargo till Wednesday, 24th April 2024, 4 PM, IST.pdfKantar AI Summit- Under Embargo till Wednesday, 24th April 2024, 4 PM, IST.pdf
Kantar AI Summit- Under Embargo till Wednesday, 24th April 2024, 4 PM, IST.pdfSocial Samosa
 
Midocean dropshipping via API with DroFx
Midocean dropshipping via API with DroFxMidocean dropshipping via API with DroFx
Midocean dropshipping via API with DroFxolyaivanovalion
 
Ravak dropshipping via API with DroFx.pptx
Ravak dropshipping via API with DroFx.pptxRavak dropshipping via API with DroFx.pptx
Ravak dropshipping via API with DroFx.pptxolyaivanovalion
 
꧁❤ Greater Noida Call Girls Delhi ❤꧂ 9711199171 ☎️ Hard And Sexy Vip Call
꧁❤ Greater Noida Call Girls Delhi ❤꧂ 9711199171 ☎️ Hard And Sexy Vip Call꧁❤ Greater Noida Call Girls Delhi ❤꧂ 9711199171 ☎️ Hard And Sexy Vip Call
꧁❤ Greater Noida Call Girls Delhi ❤꧂ 9711199171 ☎️ Hard And Sexy Vip Callshivangimorya083
 
BabyOno dropshipping via API with DroFx.pptx
BabyOno dropshipping via API with DroFx.pptxBabyOno dropshipping via API with DroFx.pptx
BabyOno dropshipping via API with DroFx.pptxolyaivanovalion
 
dokumen.tips_chapter-4-transient-heat-conduction-mehmet-kanoglu.ppt
dokumen.tips_chapter-4-transient-heat-conduction-mehmet-kanoglu.pptdokumen.tips_chapter-4-transient-heat-conduction-mehmet-kanoglu.ppt
dokumen.tips_chapter-4-transient-heat-conduction-mehmet-kanoglu.pptSonatrach
 
Week-01-2.ppt BBB human Computer interaction
Week-01-2.ppt BBB human Computer interactionWeek-01-2.ppt BBB human Computer interaction
Week-01-2.ppt BBB human Computer interactionfulawalesam
 
Al Barsha Escorts $#$ O565212860 $#$ Escort Service In Al Barsha
Al Barsha Escorts $#$ O565212860 $#$ Escort Service In Al BarshaAl Barsha Escorts $#$ O565212860 $#$ Escort Service In Al Barsha
Al Barsha Escorts $#$ O565212860 $#$ Escort Service In Al BarshaAroojKhan71
 
Carero dropshipping via API with DroFx.pptx
Carero dropshipping via API with DroFx.pptxCarero dropshipping via API with DroFx.pptx
Carero dropshipping via API with DroFx.pptxolyaivanovalion
 
04242024_CCC TUG_Joins and Relationships
04242024_CCC TUG_Joins and Relationships04242024_CCC TUG_Joins and Relationships
04242024_CCC TUG_Joins and Relationshipsccctableauusergroup
 
Delhi Call Girls CP 9711199171 ☎✔👌✔ Whatsapp Hard And Sexy Vip Call
Delhi Call Girls CP 9711199171 ☎✔👌✔ Whatsapp Hard And Sexy Vip CallDelhi Call Girls CP 9711199171 ☎✔👌✔ Whatsapp Hard And Sexy Vip Call
Delhi Call Girls CP 9711199171 ☎✔👌✔ Whatsapp Hard And Sexy Vip Callshivangimorya083
 
Smarteg dropshipping via API with DroFx.pptx
Smarteg dropshipping via API with DroFx.pptxSmarteg dropshipping via API with DroFx.pptx
Smarteg dropshipping via API with DroFx.pptxolyaivanovalion
 
April 2024 - Crypto Market Report's Analysis
April 2024 - Crypto Market Report's AnalysisApril 2024 - Crypto Market Report's Analysis
April 2024 - Crypto Market Report's Analysismanisha194592
 
VidaXL dropshipping via API with DroFx.pptx
VidaXL dropshipping via API with DroFx.pptxVidaXL dropshipping via API with DroFx.pptx
VidaXL dropshipping via API with DroFx.pptxolyaivanovalion
 
Industrialised data - the key to AI success.pdf
Industrialised data - the key to AI success.pdfIndustrialised data - the key to AI success.pdf
Industrialised data - the key to AI success.pdfLars Albertsson
 
Mature dropshipping via API with DroFx.pptx
Mature dropshipping via API with DroFx.pptxMature dropshipping via API with DroFx.pptx
Mature dropshipping via API with DroFx.pptxolyaivanovalion
 
CebaBaby dropshipping via API with DroFX.pptx
CebaBaby dropshipping via API with DroFX.pptxCebaBaby dropshipping via API with DroFX.pptx
CebaBaby dropshipping via API with DroFX.pptxolyaivanovalion
 

Recently uploaded (20)

Kantar AI Summit- Under Embargo till Wednesday, 24th April 2024, 4 PM, IST.pdf
Kantar AI Summit- Under Embargo till Wednesday, 24th April 2024, 4 PM, IST.pdfKantar AI Summit- Under Embargo till Wednesday, 24th April 2024, 4 PM, IST.pdf
Kantar AI Summit- Under Embargo till Wednesday, 24th April 2024, 4 PM, IST.pdf
 
Midocean dropshipping via API with DroFx
Midocean dropshipping via API with DroFxMidocean dropshipping via API with DroFx
Midocean dropshipping via API with DroFx
 
Ravak dropshipping via API with DroFx.pptx
Ravak dropshipping via API with DroFx.pptxRavak dropshipping via API with DroFx.pptx
Ravak dropshipping via API with DroFx.pptx
 
꧁❤ Greater Noida Call Girls Delhi ❤꧂ 9711199171 ☎️ Hard And Sexy Vip Call
꧁❤ Greater Noida Call Girls Delhi ❤꧂ 9711199171 ☎️ Hard And Sexy Vip Call꧁❤ Greater Noida Call Girls Delhi ❤꧂ 9711199171 ☎️ Hard And Sexy Vip Call
꧁❤ Greater Noida Call Girls Delhi ❤꧂ 9711199171 ☎️ Hard And Sexy Vip Call
 
BabyOno dropshipping via API with DroFx.pptx
BabyOno dropshipping via API with DroFx.pptxBabyOno dropshipping via API with DroFx.pptx
BabyOno dropshipping via API with DroFx.pptx
 
dokumen.tips_chapter-4-transient-heat-conduction-mehmet-kanoglu.ppt
dokumen.tips_chapter-4-transient-heat-conduction-mehmet-kanoglu.pptdokumen.tips_chapter-4-transient-heat-conduction-mehmet-kanoglu.ppt
dokumen.tips_chapter-4-transient-heat-conduction-mehmet-kanoglu.ppt
 
Week-01-2.ppt BBB human Computer interaction
Week-01-2.ppt BBB human Computer interactionWeek-01-2.ppt BBB human Computer interaction
Week-01-2.ppt BBB human Computer interaction
 
Delhi 99530 vip 56974 Genuine Escort Service Call Girls in Kishangarh
Delhi 99530 vip 56974 Genuine Escort Service Call Girls in  KishangarhDelhi 99530 vip 56974 Genuine Escort Service Call Girls in  Kishangarh
Delhi 99530 vip 56974 Genuine Escort Service Call Girls in Kishangarh
 
꧁❤ Aerocity Call Girls Service Aerocity Delhi ❤꧂ 9999965857 ☎️ Hard And Sexy ...
꧁❤ Aerocity Call Girls Service Aerocity Delhi ❤꧂ 9999965857 ☎️ Hard And Sexy ...꧁❤ Aerocity Call Girls Service Aerocity Delhi ❤꧂ 9999965857 ☎️ Hard And Sexy ...
꧁❤ Aerocity Call Girls Service Aerocity Delhi ❤꧂ 9999965857 ☎️ Hard And Sexy ...
 
Al Barsha Escorts $#$ O565212860 $#$ Escort Service In Al Barsha
Al Barsha Escorts $#$ O565212860 $#$ Escort Service In Al BarshaAl Barsha Escorts $#$ O565212860 $#$ Escort Service In Al Barsha
Al Barsha Escorts $#$ O565212860 $#$ Escort Service In Al Barsha
 
Carero dropshipping via API with DroFx.pptx
Carero dropshipping via API with DroFx.pptxCarero dropshipping via API with DroFx.pptx
Carero dropshipping via API with DroFx.pptx
 
04242024_CCC TUG_Joins and Relationships
04242024_CCC TUG_Joins and Relationships04242024_CCC TUG_Joins and Relationships
04242024_CCC TUG_Joins and Relationships
 
Delhi Call Girls CP 9711199171 ☎✔👌✔ Whatsapp Hard And Sexy Vip Call
Delhi Call Girls CP 9711199171 ☎✔👌✔ Whatsapp Hard And Sexy Vip CallDelhi Call Girls CP 9711199171 ☎✔👌✔ Whatsapp Hard And Sexy Vip Call
Delhi Call Girls CP 9711199171 ☎✔👌✔ Whatsapp Hard And Sexy Vip Call
 
E-Commerce Order PredictionShraddha Kamble.pptx
E-Commerce Order PredictionShraddha Kamble.pptxE-Commerce Order PredictionShraddha Kamble.pptx
E-Commerce Order PredictionShraddha Kamble.pptx
 
Smarteg dropshipping via API with DroFx.pptx
Smarteg dropshipping via API with DroFx.pptxSmarteg dropshipping via API with DroFx.pptx
Smarteg dropshipping via API with DroFx.pptx
 
April 2024 - Crypto Market Report's Analysis
April 2024 - Crypto Market Report's AnalysisApril 2024 - Crypto Market Report's Analysis
April 2024 - Crypto Market Report's Analysis
 
VidaXL dropshipping via API with DroFx.pptx
VidaXL dropshipping via API with DroFx.pptxVidaXL dropshipping via API with DroFx.pptx
VidaXL dropshipping via API with DroFx.pptx
 
Industrialised data - the key to AI success.pdf
Industrialised data - the key to AI success.pdfIndustrialised data - the key to AI success.pdf
Industrialised data - the key to AI success.pdf
 
Mature dropshipping via API with DroFx.pptx
Mature dropshipping via API with DroFx.pptxMature dropshipping via API with DroFx.pptx
Mature dropshipping via API with DroFx.pptx
 
CebaBaby dropshipping via API with DroFX.pptx
CebaBaby dropshipping via API with DroFX.pptxCebaBaby dropshipping via API with DroFX.pptx
CebaBaby dropshipping via API with DroFX.pptx
 

研究テーマ概要 坂下裕介

  • 1. Biomolecular design laboratory 11491014 Yusuke Sakashita Effect of DNA structure on graphene oxide–DNA interaction
  • 2. Property of graphene oxide (GO) Properties of GO ○quenching fluorescence due to large aromatic surface ○Water soluble due to functional groups introduced on GO ○Interaction with biomolecules Graphene Oxidization Graphene oxide (GO) GO is promising material for biological applications. R. Li et al., Int. J. Mol. Sci., 14, 12863-12872 (2013). M. Wu et al., Langmuir, 27, 2731–2738 (2011).
  • 3. Z. Zhang et al., Analyst, 139, 4805-4809 (2014). H. Volvusha et al., J. Phys. Chem. Lett, 4, 3710−3718 (2013). Biosencer based on GO for detection of DNA Adsorption Probe DNA with FAM Desorption Target DNA 1. π-π stacking 2. Hydrogen bonding GO-DNA interaction is useful to develop biosensors. Fluorescence quenching Fluorescence recovery
  • 4. Biosencer based on GO for detection of DNA GO-DNA interaction is useful to develop biosensors. Z. Zhang et al., Analyst, 139, 4805-4809 (2014). H. Volvusha et al., J. Phys. Chem. Lett, 4, 3710−3718 (2013). Adsorption ssDNA with FAM Desorption Target DNA 1. π-π stacking 2. Hydrogen bonding Fluorescence quenching Fluorescence recovery
  • 5. Mechanism of interaction between GO and DNA The mechanism of GO–DNA interaction has been elucidated for single strand DNA. The interaction between DNA and GO was performed by some mechanisms. T. Paul et al., J. Phys. Chem. B, 20(45),11628-11636 (2016).
  • 6. Problem How is the secondary structure involved in the interaction between GO and DNA? Base paired region Unpaired region Hairpin loop DNA G-quadruplex DNA Single strand DNA Hoogsteen Base pair
  • 7. Problem How is the secondary structure involved in the interaction between GO and DNA? Base paired region Unpaired region Hairpin loop DNA G-quadruplex DNASingle strand DNA Hoogsteen Base pair
  • 8. Materials and methods Probe DNA : ssDNA (random coil) 5’- [FAM] - GATCCTACTGCTTTCTCTATCG -3’ hpDNA (hairpin loop) 5’- [FAM] - TTCTCTTCTTTTTAGAAGAGAA -3’ gqDNA (G-quadruplex) 5’- [FAM] - AGGGTTAGGGTTAGGGTTAGGG -3’ Target DNA : T-ssDNA (random coil) 5’- ACT GGG GGA GGC GCA AGG -3’ T-hpDNA (hairpin loop) 5’- TTC TCT TTT TAG AGA A -3’ Molecular weight of GO unit Τ𝟕𝟐. 𝟎𝟔 𝟐 = 𝟑𝟔. 𝟎𝟑 ssDNA hpDNA gqDNA
  • 9. Table. Dissociation constant (𝐾 𝑑) of the probeDNAs with GO at 24℃ in 100 mM NaCl and 50 mM Tris buffer. 𝑭 = −∆𝑭 𝑮𝑶 𝒏 𝑲 𝒅 𝒏 + 𝑮𝑶 𝒏 + 𝑭𝒊𝒏𝒕 ∆𝑭 : Final fluorescence intensity change 𝑭𝒊𝒏𝒕 : Initial fluorescence intensity 𝑲 𝒅 : Dissociation constant n : Hill constant 0 5000 10000 15000 20000 503 511 519 527 535 543 551 559 probe-DNAs Fluorescenceintencity GO (mM) 0 mM GO 1 mM Figure. Fluorecsence spectra of the 5 nM FAM-labeled ssDNA with 0 – 1 mM GO in 100 mM NaCl and 50 mM Tris buffer (left). Effects of the structure of probe DNA on the GO–DNA adsorption Kd (mM) n ssDNA 0.57 ± 0.005 2.2 ± 0.4 hpDNA 0.13 ± 0.008 2.6 ± 0.4 gqDNA 0.091 ± 0.018 1.5 ± 0.5 Secondary structure does not affext the GO-DNA adsorption. ⇒ DNAs may not form secondary structure on GO surface.
  • 10. Effects of salt concentration on the GO–DNA adsorption Figure. Fluorescence intensity of 5 nM probe-ssDNA (left), probe-hpDNA (right) and 0.001 -1 mM GO in a 0(yellow), 10(red), 30(blue), 50(green), 80(violet), 100(orange) mM NaCl and 50 mM Tris buffer (pH 7.5). ssDNA hpDNA NaCl (mM) Kd (mM) n Kd (mM) n 0 0.13±0.02 2.1±0.6 0.12±0.02 2.1±0.6 10 0.10±0.02 2.4±0.7 0.27±0.04 3.6±1.3 30 0.072±0.015 1.5±0.4 0.17±0.02 2.6±0.5 50 0.072±0.008 1.8±0.4 0.13±0.007 3.0±0.4 80 0.015±0.004 0.82±0.16 0.11±0.01 1.8±0.4 100 0.056±0.35 2.1±0.4 0.13±0.008 2.6±0.4 F.I.at520nm Salt concentration does not affect the GO-DNA adsorption. ⇒ Electrostatic repulsion between DNA and GO does not inhibit the GO-DNA adsorption. F.I.at520nm Table 2. Dissociation constnt (Kd) and hill coeffient of the GO-DNA adsorption with various salt concentration
  • 11. 0 1000 2000 3000 4000 5000 6000 0 200 400 600 800 1000 probe-DNAs and target-DNAs F.I.at520nm target-DNA (nM) ssnc ƒGƒ‰•[’l 320.61301.17m1 0.221630.68979m2 22756538.6m3 193.18319.93m4 NA2.1554e+5ƒJƒC‚Q•æ NA0.99497R sshp ƒGƒ‰•[’l 891.09397.47m1 0.203010.49785m2 1580.22816.2m3 109.75300.05m4 NA53499ƒJƒC‚Q•æ NA0.99061R hpnc ƒGƒ‰•[’l 143.08207.86m1 0.170950.69479m2 1240.95560.6m3 146.94242.11m4 NA1.1948e+5ƒJƒC‚Q•æ NA0.9967R hphp ƒGƒ‰•[’l 1696.9719.72m1 0.241360.57993m2 2390.93368.9m3 99.086282.68m4 NA50597ƒJƒC‚Q•æ NA0.99247R gqnc ƒGƒ‰•[’l 6.070270.98m1 0.114391.1058m2 151.433884.5m3 56.612650.72m4 NA24152ƒJƒC‚Q•æ NA0.99928R gqhp ƒGƒ‰•[’l 373.26118.73m1 0.682620.60882m2 19622174.8m3 342.24359.33m4 NA5.4954e+5ƒJƒC‚Q•æ NA0.91777R Figure. Fluorescence intensity at 520 nm of ssDNA and T-ssDNA(yellow),ssDNA and T-hpDNA(red), hpDNA and T-ssDNA(sky blue), hpDNA and T-hpDNA(green), gqDNA and T-ssDNA(orange) and gqDNA and T-hpDNA(violet) in 100 mM NaCl and 50 mM Tris buffer. 𝑭 = −∆𝑭 𝑫𝑵𝑨 𝒏 𝑲 𝟎.𝟓 𝒏 + 𝑫𝑵𝑨 𝒏 + 𝑭𝒊𝒏𝒕 Effects of the structure of target DNAs on the GO–DNA desorption Probe DNA Target DNA K0.5 (nM) n ssDNA T-ssDNA 3.0×102 0.69 T-hpDNA 4.0×102 0.50 hpDNA T-ssDNA 2.1×102 0.70 T-hpDNA 7.2×102 0.58 gqDNA T-ssDNA 7.1×102 1.1 T-hpDNA 1.2×102 0.61 ●ssDNA + T-ssDNA ●hpDNA + T-ssDNA ●gqDAN + T-ssDNA ●ssDNA + T-hpDNA ●hpDNA + T-hpDNA ●gqDNA + T-hpDNA DNA desorption from GO depends on secondary structure of target DNA.
  • 12. Discussion and conclusions The DNA–GO adsorption does not depend on probe DNA structure and salt concentration. DNA may be denatured when it adsorbs onto GO surface. Secondary structure of the target DNA largely affect the its desorption from GO. Sensitivity of target DNA detection may be controlled by its structure. ssDNA hpDNA gqDNA It is necessary to elucidate the adsorption / desorption mechanisms of DNA forming secondary structures. More systematic and kinetic studies will be performed. Future works