Say whether each of the following statements is true (“T”) or false (“F”).
__ When modifying existing software, changes should follow the style of the original code.
__ In software testing, “path coverage” is another name for “statement coverage”.
__ The file command can be used to assess the type of a file.
__ The “o” in a pattern o+rx that can be given as as argument to chmod(1) stands for “owner”.
__ A downside to operating systems like LINUX and UNIX is that they still use the concept of
processes.
Other operating systems, such as Microsoft Windows, have done away with processes.
__ To send a signal to a process we use the >>> construct in the shell. For example, to send a
SIGKILL to a process with PID 7476, we would give the command
__ A characteristic of TDD (test-driven development) is the extensive use of prototypes.
__ Most UNIX/LINUX (shell) commands are actually the names of programs.
__ A characteristic of iterative software development is that one breaks a problem into a small
problem plus
a series of increments.
__ In a C/C++ program that includes the file , a data type of uint32_t is always 4 bytes in size.
B. (1 mark each, 6 marks total)
In each of the statements below, fill in the blank with the word or phrase which best fits the
overall state- ment.
In the context of output from ps(1), the acronym PPID stands for
_______________________________ .
The name of the environment variable which defines the list of paths searched by bash for
commands is
_________________________ .
Every complete C/C++ program has a function called __________________ . It is the standard
entry point
to the program.
UNIX/LINUX tools (commands) typically follow the convention of writing their output to
____________________________ and reading their input from __________________________
.
In UNIX/LINUX, a(n) _______________ is a named sequence of nonvolatile bytes.
A(n) _______________ is a a pair of streams, one for writing and one for reading, such that
everything written on the output stream can be read from the input stream in order and with full
fidelity.
C. (26 marks)
For each of the following multiple-choice1 questions, indicate the answer that is the best
response to the question. Circle the label (e.g. “(a)”) of your intended response in each case.
1. Which of the following sentences describing “testing” and “debugging” is true?
(a) Testing finds bugs, debugging locates error messages.
(b) Testing finds coding faults, debugging locates execution failures.
(c) Testing finds execution failures, debugging locates coding faults.
(d) Testing generates error messages, debugging locates bugs.
(e) None of the above.
1. or, as Peppermint Patty from the Peanuts comic strip would say, “mystical guess”
page 2
Cmpt 214 Midterm Examination
October 21, 2014
Which of the following statements regarding good programming style is true?
(a) A user should preferentially use the layout
rather than
(b) A user should preferentially use the layout if (condition)
{ }
r.
1 CMPS 12M Introduction to Data Structures Lab La.docxtarifarmarie
1
CMPS 12M
Introduction to Data Structures Lab
Lab Assignment 3
The purpose of this lab assignment is to introduce the C programming language, including standard input-output
functions, command line arguments, File IO, and compilation with Makefiles.
Introduction to C
If you are not already familiar with C (or even if you are) it is recommended that you purchase a good C reference
such as C for Java Programmers: a Primer by Charlie McDowell (Lulu.com 2007). The C programming
language is, in a certain sense, the grandparent of Java (C++ being its parent). Java is known as an Object Oriented
Programming (OOP) language, which means that data structures and the procedures which operate on them are
grouped together into one language construct, namely the class. Common behavior amongst classes is specified
explicitly through the mechanism of inheritance. The C programming language on the other hand does not
directly support OOP, although it can be implemented with some effort. C is known as a procedural programming
language, which means that data structures and functions (i.e. procedures) are separate language constructs. There
are no classes, no objects, and no inheritance. New data types in C are created using the typedef and struct
constructs, which will be illustrated in future lab assignments. There is however much common syntax between
Java and C. Many control structures such as loops (while, do-while, for), and branching (if, if-else, switch) are
virtually identical in the two languages. One major difference is in the way program input and output is handled,
both to and from standard IO devices (keyboard and terminal window), and to and from files. The following is
an example of a "Hello World!" program in C.
Example
/*
* hello.c
* Prints "Hello World!" to stdout
*/
#include <stdio.h>
int main(){
printf("Hello World!\n");
return 0;
}
Comments in C are specified by bracketing them between the strings /* and */, and may span several lines. For
instance /* comment */ or
/* comment
comment */
or
/*
* comment
* comment
*/
are all acceptable. With the right compiler flags, Java/C++ style comments are also acceptable.
// comment
// comment
2
You may use any style you like, but throughout this document we will use the older C style /*comments*/.
Any line beginning with # is known as a preprocessor directive. The preprocessor performs the first phase of
compilation wherein these directives, which are literal text substitutions, are performed, making the program
ready for later stages of compilation. The line #include<stdio.h> inserts the standard library header file
stdio.h, which specifies functions for performing standard input-output operations. Notice that preprocessor
commands in C do not end in a semicolon. One can also specify constant macros using the #define preprocessor
directive as follows.
.
1 CMPS 12M Introduction to Data Structures Lab La.docxtarifarmarie
1
CMPS 12M
Introduction to Data Structures Lab
Lab Assignment 3
The purpose of this lab assignment is to introduce the C programming language, including standard input-output
functions, command line arguments, File IO, and compilation with Makefiles.
Introduction to C
If you are not already familiar with C (or even if you are) it is recommended that you purchase a good C reference
such as C for Java Programmers: a Primer by Charlie McDowell (Lulu.com 2007). The C programming
language is, in a certain sense, the grandparent of Java (C++ being its parent). Java is known as an Object Oriented
Programming (OOP) language, which means that data structures and the procedures which operate on them are
grouped together into one language construct, namely the class. Common behavior amongst classes is specified
explicitly through the mechanism of inheritance. The C programming language on the other hand does not
directly support OOP, although it can be implemented with some effort. C is known as a procedural programming
language, which means that data structures and functions (i.e. procedures) are separate language constructs. There
are no classes, no objects, and no inheritance. New data types in C are created using the typedef and struct
constructs, which will be illustrated in future lab assignments. There is however much common syntax between
Java and C. Many control structures such as loops (while, do-while, for), and branching (if, if-else, switch) are
virtually identical in the two languages. One major difference is in the way program input and output is handled,
both to and from standard IO devices (keyboard and terminal window), and to and from files. The following is
an example of a "Hello World!" program in C.
Example
/*
* hello.c
* Prints "Hello World!" to stdout
*/
#include <stdio.h>
int main(){
printf("Hello World!\n");
return 0;
}
Comments in C are specified by bracketing them between the strings /* and */, and may span several lines. For
instance /* comment */ or
/* comment
comment */
or
/*
* comment
* comment
*/
are all acceptable. With the right compiler flags, Java/C++ style comments are also acceptable.
// comment
// comment
2
You may use any style you like, but throughout this document we will use the older C style /*comments*/.
Any line beginning with # is known as a preprocessor directive. The preprocessor performs the first phase of
compilation wherein these directives, which are literal text substitutions, are performed, making the program
ready for later stages of compilation. The line #include<stdio.h> inserts the standard library header file
stdio.h, which specifies functions for performing standard input-output operations. Notice that preprocessor
commands in C do not end in a semicolon. One can also specify constant macros using the #define preprocessor
directive as follows.
.
COMP 2103X1 Assignment 2Due Thursday, January 26 by 700 PM.docxdonnajames55
COMP 2103X1 Assignment 2
Due Thursday, January 26 by 7:00 PM
General information about assignments (important!):
http://cs.acadiau.ca/~jdiamond/comp2103/assignments/General-info.html
Information on passing in assignments:
http://cs.acadiau.ca/~jdiamond/comp2103/assignments/Pass-in-info.html
Information on coding style:
http://cs.acadiau.ca/~jdiamond/comp2103/assignments/C-coding-style-notes
[1] A filter program is a program which reads its input from “standard input” (“stdin”) and writes
its output to “standard output” (“stdout”). Filter programs are useful because they make it easy
to combine the functions they provide to solve more complex problems using the standard shell
facilities. Filter programs are also nice to write, because the programmer doesn’t have to worry
about writing code to open and close files, nor does the programmer have to worry about dealing
with related error conditions. In some respects, filter programs are truly “win-win”.
Write a filter program which uses getchar() to read in characters from stdin, continuing until
end of file (read the man page and/or textbook to see the details on getchar(), or, heaven forbid,
review the class slides). Your program must count the number of occurrences of each character in
the input. After having read all of the input, it outputs a table similar to the one below which, for
each character seen at least once, lists the total number of times that character was seen as well as
its relative frequency (expressed as a percentage). Note that the characters \n, \r, \t, \0, \a, \b,
\f, and \v (see man ascii) must be displayed with the appropriate “escape sequence”. Ordinary
printable characters must be output as themselves. Non-printable characters (see man isprint)
must be printed with their three-digit octal code (see man printf).
You can get input into a filter program (a2p1 in this case) in three ways:
(a) “pipe” data from another program into it, like
$ echo blah blah | a2p1
(b) “redirect” the contents of a file into the program, like
$ a2p1 < some-file
(c) type at the keyboard, and (eventually) type ^D (control-d) at the beginning of a line to
signify end of file.
Your output must look like the following, for this sample case:
$ echo ^Aboo | a2p1
Char Count Frequency
--------------------------
001 1 20.00%
\n 1 20.00%
b 1 20.00%
o 2 40.00%
Note: in the above examples, and from now on in this course’s assignments, text in red is text that
the human types, and a “$" at the beginning of a line like that represents the shell prompt.
1
http://cs.acadiau.ca/~jdiamond/comp2103/assignments/General-info.html
http://cs.acadiau.ca/~jdiamond/comp2103/assignments/Pass-in-info.html
http://cs.acadiau.ca/~jdiamond/comp2103/assignments/C-coding-style-notes
Note that I entered a ^A (control-a, not the circumflex character followed by the capital A) by
typing ^V^A. The ^V tells your shell that you want it to interpret the next character literally, rather
than to use any special meani.
CSCI 132 Practical Unix and Programming .docxmydrynan
CSCI
132:
Practical
Unix
and
Programming
Adjunct:
Trami
Dang
Assignment
4
Fall
2018
Assignment 41
This set of exercises will strengthen your ability to write relatively simple shell scripts
using various filters. As always, your goals should be clarity, efficiency, and simplicity. It
has two parts.
1. The background context that was provided in the previous assignment is repeated here
for your convenience. A DNA string is a sequence of the letters a, c, g, and t in any
order, whose length is a multiple of three2. For example, aacgtttgtaaccagaactgt
is a DNA string of length 21. Each sequence of three consecutive letters is called a codon.
For example, in the preceding string, the codons are aac, gtt, tgt, aac, cag, aac,
and tgt.
Your task is to write a script named codonhistogram that expects a file name on the
command line. This file is supposed to be a dna textfile, which means that it contains
only a DNA string with no newline characters or white space characters of any kind; it is
a sequence of the letters a, c, g, and t of length 3n for some n. The script must count the
number of occurrences of every codon in the file, assuming the first codon starts at
position 13, and it must output the number of times each codon occurs in the file, sorted
in order of decreasing frequency. For example, if dnafile is a file containing the dna
string aacgtttgtaaccagaactgt, then the command
codonhistogram dnafile
should produce the following output:
3 aac
2 tgt
1 cag
1 gtt
because there are 3 aac codons, 2 tgt, 1 cag, and 1 gtt. Notice that frequency comes
first, then the codon name.
1
This is licensed under the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International
License. To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-sa/4.0/.
2
This is really just a simplification to make the assignment easier. In reality, it is not necessarily a
multiple of 3.
3
Tho.
Between 2000 and 2002, then again from 2008 to 2010, access measures.pdfRBMADU
Between 2000 and 2002, then again from 2008 to 2010, access measures showed no
improvement and quality of care measures improved more slowly in racial groups and certain
ethnic populations, than the improvements for the total population.
Solution
Ans:
The health care quality chasm is better described as a gulf for certain segments of the population,
such as racial and ethnic minority groups, given the gap between actual care received and ideal
or best care quality. The landmark Institute of Medicine report Crossing the Quality Chasm: A
New Health System for the 21st Century challenges all health care organizations to pursue six
major aims of health care improvement: safety, timeliness, effectiveness, efficiency, equity, and
patient-centeredness. “Equity” aims to ensure that quality care is available to all and that the
quality of care provided does not differ by race, ethnicity, or other personal characteristics
unrelated to a patient\'s reason for seeking care. Baylor Health Care System is in the unique
position of being able to examine the current state of equity in a typical health care delivery
system and to lead the way in health equity research. Its organizational vision, “culture of
quality,” and involved leadership bode well for achieving equitable best care. However,
inequities in access, use, and outcomes of health care must be scrutinized; the moral, ethical, and
economic issues they raise and the critical injustice they create must be remedied if this goal is to
be achieved. Eliminating any observed inequities in health care must be synergistically
integrated with quality improvement. Quality performance indicators currently collected and
evaluated indicate that Baylor Health Care System often performs better than the national
average. However, there are significant variations in care by age, gender, race/ethnicity, and
socioeconomic status that indicate the many remaining challenges in achieving “best care” for
all.
Explanation: The U.S. health care system is designed to improve the physical and mental well-
being of all Americans by preventing, diagnosing, and treating illness and by supporting optimal
function. Across the lifespan, health care helps people stay healthy, recover from illness, live
with chronic disease or disability, and cope with death and dying. Quality health care delivers
these services in ways that are safe, timely, patient centered, efficient, and equitable.
Unfortunately, Americans too often do not receive care they need, or they receive care that
causes harm. Care can be delivered too late or without full consideration of a patient\'s
preferences and values. Many times, our system of health care distributes services inefficiently
and unevenly across populations. Some Americans receive worse care than others. These
disparities may occur for a variety of reasons, including differences in access to care, social
determinants, provider biases, poor provider-patient communication, and poor health literacy.
Each.
Below is a diagram of the coding strand of DNA showing a gene please .pdfRBMADU
Below is a diagram of the coding strand of DNA showing a gene please use this image for
questions 3 and 4). The arrow represents the transcription start site. Which region contains the
3\' Untranslated Region (UTR)? A B C D E
Solution
Answer: D
Reason:
When transcription occurs, the m RNA formed is longer than the actual RNA code for protein . It
has few bases at 5’ and 3’ end to protect its degradation in cell environment. While translation,
which started at middle of exon 1 and stopped at the middle of exon 3, Exon 1 has few portion
(C), and exon 3 has few portion (D), which is not undergoing translation. These regions are
known as translated regions at 5’ (C) and 3’ (D) end respectively. DNA has 5’ (in diagram) and
3’ (opposite end, not shown in diagram)..
More Related Content
Similar to Say whether each of the following statements is true (“T”) or false .pdf
COMP 2103X1 Assignment 2Due Thursday, January 26 by 700 PM.docxdonnajames55
COMP 2103X1 Assignment 2
Due Thursday, January 26 by 7:00 PM
General information about assignments (important!):
http://cs.acadiau.ca/~jdiamond/comp2103/assignments/General-info.html
Information on passing in assignments:
http://cs.acadiau.ca/~jdiamond/comp2103/assignments/Pass-in-info.html
Information on coding style:
http://cs.acadiau.ca/~jdiamond/comp2103/assignments/C-coding-style-notes
[1] A filter program is a program which reads its input from “standard input” (“stdin”) and writes
its output to “standard output” (“stdout”). Filter programs are useful because they make it easy
to combine the functions they provide to solve more complex problems using the standard shell
facilities. Filter programs are also nice to write, because the programmer doesn’t have to worry
about writing code to open and close files, nor does the programmer have to worry about dealing
with related error conditions. In some respects, filter programs are truly “win-win”.
Write a filter program which uses getchar() to read in characters from stdin, continuing until
end of file (read the man page and/or textbook to see the details on getchar(), or, heaven forbid,
review the class slides). Your program must count the number of occurrences of each character in
the input. After having read all of the input, it outputs a table similar to the one below which, for
each character seen at least once, lists the total number of times that character was seen as well as
its relative frequency (expressed as a percentage). Note that the characters \n, \r, \t, \0, \a, \b,
\f, and \v (see man ascii) must be displayed with the appropriate “escape sequence”. Ordinary
printable characters must be output as themselves. Non-printable characters (see man isprint)
must be printed with their three-digit octal code (see man printf).
You can get input into a filter program (a2p1 in this case) in three ways:
(a) “pipe” data from another program into it, like
$ echo blah blah | a2p1
(b) “redirect” the contents of a file into the program, like
$ a2p1 < some-file
(c) type at the keyboard, and (eventually) type ^D (control-d) at the beginning of a line to
signify end of file.
Your output must look like the following, for this sample case:
$ echo ^Aboo | a2p1
Char Count Frequency
--------------------------
001 1 20.00%
\n 1 20.00%
b 1 20.00%
o 2 40.00%
Note: in the above examples, and from now on in this course’s assignments, text in red is text that
the human types, and a “$" at the beginning of a line like that represents the shell prompt.
1
http://cs.acadiau.ca/~jdiamond/comp2103/assignments/General-info.html
http://cs.acadiau.ca/~jdiamond/comp2103/assignments/Pass-in-info.html
http://cs.acadiau.ca/~jdiamond/comp2103/assignments/C-coding-style-notes
Note that I entered a ^A (control-a, not the circumflex character followed by the capital A) by
typing ^V^A. The ^V tells your shell that you want it to interpret the next character literally, rather
than to use any special meani.
CSCI 132 Practical Unix and Programming .docxmydrynan
CSCI
132:
Practical
Unix
and
Programming
Adjunct:
Trami
Dang
Assignment
4
Fall
2018
Assignment 41
This set of exercises will strengthen your ability to write relatively simple shell scripts
using various filters. As always, your goals should be clarity, efficiency, and simplicity. It
has two parts.
1. The background context that was provided in the previous assignment is repeated here
for your convenience. A DNA string is a sequence of the letters a, c, g, and t in any
order, whose length is a multiple of three2. For example, aacgtttgtaaccagaactgt
is a DNA string of length 21. Each sequence of three consecutive letters is called a codon.
For example, in the preceding string, the codons are aac, gtt, tgt, aac, cag, aac,
and tgt.
Your task is to write a script named codonhistogram that expects a file name on the
command line. This file is supposed to be a dna textfile, which means that it contains
only a DNA string with no newline characters or white space characters of any kind; it is
a sequence of the letters a, c, g, and t of length 3n for some n. The script must count the
number of occurrences of every codon in the file, assuming the first codon starts at
position 13, and it must output the number of times each codon occurs in the file, sorted
in order of decreasing frequency. For example, if dnafile is a file containing the dna
string aacgtttgtaaccagaactgt, then the command
codonhistogram dnafile
should produce the following output:
3 aac
2 tgt
1 cag
1 gtt
because there are 3 aac codons, 2 tgt, 1 cag, and 1 gtt. Notice that frequency comes
first, then the codon name.
1
This is licensed under the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International
License. To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-sa/4.0/.
2
This is really just a simplification to make the assignment easier. In reality, it is not necessarily a
multiple of 3.
3
Tho.
Between 2000 and 2002, then again from 2008 to 2010, access measures.pdfRBMADU
Between 2000 and 2002, then again from 2008 to 2010, access measures showed no
improvement and quality of care measures improved more slowly in racial groups and certain
ethnic populations, than the improvements for the total population.
Solution
Ans:
The health care quality chasm is better described as a gulf for certain segments of the population,
such as racial and ethnic minority groups, given the gap between actual care received and ideal
or best care quality. The landmark Institute of Medicine report Crossing the Quality Chasm: A
New Health System for the 21st Century challenges all health care organizations to pursue six
major aims of health care improvement: safety, timeliness, effectiveness, efficiency, equity, and
patient-centeredness. “Equity” aims to ensure that quality care is available to all and that the
quality of care provided does not differ by race, ethnicity, or other personal characteristics
unrelated to a patient\'s reason for seeking care. Baylor Health Care System is in the unique
position of being able to examine the current state of equity in a typical health care delivery
system and to lead the way in health equity research. Its organizational vision, “culture of
quality,” and involved leadership bode well for achieving equitable best care. However,
inequities in access, use, and outcomes of health care must be scrutinized; the moral, ethical, and
economic issues they raise and the critical injustice they create must be remedied if this goal is to
be achieved. Eliminating any observed inequities in health care must be synergistically
integrated with quality improvement. Quality performance indicators currently collected and
evaluated indicate that Baylor Health Care System often performs better than the national
average. However, there are significant variations in care by age, gender, race/ethnicity, and
socioeconomic status that indicate the many remaining challenges in achieving “best care” for
all.
Explanation: The U.S. health care system is designed to improve the physical and mental well-
being of all Americans by preventing, diagnosing, and treating illness and by supporting optimal
function. Across the lifespan, health care helps people stay healthy, recover from illness, live
with chronic disease or disability, and cope with death and dying. Quality health care delivers
these services in ways that are safe, timely, patient centered, efficient, and equitable.
Unfortunately, Americans too often do not receive care they need, or they receive care that
causes harm. Care can be delivered too late or without full consideration of a patient\'s
preferences and values. Many times, our system of health care distributes services inefficiently
and unevenly across populations. Some Americans receive worse care than others. These
disparities may occur for a variety of reasons, including differences in access to care, social
determinants, provider biases, poor provider-patient communication, and poor health literacy.
Each.
Below is a diagram of the coding strand of DNA showing a gene please .pdfRBMADU
Below is a diagram of the coding strand of DNA showing a gene please use this image for
questions 3 and 4). The arrow represents the transcription start site. Which region contains the
3\' Untranslated Region (UTR)? A B C D E
Solution
Answer: D
Reason:
When transcription occurs, the m RNA formed is longer than the actual RNA code for protein . It
has few bases at 5’ and 3’ end to protect its degradation in cell environment. While translation,
which started at middle of exon 1 and stopped at the middle of exon 3, Exon 1 has few portion
(C), and exon 3 has few portion (D), which is not undergoing translation. These regions are
known as translated regions at 5’ (C) and 3’ (D) end respectively. DNA has 5’ (in diagram) and
3’ (opposite end, not shown in diagram)..
A patient has a tidal volume of 0.50 L, a frequency of breathing or r.pdfRBMADU
A patient has a tidal volume of 0.50 L, a frequency of breathing or respiratory rate of 19.0
breaths/min, and an anatomical dead space volume of 0.20 L. Calculate the alveolar ventilation
rate.
Solution
The alveolar ventilation (VA) and the dead space ventilation/volume (VD) together combine to
form pulmonary ventilation rate (V). So, V = VA + VD or VA = V - VD
The pulmonary ventilation rate is given by, V = VT x f
Where VT = Tidal volume and f = Respiratory Rate
Here we know, VT = 0.5 and f = 19. So, V = 0.5*19 = 9.5 L
We are given that VD = 0.2 L, So, VA = 9.5 - 0.2 = 9.3 L
Hence, VA i.e. Alveolar Ventilation rate is 9.3 L/min.
Write a program to recognizing Idenifier Or Constant in C language.pdfRBMADU
Write a program to recognizing Idenifier Or Constant in C language
Below is sample input and output
/* Output:
enter string
sum 10
sum is Identifier
10 is Constant */
Solution
#include int main() { int number; // printf() dislpays the formatted output
printf(\"Enter an integer: \"); // scanf() reads the formatted input and stores them
scanf(\"%d\", &number); // printf() displays the formatted output printf(\"You entered:
%d\", number); return 0; }.
Why having a lipid rich cell wall make a bacteria harder to stain.pdfRBMADU
Why having a lipid rich cell wall make a bacteria harder to stain?
Solution
In lipid rich cell walled bacteria the alcohol easily pass through the walls making loss of lipid
and increasing pores in the membrane thus making the cell wall more porous and the stain is
easily washed out distaining the cell. So it is difficult to retain the stain inside the lipid rich cell
walled bacteria while staining (Harder to stain)..
Which of the following statements about leasing is falseALease fina.pdfRBMADU
Which of the following statements about leasing is false?ALease financing is a substitute for
debt financing.
Solution
Lease is defined as a contract between two parties for use of assets of one parties by paying rent
for using assets. the owner of assets is calls Lessor and the person who use assets is called
Lessee. In lease analysis residual value that is value of assets at end of lease contract must be
considered. In operating lease maintainance expense should be paid by lessee only. Lease is
considered as substitute for debt financing.
So, Incorrect statement about lease contract option (E)..
using the single linked list code written in the class or in the lab,.pdfRBMADU
using the single linked list code written in the class or in the lab, write and test the follow
function: Merge() function that takes two lists, each of which is sorted in increasing order, and
merges the two together into one list which is in increasing order.
Solution
//The main class
class MergeList {
Node head; // head of list
static Node a, b;
//Node class
static class Node {
int element;
Node next;
// Constructor to create a new node
Node(int d) {
element = d;
next = null;
}
}
void printlist(Node node) {
while (node != null) {
System.out.print(node.element + \" \");
node = node.next;
}
}
Node sortMerge(Node node1, Node node2) {
// Here we will check whether both the list are null or not.
if (node1 == null && node2 == null) {
return null;
}
// sortResultant node
Node sortRes = null;
// Now we will compare and merge the elements of both the list.
while (node1 != null && node2 != null) {
// We will compare current element of both lists
if (node1.element >= node2.element) {
Node temp = node1.next;
node1.next = sortRes;
sortRes = node1;
node1 = temp;
} else {
Node temp = node2.next;
node2.next = sortRes;
sortRes = node2;
node2 = temp;
}
}
// If second list reached end, but first list has
// nodes. Add remaining nodes of first list at the
// front of sortResult list
while (node1 != null) {
Node temp = node1.next;
node1.next = sortRes;
sortRes = node1;
node1 = temp;
}
// If first list reached end, but second list has
// node. Add remaining nodes of first list at the
// front of sortResult list
while (node2 != null) {
Node temp = node2.next;
node2.next = sortRes;
sortRes = node2;
node2 = temp;
}
return sortRes;
}
public static void main(String[] args) {
MergeList list = new MergeList();
Node sortResult = null;
//Create two linked list
list.a = new Node(5);
list.a.next = new Node(10);
list.a.next.next = new Node(15);
list.b = new Node(2);
list.b.next = new Node(3);
list.b.next.next = new Node(20);
System.out.println(\"List a before merge :\");
list.printlist(a);
System.out.println(\"\");
System.out.println(\"List b before merge :\");
list.printlist(b);
// Cal the function to merge the list in increasing order.
sortResult = list.sortedmerge(a, b);
System.out.println(\"\");
System.out.println(\"Merged linked list : \");
list.printlist(sortResult);
}
}.
A database management system is also referred to as a database. True.pdfRBMADU
A database management system is also referred to as a database. True False Which of the
following is true of a virtual private network (VPN)? It provides a secure connection for
information transmitted over the public Internet. It does not encrypt messages. It is limited to
organizational use. It can be used to store highly sensitive information of an organization in
local clients. Compute represent data using binary digits called _____. dots pixels tags bits
McCann Systems, a leading IT firm, develops a customized billing software to meet the needs of
its individual customers. In this case, the software developed by the firm is referred to as a (n)
_____. vertical-market application software horizontal-market application software open
source software application simulation software Phobias Inc. offers an online service that stores
notes made by customers on the cloud. When a customer enters notes on a device, it gets updated
in all the devices he/she owns. Which of the following cloud-based offering does Phobias Inc.
provide to its customers? Unified communications as a service (UCaaS) platforms as a service
(PaaS) software as a service (SaaS) infrastructure as a service (IaaS) The conversion of the
existing traditional databases in organizations to NoSQL database is _____. Highly efficient and
is being practiced by many organizations highly recommended because it is user friendly very
cost-effective but can be enormously disruptive unnecessary when relational database meet the
needs of organizations
Solution
21 b) False
Database contains different levels of abstraction:
1) External (How the users view the data)
2) Conceptual (Communication medium between internal and external levels)
3) Internal (How the data is physically stored)
DBMS is a software that manages databases and allows us to create, edit and delete database,
their tables and their data.
Examples: MySQL, Oracle, etc
22) a) It provides a secure connection for information transmitted over the public network.
c) Yes it is limited to organizational use.
23) d) bits
24) a) vertical application software
Vertical application is supports a specific business process and targets a smaller number of users
with specific need and job responsibilities within an organization.
25) IaaS
26) A and B.
An envolope contains three cards A black card that is black on both.pdfRBMADU
An envolope contains three cards: A black card that is black on both sides, a white card that is
white on both sides and a mixed card that is black on one side and white on the other. You select
one card on random and note that the card facing up is black. What is the probability that the
other side is black?
Solution
P(first side is black) = (1/3)*(1) + (1/3)*(1/2) + (1/3)*(0)
P(first side is black) = 1/2 = 0.5
P(other side is black|first side is black) = P(both sides black)/P(first side is black)
= (1/3)*1/(0.5)
= 2/3 = 0.67.
There was a mass extinction of plants and animals at the end of the P.pdfRBMADU
There was a mass extinction of plants and animals at the end of the Permian period 250 million
years ago. Which of the following would be a reasonable prediction for the fungal fossil record?
A. There should be a massive increase in saprophytic fossils during the extinction, and then a
massive decline shortly after the extinction was complete. B. There should be a massive increase
in mycorrhizal fossils during the extinction and few afterward. C. There should be a massive
decrease in all fungal fossils just prior to the time that plant and animal species started to decline,
and the number of these fossils should remain low throughout the extinction period. D. There
should be a slow increase in all fungal fossils during the time that plant and animal species
declined, with their numbers staying relatively high after ward since there was little competition
from other species.
Solution
correct answer:-(A)There should be a massive increase in saprophytic fossils during the
extiction,and then a massive decline shortly after the extiction was complete.
Because when the saprophytic plants died,they must have definitely become a large amount of
fossil.Moreover fungal fossils are very difficult to identify,only except some fungi.When the
extinction was complete it was shortly decline..
The size P of a certain insect population at time t (in days) obeys t.pdfRBMADU
The size P of a certain insect population at time t (in days) obeys the function P(t) = 500 e^0 01t.
Determine the number of insects at t = 0 days. What is the growth rate of the insect population?
What is the population after 10 days? When will the insect population reach 700? When will the
insect population double? What is the number of insects at t = 0 days? Insects
Solution.
The fundamental theory of electromagnetic field is based on Maxwell.pdfRBMADU
The fundamental theory of electromagnetic field is based on Maxwell\'s equations. These
equations govern the electromagnetic fields, E, D, H, and there relations to the source, f and p_v.
In a source-free region, list the Maxwell\'s equations for time-harmonic fields: Given the Phaser
from of the electric field E? For the above given electric field, is B varying with time? Why?
Solution
Maxwell’s equations simplify considerably in the case of harmonic time dependence. Through
the inverse Fourier transform, general solutions of Maxwell’s equation can be built as linear
combinations of single-frequency solutions:† E(r, t)= E(r, )ejt d2 (1) Thus, we assume that all
fields have a time dependence ejt: E(r, t)= E(r)ejt, H(r, t)= H(r)ejt where the phasor amplitudes
E(r), H(r) are complex-valued. Replacing time derivatives by t j, we may rewrite Eq. in the
form:
× E = jB
× H = J + jD
· D =
· B = 0
(Maxwell’s equations) (2) In this book, we will consider the solutions of Eqs. (.2) in three
different contexts: (a) uniform plane waves propagating in dielectrics, conductors, and
birefringent media, (b) guided waves propagating in hollow waveguides, transmission lines, and
optical fibers, and (c) propagating waves generated by antennas and apertures
Next, we review some conventions regarding phasors and time averages. A realvalued sinusoid
has the complex phasor representation: A(t)= |A| cos(t + ) A(t)= Aejt (3) where A = |A|ej. Thus,
we have A(t)= Re A(t) = Re Aejt . The time averages of the quantities A(t) and A(t) over one
period T = 2/ are zero. The time average of the product of two harmonic quantities A(t)= Re Aejt
and B(t)= Re Bejt with phasors A, B is given by A(t)B(t) = 1T T0 A(t)B(t) dt = 12 Re AB] (4) In
particular, the mean-square value is given by: A2(t) = 1T T0 A2(t) dt = 12 Re AA]= 12|A|2 (5)
Some interesting time averages in electromagnetic wave problems are the time averages of the
energy density, the Poynting vector (energy flux), and the ohmic power losses per unit volume.
Using the definition) and the result (.4), we have for these time averages:
w = 1 2 Re 12E · E + 12H · H (energy density) P = 1/ 2 Re E × H (Poynting vector) dPloss dV =
1/ 2 Re Jtot · E (ohmic losses) (6) where Jtot = J + jD is the total current in the right-hand side of
Amp`ere’s law and accounts for both conducting and dielectric losses. The time-averaged
version of Poynting’s theorem is discussed in Problem 1.5. The expression (1.9.6) for the energy
density w was derived under the assumption that both and were constants independent of
frequency. In a dispersive medium, , become functions of frequency. In frequency bands where
(), () are essentially real-valued, that is, where the medium is lossless,that the timeaveraged
energy density generalizes to: w = 1/ 2 Re 1/2 d() d E · E + 1/2 d() d H · H (lossless case) (.7)
The derivation of (.7) is as follows. Starting with Maxwell’s equations (1.1.1) and without
assuming any particular constitutive relations, we obtain:.
Part I – Antibiotics and the Human Microbiome Amelia and her family .pdfRBMADU
Part I – Antibiotics and the Human Microbiome Amelia and her family had just returned from a
family vacation in Mexico. While there they had enjoyed an abundance of fresh fruit and
vegetables from the local street vendors outside of their hotel. Amelia’s mother normally would
have avoided these fruit stands because her doctor had warned her to be cautious of raw produce
while travelling in less developed countries. But she recently had read a New York Times article
illustrating the benefits of various microbes on the immune system and decided to embrace the
local agriculture in Mexico as a result. However, by the end of their trip, they all had begun to
suffer from nausea and diarrhea. Their family doctor diagnosed 16 year-old Amelia and her
family with food poisoning and promptly placed them all on antibiotics. While her brother and
parents started feeling better relatively quickly, Amelia continued to suffer from gastrointestinal
(GI) distress. She found that she couldn’t leave her home because she was constantly running to
the bathroom (10–12 times per day). While the rest of her family seemed well rested and
recovered, Amelia felt tired, had severe abdominal cramping, and had lost her appetite. After
visiting a gastroenterologist, Amelia was diagnosed with Crohn’s disease (CD). CD is a chronic
inflammatory bowel disease, where the immune cells in the intestine become overly sensitive to
the bacteria residing in the intestines causing pathologic inflammation in the lining of the GI
tract. It typically presents in the small intestine but can occur anywhere along the GI tract from
the mouth down to the anus. Determined to shed some light on her diagnosis, Amelia began to
search the Internet for information. As she read many personal stories of other Crohn’s patients,
she noticed many of them also had the first onset of their disease following a course of
antibiotics. She was astonished to find that her intestines were the home for billions of bacteria
collectively called the gut microbiota. In fact, she read that there were more than 10 times the
number of bacterial cells in her body than human cells; best estimates suggested there are 1013
bacterial cells in a single human body. She was also surprised to discover that some scientists
estimate as many as 10,000 different microbial species reside in or on the average healthy human
body (Proctor, 2012). She found an article in Wired (http://www.
wired.com/2011/09/mf_microbiome/) that described the impact of antibiotics on the gut
microbiota. Amelia was particularly struck by the figure that illustrated the lasting impact that
antibiotics have on microbial diversity in the intestines. She began to wonder about the impact
her recent course of antibiotics had had on her intestines and what it meant for her health.
Questions
1.Look at the figure that Amelia found in Wired pertaining to antibiotics and the microbiota.
What conclusions can you draw from this figure?
2. Given the fact that Amelia fou.
Recall the Squeeze TheoremSuppose that for all n, xn yn zn. If .pdfRBMADU
Recall the Squeeze Theorem:
Suppose that for all n, xn yn zn. If (xn) and (zn) both converge to L R, then (yn) also converges
to L.
Louis Reasoner gives the following proof:
Using limit comparison theorems, since xn yn, for all n, then lim xn lim yn, and so L lim yn.
Similarly, since yn zn, for all n, then lim yn lim zn, so lim yn L. Putting the 2 inequalities
together, lim yn = L, Q.E.D.
What’s wrong with this proof?
Solution
Nothing is wrong. It is correct..
Since somathesthetic sensation from each side of the body projects t.pdfRBMADU
Since somathesthetic sensation from each side of the body projects to the contralateral
postcentral gyrus _______ must have occurred at some point along the pathway.
Solution
Answer: Since somathesthetic sensation from each side of the body projects to the contralateral
postcentral gyrus _ decussation_ must have occurred at some point along the pathway.
Reason:
Somatosensory system- decussation:
Proprioceptors (receptors of self -sensation & decussation) are present in the joints and skeletal
(striated) muscles. These receptors sense the relative position of other body parts and balance the
posture. Somathesthetic sensation from each side of the body projects to the contralateral
postcentral gyrus to parietal lobe, so that initially decussations must have occurred at some point
along the pathway representing a muscular activity. The overall body posture and movement is
balanced by the integration of information received from the vestibular system and
proprioceptors by the brain.
For example, the central information in playing piano is due to severe and increased stimulation
of accompanying motor areas such as premotor cortex with proper planning with proprioception
for decussation. But the activation of cerebellum is a bit less compared to the propriocetion.
Spinocerebellar tracts are more widely projected via dorsal column and to the cerebellum and
finally the information is considerably utilized for rhythmic movements.
This is pathway mainly involved in the sensory ascending pathways to process sensation &
perception through a 3 neuron system finally enable “sensory information” to the central nervous
system through sensory receptor to the cortex. This pathway is mainly involved in mediating
discriminative touch sensation through adequate proprioception & vibration.
This pathway has two white matter tracts profoundly possess a first neuron mainly through
fasciculus gracilis in the medial column from lower limb (T6 and lower) & sensory information
is obtained through fasciculus cuneatus: of lateral column in upper limb (T5)
Features of spinothalamic pathway: This is the sensory pathway mainly involved in processing
sensory information of “poorly localized touch, pressure & temperature”. This pathway is going
to involve cross of sensory information to the spinal cord prior to ascending via the anterior or
spinothalamic & lateral spinothalamic tracts.
Interaction of these two pathways: The interaction of these two pathways are mainly through
axons & spinaothalamic tracts arising into an ascending pathway to transport to the sensory
information processing center in the brain. Mainly spinothalamic neurons are going to use first
order neurons, second order neurons, third order neurons to enter spinal cord and synapse
through posterior gray horns & these neurons are going to carry sensory information of pain,
sensation etc in ventral nucleus group of the thalamus. This information is going to reach through
from the Lemniscal pathway finally relaye.
Research and identify three IT-related Risk Management Plans and lis.pdfRBMADU
Research and identify three IT-related Risk Management Plans and list your references to the
three plans you found. Then identify 10 important components of an IT Risk Management Plan
and define these components as well as their importance in an organization. The submitted
document should not exceed two pages in length.
Solution
The three IT related risk management plans are as follows:
Following are the components of an IT related risk management plan:
System characterization: System characterization comprises of identification and listing of the
characteristics of a system. This helps the analysts to identify any bug easily in case of
malfunctioning. The various characteristics of a system can be its need, functional requirement,
mission, goal, network, security controls etc.
Threat identification: This refers to identification of the types of threats a system can face in an
organization. The system is designed in such a way that it is able to identify the threats that
might be harmful for the system that is being used. Hacking, viruses, data compromise are some
of the threats that are faced by systems in an organization.
Vulnerability identification: This involves identification of those areas that are vulnerable for a
system. The vulnerable areas are required to be monitored closely.
Control analysis: This involves controlling various functions that are related with a system and
controlling them so that the system works in the way as required by a company.
Likelihood determination: Likelihood determination relates with determining the likeliness that a
threat may be damaging for the system. There might be likelihood that the threat might be high,
medium or low as far as the likelihood of the threat from a bug is concerned.
Impact analysis: This component analyzes the impact of potential threat from vulnerability. The
impact analysis requires taking into account the importance of the system. In case of critical
system the impact from vulnerability would be high.
Risk determination: This involves determining the amount of risk involved in a system. This
allows the system analysts to formulate the plans accordingly.
Control recommendation: The component requires that there should be recommendations in
place that would require controlling of the system so that the system works optimally and gives
the desired results.
Results documentation: There should be a document that should contain all the details that are
related with the results that are to be provided by the system..
please help me with two partI Bold it out as wrong part which in t.pdfRBMADU
please help me with two part
I Bold it out as wrong part which in the first part of code and the last part of it.
JAVA CODE
import java.util.List;
import javafx.application.Application;
import javafx.event.Event;
import javafx.event.EventHandler;
import javafx.geometry.Insets;
import javafx.geometry.Pos;
import javafx.scene.Node;
import javafx.scene.Scene;
import javafx.scene.control.Button;
import javafx.scene.control.Label;
import javafx.scene.control.TextField;
import javafx.scene.input.MouseEvent;
import javafx.scene.layout.BorderPane;
import javafx.scene.layout.GridPane;
import javafx.scene.layout.HBox;
import javafx.stage.Stage;
// class for revrse multiplication table
public class RC_revmul extends Application
{
// over ride nethod for setup the grid
@Override
public void start(Stage primaryStage)
{
BorderPane RCpane = new BorderPane();
RCpane.setTop(getHbox1());
HBox RCprompt = new HBox(15);
RCprompt.setPadding(new Insets(15, 15, 15, 15));
RCprompt.setAlignment(Pos.TOP_CENTER);
RCprompt.getStyleClass().add(\"hbox2\");
Label lblRCProblem = new Label(\"Enter Answer: \");
RCprompt.getChildren().add(lblRCProblem);
TextField tfRCProblem = new TextField();
RCprompt.getChildren().add(tfRCProblem);
GridPane RCgridPane = setUpGrid();
GridpaneHelper gh = new GridpaneHelper(RCgridPane); // this lane is wrong but why ?
Button btnRCFindAnswer = new Button(\"Find problems\");
btnRCFindAnswer.addEventHandler(MouseEvent.MOUSE_CLICKED, new EventHandler()
{
@Override
public void handle(Event arg0)
{
List RCx = showFactors(tfRCProblem);
for (int[] RCx1 : RCx) {
Node node = gh.RCgetChildren()[RCx1[0]][RCx1[1]];
node.setStyle(\"-fx-background-color: green\");
}
}
});
RCprompt.getChildren().add(btnRCFindAnswer);
RCpane.setCenter(RCprompt);
RCpane.setBottom(RCgridPane);
Scene scene = new Scene(RCpane, 550, 650);
scene.getStylesheets().add(getClass().getResource(\"application.css\").toExternalForm());
primaryStage.setTitle(\"lab 6\");
primaryStage.setScene(scene);
primaryStage.show();
}
// method for grid layout
private HBox getHbox1()
{
HBox RChbox = new HBox(15);
RChbox.setPadding(new Insets(15, 15, 15, 15));
RChbox.setAlignment(Pos.TOP_CENTER);
RChbox.getStyleClass().add(\"hbox1\");
Label lblRCProblem = new Label(\"Reverse Multiplication Table\");
RChbox.getChildren().add(lblRCProblem);
return RChbox;
}
// method to setup a grid
public GridPane setUpGrid() {
GridPane RCpane = new GridPane();
Label[][] RClabels = new Label[11][11];
for (int RCrow = 0; RCrow < 11; RCrow++) {
for (int RCcol = 0; RCcol < 11; RCcol++) {
Label RClbl = new Label();
setUpLabel(RClbl, RCcol, RCrow);
RClabels[RCrow][RCcol] = RClbl;
RCpane.add(RClbl, RCcol, RCrow);
}
}
return RCpane;
}
// method to setup label
public void setUpLabel(final Label RClbl, final int RCcol, final int RCrow)
{
RClbl.setPrefHeight(50);
RClbl.setPrefWidth(50);
RClbl.setAlignment(Pos.CENTER);
RClbl.setStyle(\"-fx-stroke-border: black; -fx-border-width: 1;\");
String RCa = String.valueOf(RCrow);
String RCb = S.
Matching. Choose the most appropriate answer from the right. 1. Null .pdfRBMADU
Matching. Choose the most appropriate answer from the right. 1. Null Modem 2. FDM 3.
Fourier Transform c. Interleave blocks of bits 4. _Photodiode 5. Repeater 6. TDM 7. Twisted
Pair 8. Manchester a. RJ-45 d. Extend Range e. Connect two DTEs directly f. detect fiber
transmission h. RJ-11 Fixed Frequency j. Trafic Division k. Digital/Digital used in LAN I.
Duplicate data on two machines m. Core n. Creates light pulses
Solution
>null modem = Connect 2 DTE dirctly
>FDM = Many frequencies on same medium
>Fourier transform = composite signal to component parts
>Photodiode = detect fiber transmission
>Repeater = Extend range
>TDM = interleave block of bits
>Twisted pair = RJ-45.
Numerous diseases are caused by viruses and bacteria (etc. Hepatitis.pdfRBMADU
Numerous diseases are caused by viruses and bacteria (etc. Hepatitis, West Nile Virus, Pertussis,
Avian Flu, Ebola, Cholera, Typhoid). On a Global scale, viral and bacterial diseases result in
hundreds of thousands of deaths every year (sometimes millions in the case of epidemics or
pandemics). However, for many of these viral and bacterial pathogens there are effective
vaccines available.
So, do you think the government, or your employer, or your school has the right to require
vaccinations. What if your job requires you to come in contact with hundreds of people a day
(nurse, bus driver, etc.).
Solution
The immunity against these pathogenic diseases has to develop in the children so small kids must
be ensured for complete vaccination at proper ages. Vaccines for diseases like Hepatitis and
Ebola are given at the early age to develop immunity for such diseases. However, those children
who could not get them, should be attended by their schools through government initiatives to
make sure every child get them.
The jobs like nurse and drivers who happen to meet hundreds of people daily are at the greater
risk of developing the diseases so their employers must take care of them..
Network peering is a method to save ISP’s network bandwidth and reso.pdfRBMADU
Network peering is a method to save ISP’s network bandwidth and resources. Write a brief
document describing the following:
What is meant by “Network Peering”
What is meant by “Internet Exchange” and How is it related to “Network Peering”.
How can “Network Peering” save network resources
How can “Network Peering” be implemented
Solution
Network Peering:
Relationship between two Internet Service Providers is called Peering. In this they mutually
agreed to exchange prefixes and allow flow of traffic. The typical connection to the internet is
called transit. Network peering is when one internet network connects to another directly,
enabling a faster throughput and exchange of information.
Peering is of four types.
Public peering
Private peering
Partial Peering
Paid Peering
For peering need to have connection exchange point.
Internet Exchange in the context of Network Peering:
To establish a peering between any two networks they must exchange the connection points.
Using an Internet exchange, a network can peer with many other networks through a single
connection. It is negotiable through the peer. An Internet exchange is a point of a physical
infrastructure that allows different Internet Service Providers (ISPs) to exchange Internet traffic
between their networks (autonomous systems) by means of mutual peering agreements, which
allow traffic to be exchanged without cost.
The main purpose of the internet exchange is to allow networks to interconnect directly, via the
exchange, or by using other network or third party network.
In establishing PEER in the network they are mutually exchanging the points to each other at that
time an unlimited number of parties agree to exchange traffic on common terms, using a single
agreement that they all accede to, and using a route server or route reflector.
The first is a connection to an exchange point. Peering is the direct exchange of customer routing
information and traffic between to isp’s..
A Strategic Approach: GenAI in EducationPeter Windle
Artificial Intelligence (AI) technologies such as Generative AI, Image Generators and Large Language Models have had a dramatic impact on teaching, learning and assessment over the past 18 months. The most immediate threat AI posed was to Academic Integrity with Higher Education Institutes (HEIs) focusing their efforts on combating the use of GenAI in assessment. Guidelines were developed for staff and students, policies put in place too. Innovative educators have forged paths in the use of Generative AI for teaching, learning and assessments leading to pockets of transformation springing up across HEIs, often with little or no top-down guidance, support or direction.
This Gasta posits a strategic approach to integrating AI into HEIs to prepare staff, students and the curriculum for an evolving world and workplace. We will highlight the advantages of working with these technologies beyond the realm of teaching, learning and assessment by considering prompt engineering skills, industry impact, curriculum changes, and the need for staff upskilling. In contrast, not engaging strategically with Generative AI poses risks, including falling behind peers, missed opportunities and failing to ensure our graduates remain employable. The rapid evolution of AI technologies necessitates a proactive and strategic approach if we are to remain relevant.
Synthetic Fiber Construction in lab .pptxPavel ( NSTU)
Synthetic fiber production is a fascinating and complex field that blends chemistry, engineering, and environmental science. By understanding these aspects, students can gain a comprehensive view of synthetic fiber production, its impact on society and the environment, and the potential for future innovations. Synthetic fibers play a crucial role in modern society, impacting various aspects of daily life, industry, and the environment. ynthetic fibers are integral to modern life, offering a range of benefits from cost-effectiveness and versatility to innovative applications and performance characteristics. While they pose environmental challenges, ongoing research and development aim to create more sustainable and eco-friendly alternatives. Understanding the importance of synthetic fibers helps in appreciating their role in the economy, industry, and daily life, while also emphasizing the need for sustainable practices and innovation.
Palestine last event orientationfvgnh .pptxRaedMohamed3
An EFL lesson about the current events in Palestine. It is intended to be for intermediate students who wish to increase their listening skills through a short lesson in power point.
How to Make a Field invisible in Odoo 17Celine George
It is possible to hide or invisible some fields in odoo. Commonly using “invisible” attribute in the field definition to invisible the fields. This slide will show how to make a field invisible in odoo 17.
Acetabularia Information For Class 9 .docxvaibhavrinwa19
Acetabularia acetabulum is a single-celled green alga that in its vegetative state is morphologically differentiated into a basal rhizoid and an axially elongated stalk, which bears whorls of branching hairs. The single diploid nucleus resides in the rhizoid.
Instructions for Submissions thorugh G- Classroom.pptxJheel Barad
This presentation provides a briefing on how to upload submissions and documents in Google Classroom. It was prepared as part of an orientation for new Sainik School in-service teacher trainees. As a training officer, my goal is to ensure that you are comfortable and proficient with this essential tool for managing assignments and fostering student engagement.
Francesca Gottschalk - How can education support child empowerment.pptxEduSkills OECD
Francesca Gottschalk from the OECD’s Centre for Educational Research and Innovation presents at the Ask an Expert Webinar: How can education support child empowerment?
Macroeconomics- Movie Location
This will be used as part of your Personal Professional Portfolio once graded.
Objective:
Prepare a presentation or a paper using research, basic comparative analysis, data organization and application of economic information. You will make an informed assessment of an economic climate outside of the United States to accomplish an entertainment industry objective.
The French Revolution, which began in 1789, was a period of radical social and political upheaval in France. It marked the decline of absolute monarchies, the rise of secular and democratic republics, and the eventual rise of Napoleon Bonaparte. This revolutionary period is crucial in understanding the transition from feudalism to modernity in Europe.
For more information, visit-www.vavaclasses.com
Unit 8 - Information and Communication Technology (Paper I).pdfThiyagu K
This slides describes the basic concepts of ICT, basics of Email, Emerging Technology and Digital Initiatives in Education. This presentations aligns with the UGC Paper I syllabus.
June 3, 2024 Anti-Semitism Letter Sent to MIT President Kornbluth and MIT Cor...Levi Shapiro
Letter from the Congress of the United States regarding Anti-Semitism sent June 3rd to MIT President Sally Kornbluth, MIT Corp Chair, Mark Gorenberg
Dear Dr. Kornbluth and Mr. Gorenberg,
The US House of Representatives is deeply concerned by ongoing and pervasive acts of antisemitic
harassment and intimidation at the Massachusetts Institute of Technology (MIT). Failing to act decisively to ensure a safe learning environment for all students would be a grave dereliction of your responsibilities as President of MIT and Chair of the MIT Corporation.
This Congress will not stand idly by and allow an environment hostile to Jewish students to persist. The House believes that your institution is in violation of Title VI of the Civil Rights Act, and the inability or
unwillingness to rectify this violation through action requires accountability.
Postsecondary education is a unique opportunity for students to learn and have their ideas and beliefs challenged. However, universities receiving hundreds of millions of federal funds annually have denied
students that opportunity and have been hijacked to become venues for the promotion of terrorism, antisemitic harassment and intimidation, unlawful encampments, and in some cases, assaults and riots.
The House of Representatives will not countenance the use of federal funds to indoctrinate students into hateful, antisemitic, anti-American supporters of terrorism. Investigations into campus antisemitism by the Committee on Education and the Workforce and the Committee on Ways and Means have been expanded into a Congress-wide probe across all relevant jurisdictions to address this national crisis. The undersigned Committees will conduct oversight into the use of federal funds at MIT and its learning environment under authorities granted to each Committee.
• The Committee on Education and the Workforce has been investigating your institution since December 7, 2023. The Committee has broad jurisdiction over postsecondary education, including its compliance with Title VI of the Civil Rights Act, campus safety concerns over disruptions to the learning environment, and the awarding of federal student aid under the Higher Education Act.
• The Committee on Oversight and Accountability is investigating the sources of funding and other support flowing to groups espousing pro-Hamas propaganda and engaged in antisemitic harassment and intimidation of students. The Committee on Oversight and Accountability is the principal oversight committee of the US House of Representatives and has broad authority to investigate “any matter” at “any time” under House Rule X.
• The Committee on Ways and Means has been investigating several universities since November 15, 2023, when the Committee held a hearing entitled From Ivory Towers to Dark Corners: Investigating the Nexus Between Antisemitism, Tax-Exempt Universities, and Terror Financing. The Committee followed the hearing with letters to those institutions on January 10, 202
Introduction to AI for Nonprofits with Tapp NetworkTechSoup
Dive into the world of AI! Experts Jon Hill and Tareq Monaur will guide you through AI's role in enhancing nonprofit websites and basic marketing strategies, making it easy to understand and apply.
CLASS 11 CBSE B.St Project AIDS TO TRADE - INSURANCE
Say whether each of the following statements is true (“T”) or false .pdf
1. Say whether each of the following statements is true (“T”) or false (“F”).
__ When modifying existing software, changes should follow the style of the original code.
__ In software testing, “path coverage” is another name for “statement coverage”.
__ The file command can be used to assess the type of a file.
__ The “o” in a pattern o+rx that can be given as as argument to chmod(1) stands for “owner”.
__ A downside to operating systems like LINUX and UNIX is that they still use the concept of
processes.
Other operating systems, such as Microsoft Windows, have done away with processes.
__ To send a signal to a process we use the >>> construct in the shell. For example, to send a
SIGKILL to a process with PID 7476, we would give the command
__ A characteristic of TDD (test-driven development) is the extensive use of prototypes.
__ Most UNIX/LINUX (shell) commands are actually the names of programs.
__ A characteristic of iterative software development is that one breaks a problem into a small
problem plus
a series of increments.
__ In a C/C++ program that includes the file , a data type of uint32_t is always 4 bytes in size.
B. (1 mark each, 6 marks total)
In each of the statements below, fill in the blank with the word or phrase which best fits the
overall state- ment.
In the context of output from ps(1), the acronym PPID stands for
_______________________________ .
The name of the environment variable which defines the list of paths searched by bash for
commands is
_________________________ .
Every complete C/C++ program has a function called __________________ . It is the standard
entry point
to the program.
UNIX/LINUX tools (commands) typically follow the convention of writing their output to
____________________________ and reading their input from __________________________
.
In UNIX/LINUX, a(n) _______________ is a named sequence of nonvolatile bytes.
A(n) _______________ is a a pair of streams, one for writing and one for reading, such that
everything written on the output stream can be read from the input stream in order and with full
fidelity.
C. (26 marks)
2. For each of the following multiple-choice1 questions, indicate the answer that is the best
response to the question. Circle the label (e.g. “(a)”) of your intended response in each case.
1. Which of the following sentences describing “testing” and “debugging” is true?
(a) Testing finds bugs, debugging locates error messages.
(b) Testing finds coding faults, debugging locates execution failures.
(c) Testing finds execution failures, debugging locates coding faults.
(d) Testing generates error messages, debugging locates bugs.
(e) None of the above.
1. or, as Peppermint Patty from the Peanuts comic strip would say, “mystical guess”
page 2
Cmpt 214 Midterm Examination
October 21, 2014
Which of the following statements regarding good programming style is true?
(a) A user should preferentially use the layout
rather than
(b) A user should preferentially use the layout if (condition)
{ }
rather than
(c) Either of
if (condition)
{ }
or
can be used. What is more important, however, is that one format is chosen and then used consis-
tently.
(d) Neither
if( condition ) {
}
nor
is an acceptable format.
What is the name of the type of testing that checks that features that were working before are still
work- ing?
(a) White-box testing.
(b) Unit testing.
(c) Regression testing.
(d) Randomized testing.
(e) None of the above.
3. The “#ifdef” construct in C/C++ is an example of
(a) a preprocessor directive.
(b) bad programming style.
(c) TDD.
(d) defensive programming.
(e) None of the above.
page 3
Cmpt 214 Midterm Examination
October 21, 2014
What is the name of a special file in UNIX/LINUX to which one can redirect output and that
output is simply discarded (by the operating system)?
(a) NULL
(b) /dev/null
(c) /root
(d) /usr/bin
(e) Any of the above.
page 4
Cmpt 214 Midterm Examination
October 21, 2014
Consider the following declaration in C:
Given the above, the address of student_records[2] will be the same as the value of which
expression below?
(a) student_records[0]+2
(b) *student_records[2]
(c) *student_records+2
(d) rec_p+2
(e) None of the above.
In a C/C++ program, writing if( 7 == N )
rather than
if( N == 7 )
is an example of what?
(a) Defensive programming.
(b) Iterative software development.
(c) Use of prototypes.
(d) Test-driven development.
(e) All of the above.
4. It is the job of the shell (e.g. bash) to interpret various components of a command. Which of the
following is(are) not interpreted by the shell?
(a) History references, such as !!.
(b) A command alias.
(c) Filename wildcards.
(d) Shell variable names preceded by $.
(e) Arguments enclosed within single quotes, ''.
(f) All of the above.
What is the function of the “>>” operator in the bash command cat foo >> bar
? Assume that the noclobber shell variable is set to its default value.
(a) Passes output of cat(1) to the program (command) bar.
(b) Indicates that data from the file bar should be considered (input) after the data from file foo.
(c) Overwrites file bar with the contents of file foo.
(d) Redirects error messages from the execution of cat into file foo.
(e) None of the above.
page 5
Cmpt 214 Midterm Examination
12. Consider the following sample of code from an in-class example.
October 21, 2014
}
The example was following the in-class programming guidelines and TDD. As such, it is an
example of
(a) defensive programming.
(b) a prototype.
(c) a data definition.
(d) a module template.
(e) a stub.
(f) None of the above.
13. Consider again the following sample of code from an in-class example.
}
The example was following the in-class programming guidelines and TDD. As such, the
return 'F';
statement is an example of
(a) defensive programming.
(b) a prototype.
(c) a data definition.
5. (d) a module template.
(e) a stub.
(f) None of the above.
14. An early version of UNIX was
(a) System III.
(b) System V.
(c) SunOS.
(d) 4.3BSD.
(e) All of the above.
page 6
Cmpt 214 Midterm Examination
October 21, 2014
Consider the following pipelined command:
cat < /etc/passwd | cut -f 3 | wc -l
Which of the following statements is false regarding this complex command?
(a) cut(1) gets its input from a pipe
(b) cut(1) gets its input from its standard input
(c) cat(1) gets its input from its standard input
(d) cat(1) is invoked with one command-line argument
(e) All of the above.
Which of the following commands below can be used to determine what file systems have been
mounted on a (running) LINUX/UNIX file system?
(a) df
(b) uname
(c) hostname
(d) whoami
(e) All of the above.
(f) None of the above.
Which of the following bash commands will produce the output $PATH
?
(a) echo $PATH
(b) echo "$PATH"
(c) echo $PATH
(d) cat $PATH
What is the role of “&” in the command sort foo.txt > bar.txt &
?
6. (a) It forces the overwriting of bar.txt, even if it already exists.
(b) It makes sure that the command completes.
(c) It directs the shell to run the sort process in the background.
(d) It forces the command to be run as a shell built-in.
(e) It tells the shell to execute the command without creating a child process.
(f) None of the above.
A co-worker suggests that worrying about permissions on a file-by-file basis is too much work,
and sug- gests setting the permissions of all files using
chmod 777
Which of the below represents a legitimate response?
(a) This is fine.
(b) Everyone would be able to access my files!
(c) I won't be able to access my own files!
(d) None of the above.
page 7
Cmpt 214 Midterm Examination
October 21, 2014
When input to the shell, the file pathname . (as in ./ ) is used to denote
(a) the user's home directory.
(b) the root directory of the file system.
(c) the current working directory.
(d) None of the above.
What is the name of that portion of the operating system which provides only the minimum of
services
necessary for implementing additional O/S services?
(a) X-Windows.
(b) The kernel.
(c) Root.
(d) A server.
(e) None of the above.
What type of entity can be organized according to “layers of abstraction”, where each layer
defines an abstract machine?
(a) A GUI-based windowing system.
(b) An operating system.
(c) Software designed using TDD.
(d) A testing scaffold.
7. (e) None of the above.
How many processes in total are created by the shell to execute the following complex
command? ls /etc/foobar ; date
(a) 1
(b) 2
(c) 3
(d) 4
(e) None of the above.
Which of the following commands can be used to search for all instances of the string
“TESTING” in all files in the current working directory whose names start with the string
“queen”, then contain a number between 0 and 99, and finally end with “.cc”.
(a) egrep TESTING 'queen[0-9][0-9]?.cc'
(b) egrep 'TESTING' queen[0-9].cc queen[0-9][0-9].cc
(c) egrep TESTING 'queen[0-9]{1,2}.cc'
(d) Any of the above.
What is the name of the “configuration file” for bash, a file of commands that are read and
executed by bash when it starts and prior to prompting the user for input?
(a) .bashrc
(b) login
(c) .login
(d) /etc/config
(e) None of the above.
page 8
Cmpt 214 Midterm Examination October 21, 2014
26. What is the name of a program that you can use to obtain online documentation on tuxworld?
(a) info
(b) man
(c) khelpcenter (d) All of the above.
D. (1 mark each, total 5 marks)
Consider the following LINUX commands (commands one could
give on a tuxworld machine via bash): ls
which whatis
whatis which
(a) ls -l
(b) ls -la
(c) df
8. (d) ps -u $USER
(e) du -s -m /usr/bin
(f) uptime
(g) (h) (i) (j) (k) (l)
Consider each portion of output below. Each was produced by one of the commands above. For
each portion of output, write the letter label of the command which produced that output.
1. ____
15:50:15 up 7 days, 1:39, 20 users, load average: 0.02, 0.02, 0.05
____ which []
____
PID TTY
____ total 18
5. ____ /usr/bin/whatis
E. (1 mark each, total 12 marks)
Suppose that the file phone_directory.txt contains the following lines of information. Each line
consists of 4 fields (columns) separated by single tab characters. The fields are obvious from
viewing the layout of the file when it is printed on a terminal:
page 9
Cmpt 214 Midterm Examination
October 21, 2014
A Hacker B Ator
C Reasoner D BitDiddle E Fect
F Tweakit
We will refer to the above lines in phone_directory.txt by the letters A through F to the left of
each line. For example, A refers the first line, while F refers to the final line. The labelling letters
are not part of the lines of text in the file.
Below are commands (given to bash) that operate on phone_directory.txt. The commands may
or may not produce any output. For each of the commands, enter the letter label (A–F) of the line
in the file phone_directory.txt which originally contained the text which is output first. That is,
for all the commands below, answer the question, “which of the above lines contains the text that
first appears in response to the command?” For example, if a command first yields a line
consisting of the text “Eva” from the second line in phone_directory.txt, you should enter “B” as
the answer to the question (reflecting the fact that this text came from line “B” of
phone_directory.txt). Additionally, if the command generates no output, enter “N”. Finally, if
none of the answers A–F or N is correct, enter “X” as indicating “None of the above”.
grep 't' phone_directory.txt
9. grep 't>' phone_directory.txt
egrep '[0-9]{3}-[01]{3}-[01]{4}$' phone_directory.txt
egrep '.A?' phone_directory.txt
egrep '(^w).*1' phone_directory.txt
egrep -v '^w+W+w+W+wW' phone_directory.txt
sort phone_directory.txt
cut -f 3 < phone_directory.txt | sort -r
cat <<< phone_directory.txt
rm -f a.txt; cat phone_directory.txt a.txt >b.txt 2>e.txt ; cat e.txt
rm -f a.txt; cat phone_directory.txt a.txt >b.txt 2>e.txt ; cat b.txt
sort phone_directory.txt > a.txt; date >> a.txt; cat a.txt
page 10
Cmpt 214 Midterm Examination October 21, 2014
F. (2+1+1+1+1+1+3 = 10 marks)
Answer each of the following questions with a technically-oriented answer. In some cases, a very
short, pre- cise answer is in order. In others, a concise descriptive answer is required.
A programmer would like to make use of the system library function printf(3). The programmer
knows that she will need to include a system “.h” file to be able to use printf(), but does not
know ex- actly which one. What LINUX/UNIX command should the programmer use to obtain
online information to determine the name of the system “.h” file to include? Give the complete
command.
What is the (shell) filename wild-card character that will match one, and only one, arbitrary
character?
What is the bash command involving the history buffer which causes the shell to repeat the
immediately
previous command?
The following fragment of C/C++ exhibits poor programming style. Why? What is wrong with
it?
The following fragment of C/C++ exhibits poor programming style. Why? What is wrong with
it?
}
Consider the following piece of code. It is intended to declare the State datatype according to the
pro- gramming guidelines given in class. Unfortunately, it does not in fact adhere to those
guidelines. Why? What is wrong with it?
Solution
10. 1.Every complete C/C++ program has a function called main( ) function. It is the standard entry
point
to the program.
2. Which of the following statements regarding good programming style is true?
(a) A user should preferentially use the layout
rather than
3..The “#ifdef” construct in C/C++ is an example of a preprocessor directive.