RNA splicing mutations and human disease: Pompe disease - Emanuele Buratti
Convegno del 25 novembre "Diagnosi e management della glicogenosi tipo 2" - Centro di coordinamento regionale malattie rare FVG
A new effector pathway links ATM kinase with the DNA damage responseCostas Demonacos
The related kinases ATM (ataxia-telangiectasia mutated) and ATR (ataxia-telangiectasia and Rad3-related) phosphorylate a limited number of downstream protein targets in response to DNA damage. Here we report a new pathway in which ATM kinase signals the DNA damage response by targeting the transcriptional cofactor Strap. ATM phosphorylates Strap at a serine residue, stabilizing nuclear Strap and facilitating formation of a stress-responsive co-activator complex. Strap activity enhances p53 acetylation, and augments the response to DNA damage. Strap remains localized in the cytoplasm in cells derived from ataxia telangiectasia individuals with defective ATM, as well as in cells expressing a Strap mutant that cannot be phosphorylated by ATM. Targeting Strap to the nucleus reinstates protein stabilization and activates the DNA damage response. These results indicate that the nuclear accumulation of Strap is a critical regulator in the damage response, and argue that this function can be assigned to ATM through the DNA damage-dependent phosphorylation of Strap.
First aid for usmle step 1 with uworld and nbme notes sampleusmlematerialsnet
First Aid For USMLE Step 1 with Uworld and NBME Notes
Download Full book from > usmlematerials.net
Pages: 798
Series: First Aid for the USMLE Step 1
NBMEs and Uworld Notes are added to this file.
CD47 plays a role in nitric oxide signaling and angiogenesis by interacting with other proteins like thrombospondin-1 and vascular endothelial growth factor receptor-2. The document discusses experiments attempting to characterize CD47's role by tagging it with BirA to identify interacting proteins, expressing a truncated version of thrombospondin-1 to activate CD47 and measure calcium responses, and cloning CD47-BirA into a vector for expression. Preliminary results were inconclusive, suggesting the calcium assay and thrombospondin-1 purification need further optimization to understand CD47's signaling mechanisms.
By constructing a plasmid containing flanking sequences of the adenylate cyclase gene and a tryptophan marker gene, researchers aim to knockout the adenylate cyclase gene in Schizophyllum commune via homologous recombination. The plasmid would replace the adenylate cyclase sequence with the tryptophan gene in the genome, allowing only cells without adenylate cyclase to grow in media lacking tryptophan. Using a ku80 knockout strain of S. commune increases the likelihood of homologous recombination during transformation. Primers and restriction enzymes were used to amplify flanking sequences and insert them into a vector plasmid to ultimately construct the adenylate cyclase knockout plasmid.
This study explores how aristolochic acid (AA) affects leptin production in kidney fibroblasts. The researchers found that AA treatment increased leptin secretion and expression in kidney fibroblasts in a time and dose-dependent manner. AA was found to activate C/EBPα and the PI3K/Akt pathway to upregulate leptin expression. Knocking down C/EBPα or inhibiting the PI3K/Akt pathway blocked AA-induced leptin expression, demonstrating these factors are involved in AA's effects on leptin. Overall, the results suggest AA promotes renal fibrosis by stimulating leptin production in fibroblasts through C/EBPα and PI3K/Akt signaling
Thant Bio Symposium Poster Spring 2016Claire Thant
The study found that axonal transport defects activate the PI3K pathway in an attempt to reduce oxidative stress and neuronal cell death in neurodegenerative disease models. Expressing constitutively active PI3K decreased cell death caused by polyQ repeats and Paraquat exposure but did not affect axonal transport blockages. Dominant negative PI3K disrupted normal huntingtin motility, indicating PI3K acts downstream of transport. Motor protein mutations and disease models showed increased levels of p-GSK3β, a PI3K effector, suggesting transport defects trigger the protective PI3K response.
RNA splicing mutations and human disease: Pompe disease - Emanuele Buratti
Convegno del 25 novembre "Diagnosi e management della glicogenosi tipo 2" - Centro di coordinamento regionale malattie rare FVG
A new effector pathway links ATM kinase with the DNA damage responseCostas Demonacos
The related kinases ATM (ataxia-telangiectasia mutated) and ATR (ataxia-telangiectasia and Rad3-related) phosphorylate a limited number of downstream protein targets in response to DNA damage. Here we report a new pathway in which ATM kinase signals the DNA damage response by targeting the transcriptional cofactor Strap. ATM phosphorylates Strap at a serine residue, stabilizing nuclear Strap and facilitating formation of a stress-responsive co-activator complex. Strap activity enhances p53 acetylation, and augments the response to DNA damage. Strap remains localized in the cytoplasm in cells derived from ataxia telangiectasia individuals with defective ATM, as well as in cells expressing a Strap mutant that cannot be phosphorylated by ATM. Targeting Strap to the nucleus reinstates protein stabilization and activates the DNA damage response. These results indicate that the nuclear accumulation of Strap is a critical regulator in the damage response, and argue that this function can be assigned to ATM through the DNA damage-dependent phosphorylation of Strap.
First aid for usmle step 1 with uworld and nbme notes sampleusmlematerialsnet
First Aid For USMLE Step 1 with Uworld and NBME Notes
Download Full book from > usmlematerials.net
Pages: 798
Series: First Aid for the USMLE Step 1
NBMEs and Uworld Notes are added to this file.
CD47 plays a role in nitric oxide signaling and angiogenesis by interacting with other proteins like thrombospondin-1 and vascular endothelial growth factor receptor-2. The document discusses experiments attempting to characterize CD47's role by tagging it with BirA to identify interacting proteins, expressing a truncated version of thrombospondin-1 to activate CD47 and measure calcium responses, and cloning CD47-BirA into a vector for expression. Preliminary results were inconclusive, suggesting the calcium assay and thrombospondin-1 purification need further optimization to understand CD47's signaling mechanisms.
By constructing a plasmid containing flanking sequences of the adenylate cyclase gene and a tryptophan marker gene, researchers aim to knockout the adenylate cyclase gene in Schizophyllum commune via homologous recombination. The plasmid would replace the adenylate cyclase sequence with the tryptophan gene in the genome, allowing only cells without adenylate cyclase to grow in media lacking tryptophan. Using a ku80 knockout strain of S. commune increases the likelihood of homologous recombination during transformation. Primers and restriction enzymes were used to amplify flanking sequences and insert them into a vector plasmid to ultimately construct the adenylate cyclase knockout plasmid.
This study explores how aristolochic acid (AA) affects leptin production in kidney fibroblasts. The researchers found that AA treatment increased leptin secretion and expression in kidney fibroblasts in a time and dose-dependent manner. AA was found to activate C/EBPα and the PI3K/Akt pathway to upregulate leptin expression. Knocking down C/EBPα or inhibiting the PI3K/Akt pathway blocked AA-induced leptin expression, demonstrating these factors are involved in AA's effects on leptin. Overall, the results suggest AA promotes renal fibrosis by stimulating leptin production in fibroblasts through C/EBPα and PI3K/Akt signaling
Thant Bio Symposium Poster Spring 2016Claire Thant
The study found that axonal transport defects activate the PI3K pathway in an attempt to reduce oxidative stress and neuronal cell death in neurodegenerative disease models. Expressing constitutively active PI3K decreased cell death caused by polyQ repeats and Paraquat exposure but did not affect axonal transport blockages. Dominant negative PI3K disrupted normal huntingtin motility, indicating PI3K acts downstream of transport. Motor protein mutations and disease models showed increased levels of p-GSK3β, a PI3K effector, suggesting transport defects trigger the protective PI3K response.
1) The document discusses the relationship between mTORC1, a protein kinase complex that regulates cell growth, and the endosomal system. 2) It reports that disrupting the endosomal system by activating Rab5, which inhibits early to late endosomal conversion, prevents mTORC1 from being activated by amino acids. 3) The findings suggest that proper trafficking through the endosomal system is required for amino acids to induce mTORC1 translocation and activation.
1) The document discusses the relationship between mTORC1, a protein kinase complex that regulates cell growth, and the endosomal system. 2) It reports that disrupting early endosome maturation and fusion using a constitutively active Rab5 mutant inhibits mTORC1 and S6K1 activation in response to amino acids. 3) The findings suggest mTORC1 activation by amino acids requires proper endosomal maturation and an optimal intraluminal pH.
Canvax™ offers a wide range of high quality Human Recombinant Proteins for several research applications like ELISA, Western Blot, Antibody Production or Protein array.
The document summarizes work done in the Montfort lab to study nitric oxide signaling regulation. It describes three goals: 1) Develop a functional readout for thrombospondin-1 using calcium assays, 2) Optimize expression and purification of thrombospondin-1, and 3) Discover proximal protein interactions between CD47 and thrombospondin-1 using BirA proximity labeling. Preliminary results showed angiotensin-II did not increase calcium levels, and thrombospondin-1 expression and purification needed improvement. Cloning of CD47-BirA was initiated to identify signaling partners by mass spectrometry. Future work involves optimizing assays and experiments.
Presentation made by Dr. Paul Taylor on October 30, 2015 at the Alzforum-hosted live webinar titled "Fluid Business: Could “Liquid” Protein Herald Neurodegeneration?"
More information and the recording of the session available at http://www.alzforum.org/webinars/fluid-business-could-liquid-protein-herald-neurodegeneration
This is the Powerpoint presentation from my recent presentation at the TTP LabTech US Acumen Users Group Meeting (UGM) held at the British Consulate-General in Cambridge, MA on May 18, 2010
The document summarizes genetic and mutational characterization of the relV gene of Vibrio cholerae, which encodes a small alarmone synthetase protein called RelV. Key findings include:
1) Site-directed mutagenesis identified five amino acid residues (K107, D129, R132, L150, E188) in the RelA-SpoT domain of RelV that are essential for its (p)ppGpp synthetase activity.
2) Progressive deletion analysis determined the functional N-terminal boundary of RelV to be amino acid 59 and the C-terminal boundary to be amino acid 248, indicating that flanking sequences of the RelA-SpoT
1) PSF, a pre-mRNA splicing factor, was identified as a constituent of PER complexes purified from mouse tissues.
2) PSF recruits the SIN3A-HDAC complex to the Per1 promoter in a circadian manner through interactions with PER complexes.
3) Recruitment of the SIN3A-HDAC complex by the PER complex leads to histone deacetylation at the Per1 promoter, providing a molecular mechanism for circadian clock negative feedback through rhythmic repression of Per1 transcription.
This document discusses Polycomb group (PcG) proteins, which are important repressor proteins that regulate gene expression during development. It describes two main PcG complexes, PRC1 and PRC2, and their mechanisms of action, including histone modifications and chromatin compaction. The document also examines a case study on the interaction between the PcG protein LHP1 and deubiquitinating enzymes UBP12 and UBP13 in Arabidopsis thaliana. The study found that UBP12 and UBP13 interact with and help recruit LHP1 to target genes, and are involved in histone deubiquitination, which impacts gene silencing by PcG proteins.
This study investigated how endoplasmic reticulum (ER) stress induced by glucosamine (GlcN) is involved in pancreatic beta-cell dysfunction. The researchers found that GlcN treatment increased levels of the ER stress markers BiP/GRP78 and CHOP/GADD153 in mouse pancreatic islets and INS-1E beta cells. GlcN also decreased mRNA levels of genes important for beta-cell function like Glut2, glucokinase, and Insulin1. Pretreating cells with a chemical chaperone partially prevented GlcN-induced ER stress and gene expression changes. However, an antioxidant did not prevent ER stress, indicating oxidative stress is not involved. The results suggest
Rin-like (Rinl) is a novel member of the RIN family of proteins that serve as guanine nucleotide exchange factors (GEFs) for Rab GTPases. Rinl preferentially binds and catalyzes GDP/GTP exchange on Rab5a and Rab22, implicating it in endocytic processes regulated by these Rab proteins. Rinl localizes to neuromuscular synapses and interacts with the receptor tyrosine kinase MuSK, a key regulator of neuromuscular synapse development. Overexpression of Rinl affects both fluid-phase and EGFR receptor-mediated endocytosis. Rinl is closely associated with the actin cytoskeleton and thus may recruit Rab5
This document summarizes a study investigating the roles of Rho and ADP-ribosylation Factor (ARF) GTPases in regulating phospholipase D (PLD) activity in human lung adenocarcinoma cells. The study used recombinant Sindbis viruses to express Clostridium botulinum C3 exoenzyme (which inactivates Rho) and a dominant-negative Rho mutant in the cells. Expression of C3 or the mutant Rho increased basal PLD activity and decreased phorbol ester-stimulated PLD activity. Bradykinin- or sphingosine-stimulated PLD activity, which had additive effects, was abolished by C3 or mutant Rho expression. Brefeld
This document reports on a study that investigated the effects of oxidative damage to mRNA on translation. The researchers found that a single oxidative lesion, 8-oxoguanine (8-oxoG), drastically reduced the rate of peptide bond formation during translation by more than three orders of magnitude, regardless of its position within the codon. Interestingly, 8-oxoG had little effect on the fidelity of tRNA selection. This suggests that the modification causes the translational machinery to stall. Consistent with these findings, mRNAs containing 8-oxoG were observed to accumulate and associate with polyribosomes in yeast strains where mRNA surveillance mechanisms were compromised, providing evidence that cells have evolved to cope with damaged mRNA.
The document describes research sequencing the human lymph peptidome using various mass spectrometry techniques. Over 900 peptides were identified from over 480 proteins. The peptides came from intracellular, extracellular, and membrane proteins. Some peptides bound strongly to MHC II molecules, indicating they could be immunologically relevant. Analysis of the molecular functions and pathways identified acute phase response and coagulation proteins. Protease processing pathways generating the peptidome involved matrix metalloproteases, cathepsins, and enzymes from innate immunity and coagulation. The study provides new insights into self-antigens and peptides presented by immune cells.
Presentation made by Dr. Simon Alberti on October 30, 2015 at the Alzforum-hosted live webinar titled "Fluid Business: Could “Liquid” Protein Herald Neurodegeneration?"
More information and the recording of the session available at http://www.alzforum.org/webinars/fluid-business-could-liquid-protein-herald-neurodegeneration
This study investigated BAR130, a novel dual agonist of LXRα and GPBAR1 receptors. In vitro experiments showed that BAR130 activated both receptors in a concentration-dependent manner. When administered to mice, BAR130 did not increase liver lipids or inflammation markers. It increased expression of the GPBAR1 target gene GLP-1 in the intestine but did not induce expression of lipid metabolism genes in the liver. BAR130 represents a promising approach to target metabolic disorders by activating LXRα and GPBAR1 without causing liver lipid accumulation.
- The document examines RNA editing of genes involved in amyloid formation (B2M, APP, ADAM10) in microglia by the enzyme APOBEC1.
- Using murine microglia and BV2 cell lines, it finds C-to-U RNA editing in the 3' UTRs of these genes. Editing only occurs in wild-type mice, not APOBEC1 knockout mice, suggesting APOBEC1 is required.
- Some editing sites are also edited in macrophages. The study provides evidence that APOBEC1 is responsible for RNA editing of APP in murine microglia from brain tissue.
This research project studied post-translational modifications (PTMs) of nicotinamide phosphoribosyltransferase (NAMPT) through site-directed mutagenesis. NAMPT is the rate-limiting enzyme in the NAD+ salvage pathway. The document details the cloning of NAMPT cDNA into expression vectors, generation of point mutations at various PTM sites, expression and purification of mutant proteins, and initial analysis. Future work will involve further mutagenesis and characterization of the mutated NAMPT proteins to better understand how PTMs regulate NAMPT activity and NAD+ regeneration.
This study investigated the effects of bile acids on expression of the proprotein convertase subtilisin/kexin type 9 (PCSK9) gene in human hepatocytes. The following key points are summarized:
1) Treatment with chenodeoxycholic acid (CDCA) significantly decreased both PCSK9 mRNA and protein levels in immortalized human hepatocytes.
2) Activation of the farnesoid X receptor (FXR) by its synthetic agonist GW4064 also decreased PCSK9 expression.
3) Coadministration of CDCA counteracted the statin-induced increase in PCSK9 expression, leading to a potentiation of low-density lip
Western Blotting Of Camkii Β And T 287Beth Salazar
1. Tomato production is affected by various bacterial, fungal and viral diseases which can cause considerable yield losses.
2. One of the most devastating diseases is tomato leaf curl disease (ToLCD), caused by geminiviruses, which is increasing worldwide and poses a major constraint to tomato production in India.
3. ToLCD causes serious yield losses according to studies from the 1940s and more recently. Effective management strategies are needed to control this and other diseases threatening tomato production.
Posttranslational modifications and regulation of gene expression are discussed. Protein synthesis involves transcription of DNA to mRNA in the nucleus, then transport of mRNA to the cytoplasm where translation occurs on ribosomes. The genetic code is explained where codons consisting of three nucleotides specify each of the 20 amino acids. Mutations can occur that result in changes to the amino acid sequence of proteins.
The document discusses several key concepts in molecular biology including DNA, RNA, transcription, translation, and protein synthesis. It explains that DNA is transcribed into RNA which is then translated into proteins. It describes the central dogma of molecular biology and provides more details on processes like transcription, splicing, and translation. It also discusses topics like alternative splicing, RNA editing, and RNA interference.
1) The document discusses the relationship between mTORC1, a protein kinase complex that regulates cell growth, and the endosomal system. 2) It reports that disrupting the endosomal system by activating Rab5, which inhibits early to late endosomal conversion, prevents mTORC1 from being activated by amino acids. 3) The findings suggest that proper trafficking through the endosomal system is required for amino acids to induce mTORC1 translocation and activation.
1) The document discusses the relationship between mTORC1, a protein kinase complex that regulates cell growth, and the endosomal system. 2) It reports that disrupting early endosome maturation and fusion using a constitutively active Rab5 mutant inhibits mTORC1 and S6K1 activation in response to amino acids. 3) The findings suggest mTORC1 activation by amino acids requires proper endosomal maturation and an optimal intraluminal pH.
Canvax™ offers a wide range of high quality Human Recombinant Proteins for several research applications like ELISA, Western Blot, Antibody Production or Protein array.
The document summarizes work done in the Montfort lab to study nitric oxide signaling regulation. It describes three goals: 1) Develop a functional readout for thrombospondin-1 using calcium assays, 2) Optimize expression and purification of thrombospondin-1, and 3) Discover proximal protein interactions between CD47 and thrombospondin-1 using BirA proximity labeling. Preliminary results showed angiotensin-II did not increase calcium levels, and thrombospondin-1 expression and purification needed improvement. Cloning of CD47-BirA was initiated to identify signaling partners by mass spectrometry. Future work involves optimizing assays and experiments.
Presentation made by Dr. Paul Taylor on October 30, 2015 at the Alzforum-hosted live webinar titled "Fluid Business: Could “Liquid” Protein Herald Neurodegeneration?"
More information and the recording of the session available at http://www.alzforum.org/webinars/fluid-business-could-liquid-protein-herald-neurodegeneration
This is the Powerpoint presentation from my recent presentation at the TTP LabTech US Acumen Users Group Meeting (UGM) held at the British Consulate-General in Cambridge, MA on May 18, 2010
The document summarizes genetic and mutational characterization of the relV gene of Vibrio cholerae, which encodes a small alarmone synthetase protein called RelV. Key findings include:
1) Site-directed mutagenesis identified five amino acid residues (K107, D129, R132, L150, E188) in the RelA-SpoT domain of RelV that are essential for its (p)ppGpp synthetase activity.
2) Progressive deletion analysis determined the functional N-terminal boundary of RelV to be amino acid 59 and the C-terminal boundary to be amino acid 248, indicating that flanking sequences of the RelA-SpoT
1) PSF, a pre-mRNA splicing factor, was identified as a constituent of PER complexes purified from mouse tissues.
2) PSF recruits the SIN3A-HDAC complex to the Per1 promoter in a circadian manner through interactions with PER complexes.
3) Recruitment of the SIN3A-HDAC complex by the PER complex leads to histone deacetylation at the Per1 promoter, providing a molecular mechanism for circadian clock negative feedback through rhythmic repression of Per1 transcription.
This document discusses Polycomb group (PcG) proteins, which are important repressor proteins that regulate gene expression during development. It describes two main PcG complexes, PRC1 and PRC2, and their mechanisms of action, including histone modifications and chromatin compaction. The document also examines a case study on the interaction between the PcG protein LHP1 and deubiquitinating enzymes UBP12 and UBP13 in Arabidopsis thaliana. The study found that UBP12 and UBP13 interact with and help recruit LHP1 to target genes, and are involved in histone deubiquitination, which impacts gene silencing by PcG proteins.
This study investigated how endoplasmic reticulum (ER) stress induced by glucosamine (GlcN) is involved in pancreatic beta-cell dysfunction. The researchers found that GlcN treatment increased levels of the ER stress markers BiP/GRP78 and CHOP/GADD153 in mouse pancreatic islets and INS-1E beta cells. GlcN also decreased mRNA levels of genes important for beta-cell function like Glut2, glucokinase, and Insulin1. Pretreating cells with a chemical chaperone partially prevented GlcN-induced ER stress and gene expression changes. However, an antioxidant did not prevent ER stress, indicating oxidative stress is not involved. The results suggest
Rin-like (Rinl) is a novel member of the RIN family of proteins that serve as guanine nucleotide exchange factors (GEFs) for Rab GTPases. Rinl preferentially binds and catalyzes GDP/GTP exchange on Rab5a and Rab22, implicating it in endocytic processes regulated by these Rab proteins. Rinl localizes to neuromuscular synapses and interacts with the receptor tyrosine kinase MuSK, a key regulator of neuromuscular synapse development. Overexpression of Rinl affects both fluid-phase and EGFR receptor-mediated endocytosis. Rinl is closely associated with the actin cytoskeleton and thus may recruit Rab5
This document summarizes a study investigating the roles of Rho and ADP-ribosylation Factor (ARF) GTPases in regulating phospholipase D (PLD) activity in human lung adenocarcinoma cells. The study used recombinant Sindbis viruses to express Clostridium botulinum C3 exoenzyme (which inactivates Rho) and a dominant-negative Rho mutant in the cells. Expression of C3 or the mutant Rho increased basal PLD activity and decreased phorbol ester-stimulated PLD activity. Bradykinin- or sphingosine-stimulated PLD activity, which had additive effects, was abolished by C3 or mutant Rho expression. Brefeld
This document reports on a study that investigated the effects of oxidative damage to mRNA on translation. The researchers found that a single oxidative lesion, 8-oxoguanine (8-oxoG), drastically reduced the rate of peptide bond formation during translation by more than three orders of magnitude, regardless of its position within the codon. Interestingly, 8-oxoG had little effect on the fidelity of tRNA selection. This suggests that the modification causes the translational machinery to stall. Consistent with these findings, mRNAs containing 8-oxoG were observed to accumulate and associate with polyribosomes in yeast strains where mRNA surveillance mechanisms were compromised, providing evidence that cells have evolved to cope with damaged mRNA.
The document describes research sequencing the human lymph peptidome using various mass spectrometry techniques. Over 900 peptides were identified from over 480 proteins. The peptides came from intracellular, extracellular, and membrane proteins. Some peptides bound strongly to MHC II molecules, indicating they could be immunologically relevant. Analysis of the molecular functions and pathways identified acute phase response and coagulation proteins. Protease processing pathways generating the peptidome involved matrix metalloproteases, cathepsins, and enzymes from innate immunity and coagulation. The study provides new insights into self-antigens and peptides presented by immune cells.
Presentation made by Dr. Simon Alberti on October 30, 2015 at the Alzforum-hosted live webinar titled "Fluid Business: Could “Liquid” Protein Herald Neurodegeneration?"
More information and the recording of the session available at http://www.alzforum.org/webinars/fluid-business-could-liquid-protein-herald-neurodegeneration
This study investigated BAR130, a novel dual agonist of LXRα and GPBAR1 receptors. In vitro experiments showed that BAR130 activated both receptors in a concentration-dependent manner. When administered to mice, BAR130 did not increase liver lipids or inflammation markers. It increased expression of the GPBAR1 target gene GLP-1 in the intestine but did not induce expression of lipid metabolism genes in the liver. BAR130 represents a promising approach to target metabolic disorders by activating LXRα and GPBAR1 without causing liver lipid accumulation.
- The document examines RNA editing of genes involved in amyloid formation (B2M, APP, ADAM10) in microglia by the enzyme APOBEC1.
- Using murine microglia and BV2 cell lines, it finds C-to-U RNA editing in the 3' UTRs of these genes. Editing only occurs in wild-type mice, not APOBEC1 knockout mice, suggesting APOBEC1 is required.
- Some editing sites are also edited in macrophages. The study provides evidence that APOBEC1 is responsible for RNA editing of APP in murine microglia from brain tissue.
This research project studied post-translational modifications (PTMs) of nicotinamide phosphoribosyltransferase (NAMPT) through site-directed mutagenesis. NAMPT is the rate-limiting enzyme in the NAD+ salvage pathway. The document details the cloning of NAMPT cDNA into expression vectors, generation of point mutations at various PTM sites, expression and purification of mutant proteins, and initial analysis. Future work will involve further mutagenesis and characterization of the mutated NAMPT proteins to better understand how PTMs regulate NAMPT activity and NAD+ regeneration.
This study investigated the effects of bile acids on expression of the proprotein convertase subtilisin/kexin type 9 (PCSK9) gene in human hepatocytes. The following key points are summarized:
1) Treatment with chenodeoxycholic acid (CDCA) significantly decreased both PCSK9 mRNA and protein levels in immortalized human hepatocytes.
2) Activation of the farnesoid X receptor (FXR) by its synthetic agonist GW4064 also decreased PCSK9 expression.
3) Coadministration of CDCA counteracted the statin-induced increase in PCSK9 expression, leading to a potentiation of low-density lip
Western Blotting Of Camkii Β And T 287Beth Salazar
1. Tomato production is affected by various bacterial, fungal and viral diseases which can cause considerable yield losses.
2. One of the most devastating diseases is tomato leaf curl disease (ToLCD), caused by geminiviruses, which is increasing worldwide and poses a major constraint to tomato production in India.
3. ToLCD causes serious yield losses according to studies from the 1940s and more recently. Effective management strategies are needed to control this and other diseases threatening tomato production.
Posttranslational modifications and regulation of gene expression are discussed. Protein synthesis involves transcription of DNA to mRNA in the nucleus, then transport of mRNA to the cytoplasm where translation occurs on ribosomes. The genetic code is explained where codons consisting of three nucleotides specify each of the 20 amino acids. Mutations can occur that result in changes to the amino acid sequence of proteins.
The document discusses several key concepts in molecular biology including DNA, RNA, transcription, translation, and protein synthesis. It explains that DNA is transcribed into RNA which is then translated into proteins. It describes the central dogma of molecular biology and provides more details on processes like transcription, splicing, and translation. It also discusses topics like alternative splicing, RNA editing, and RNA interference.
This study identified protein arginine methyltransferase 6 (PRMT6) as a coactivator of nuclear factor-kappa B (NF-κB) through three main findings:
1. Transgenic mice overexpressing a fusion of PRMT6 and the estrogen receptor displayed increased levels of interleukin 6 (IL-6), an NF-κB target gene, upon tamoxifen treatment.
2. PRMT6 was found to directly interact with the NF-κB subunit RelA and enhance the transcriptional activity of an NF-κB reporter.
3. PRMT6 was recruited by RelA to selective NF-κB target promoters upon TNF-α stimulation and its overexpression led to increased nuclear accumulation of Rel
This document summarizes molecular pathology of pre-mRNA splicing and discusses how mutations can affect splicing, leading to disease. It describes various methods used to identify pathological splicing mutations experimentally, including RT-PCR to detect mutations. It also discusses how RNA secondary structure and bioinformatics tools can influence splicing and be used to predict structure. Finally, it outlines emerging therapies targeting pre-mRNA splicing, such as antisense oligonucleotides, to treat diseases.
Lydia Yeshitla, Research Scholar at the Neurobiology Section of UCSDLydia Yeshitla
1) The document describes an experiment cloning a pH-sensitive fluorescent protein (pHRed) onto the GLUA1 AMPA receptor subunit to track intracellular trafficking and degradation of AMPA receptors by lysosomes.
2) Restriction enzymes (AGE1 and BSRG1) were used to cut the DNA in order to ligate pHRed onto GLUA1 using PCR. This would allow detection of AMPA receptors in the acidic lysosome lumen.
3) Bacteria were transformed with the ligated pHRed-GluA1 DNA. Colonies were selected and the DNA was sequenced to validate that the cloning procedure was done correctly.
Discriminating Facts from Artefacts in the Secreted Ly-6 Protein FamilyChris Southan
The document discusses several issues related to accurately characterizing the secreted Ly-6 protein family based on bioinformatic analysis. It describes the discovery of novel rat Ly-6 proteins from urine samples and EST data, but also finds chimeric mRNA sequences that combined portions of unrelated genes with Ly-6 sequences, complicating the analysis. Genome mapping showed the chimeras did not represent real gene fusions but likely arose from artifacts. While many rat and mouse homologs were identified, clear orthologs between species were difficult to determine due to high sequence divergence over time.
I am Mark T. I am a Molecular Biology Assignment Expert at nursingassignmenthelp.com. I hold a Masters’ in Medical Biotechnology, from Arizona State University, USA. I have been helping students with their assignments for the past 8 years. I solve assignments related to Molecular Biology.
Visit nursingassignmenthelp.com or email info@nursingassignmenthelp.com. You can also call on +1 678 648 4277 for any assistance with Molecular Biology Assignments.
The document discusses several key aspects of gene prediction including:
1. Gene prediction algorithms use signals like start/stop codons, splice sites, and open reading frames to identify genes computationally with near 100% accuracy.
2. There are ab initio, homology-based, and probabilistic models like Hidden Markov Models that can predict prokaryotic and eukaryotic genes.
3. Eukaryotic gene prediction is more challenging due to larger genomes, fewer genes, and intron-exon structures. Programs must consider splicing, polyadenylation, and other post-transcriptional modifications.
1) The study explores the role of plasma membrane calcium ATPase-4 (PMCA4) and its splice variants in vascular smooth muscle cell (VSMC) cell cycle progression.
2) It finds that the ratio of PMCA4a to PMCA4b splice variants decreases after arterial injury, and that PMCA4 knockout mice have reduced VSMC proliferation and G1 cell cycle arrest.
3) Rescue experiments show that both PMCA4a and PMCA4b can rescue this phenotype, indicating PMCA4 calcium efflux activity regulates G1 progression, though they may act through different downstream effectors.
CRISPR- Trap: a clean approach for the generation of gene knockouts and gene replacements in human cells.- a paper is taken for lab presentation. A very good technique having advantages over conventional KO approaches and allow for the generation of clean CRISPR/ Cas9- based KOs.
P68 RNA helicase unwinds the human let-7 microRNA precursor duplex and is req...David W. Salzman
P68 RNA helicase was identified as being required for unwinding the human let-7 microRNA precursor duplex. Recombinant P68 RNA helicase was shown to unwind the let-7 duplex in vitro. Knockdown of P68 inhibited let-7 microRNA function, indicating P68 is essential for loading let-7 into the silencing complex. This study identifies P68 RNA helicase as playing a key role in the human let-7 microRNA pathway.
The document discusses key processes involved in gene expression and protein synthesis, including DNA replication, transcription, and translation. It provides details on:
1) DNA replication through semiconservative replication where each new DNA double helix contains one original and one new strand synthesized in the 5' to 3' direction.
2) Transcription of DNA into mRNA which is then translated into proteins with the help of tRNA and the ribosome.
3) Translation of mRNA into polypeptide chains using the genetic code where codons in mRNA are recognized by anticodons in tRNA to add amino acids in the correct sequence. Translation terminates when a stop codon is reached.
Protein translation is the process by which the genetic code in mRNA is used to synthesize proteins. It involves transcription of DNA to mRNA, which is then translated into protein with the help of tRNA and the ribosome. There are three main steps - initiation, elongation, and termination. Most proteins undergo post-translational modifications to become fully functional. Secretory and transmembrane proteins are translated on the rough endoplasmic reticulum before being modified and transported to their final destinations.
1) The document reviews recent advances in understanding thalassemia at the molecular level, including characterization of mutations that alter gene expression.
2) It describes the organization and structure of human globin genes, focusing on mutations in the promoter region that decrease gene transcription in beta-thalassemia.
3) Current approaches for treating severe thalassemia are summarized, including bone marrow transplantation and stimulating fetal hemoglobin production, but a cure remains elusive.
This study characterized the Dvilp7 gene from Drosophila virilis through a series of experiments. RNA was purified from D. virilis and used to construct cDNA. RACE experiments were used to amplify the 5' and 3' ends of the Dvilp7 cDNA sequence. The full Dvilp7 cDNA sequence was assembled and found to encode a putative protein with a signal peptide. Genomic DNA was also sequenced and compared to determine intron sequences. Characterizing the Dvilp7 gene expands understanding of the genetic mechanisms regulating insulin signaling in Drosophila.
CRISPR cas9 mediated TERT disruption in cancer cells ChiLerFam
CRISPR/Cas9 was used to disrupt the TERT gene in cancer cells. Three gRNAs targeted exon regions of the TERT gene in HELA, PANC1, and SKBR3 cells, achieving up to 85% editing efficiency as determined by PCR and T7 endonuclease assays. Xenograft experiments found that editing TERT prevented tumor formation in nude mice. While effective, delivery methods need improvement and off-target effects require validation before clinical use. Future work aims to identify additional tumor-specific genes that could be targeted with CRISPR to develop new cancer therapies.
This document provides scientific background on the 2009 Nobel Prize in Chemistry, which was awarded for studies of the structure and function of the ribosome. It summarizes the key contributions of Venkatraman Ramakrishnan, Thomas Steitz, and Ada Yonath, including obtaining the first high resolution crystal structures of the ribosomal subunits, solving the long-standing mysteries of the ribosome's catalytic mechanisms and role in protein synthesis, and advancing understanding of its accuracy and interactions with antibiotic drugs. Their work over decades was instrumental in revealing the ribosome's structure and function at the atomic level.
This laboratory report summarizes an experiment exploring RNA splicing in Drosophila melanogaster. Genomic DNA and total RNA were extracted from fruit flies and used to study the rngo gene. PCR and RT-PCR were performed on the genomic DNA and cDNA samples. The genomic PCR product was cloned and sequenced. Bioinformatics analysis showed the genomic sequence was longer, containing introns absent from the cDNA, indicating splicing of the rngo pre-mRNA. Future work could investigate other splicing sites and homology to human genes.
The 5' terminal uracil of let-7a is critical for the recruitment of mRNA to A...David W. Salzman
This document investigates the interaction between let-7a microRNA, Argonaute2 protein, and mRNA targets. It finds that recombinant Argonaute2 is sufficient to direct let-7a-guided cleavage of a fully complementary mRNA target in vitro. Additionally, it determines that the 5' terminal uracil of let-7a is critical for recruitment of the mRNA target to the let-7a-Argonaute2 complex. Mutation of this 5' uracil inhibits formation of the ternary let-7a-Argonaute2-mRNA complex, but does not affect formation of the binary let-7a-Argonaute2 complex. This suggests the 5' urac
Similar to Regulation of atp7 a gene expression by the grx1 as an inducer in menkes disease (20)
Letter and Document Automation for Bonterra Impact Management (fka Social Sol...Jeffrey Haguewood
Sidekick Solutions uses Bonterra Impact Management (fka Social Solutions Apricot) and automation solutions to integrate data for business workflows.
We believe integration and automation are essential to user experience and the promise of efficient work through technology. Automation is the critical ingredient to realizing that full vision. We develop integration products and services for Bonterra Case Management software to support the deployment of automations for a variety of use cases.
This video focuses on automated letter generation for Bonterra Impact Management using Google Workspace or Microsoft 365.
Interested in deploying letter generation automations for Bonterra Impact Management? Contact us at sales@sidekicksolutionsllc.com to discuss next steps.
Unlock the Future of Search with MongoDB Atlas_ Vector Search Unleashed.pdfMalak Abu Hammad
Discover how MongoDB Atlas and vector search technology can revolutionize your application's search capabilities. This comprehensive presentation covers:
* What is Vector Search?
* Importance and benefits of vector search
* Practical use cases across various industries
* Step-by-step implementation guide
* Live demos with code snippets
* Enhancing LLM capabilities with vector search
* Best practices and optimization strategies
Perfect for developers, AI enthusiasts, and tech leaders. Learn how to leverage MongoDB Atlas to deliver highly relevant, context-aware search results, transforming your data retrieval process. Stay ahead in tech innovation and maximize the potential of your applications.
#MongoDB #VectorSearch #AI #SemanticSearch #TechInnovation #DataScience #LLM #MachineLearning #SearchTechnology
Let's Integrate MuleSoft RPA, COMPOSER, APM with AWS IDP along with Slackshyamraj55
Discover the seamless integration of RPA (Robotic Process Automation), COMPOSER, and APM with AWS IDP enhanced with Slack notifications. Explore how these technologies converge to streamline workflows, optimize performance, and ensure secure access, all while leveraging the power of AWS IDP and real-time communication via Slack notifications.
TrustArc Webinar - 2024 Global Privacy SurveyTrustArc
How does your privacy program stack up against your peers? What challenges are privacy teams tackling and prioritizing in 2024?
In the fifth annual Global Privacy Benchmarks Survey, we asked over 1,800 global privacy professionals and business executives to share their perspectives on the current state of privacy inside and outside of their organizations. This year’s report focused on emerging areas of importance for privacy and compliance professionals, including considerations and implications of Artificial Intelligence (AI) technologies, building brand trust, and different approaches for achieving higher privacy competence scores.
See how organizational priorities and strategic approaches to data security and privacy are evolving around the globe.
This webinar will review:
- The top 10 privacy insights from the fifth annual Global Privacy Benchmarks Survey
- The top challenges for privacy leaders, practitioners, and organizations in 2024
- Key themes to consider in developing and maintaining your privacy program
Taking AI to the Next Level in Manufacturing.pdfssuserfac0301
Read Taking AI to the Next Level in Manufacturing to gain insights on AI adoption in the manufacturing industry, such as:
1. How quickly AI is being implemented in manufacturing.
2. Which barriers stand in the way of AI adoption.
3. How data quality and governance form the backbone of AI.
4. Organizational processes and structures that may inhibit effective AI adoption.
6. Ideas and approaches to help build your organization's AI strategy.
Building Production Ready Search Pipelines with Spark and MilvusZilliz
Spark is the widely used ETL tool for processing, indexing and ingesting data to serving stack for search. Milvus is the production-ready open-source vector database. In this talk we will show how to use Spark to process unstructured data to extract vector representations, and push the vectors to Milvus vector database for search serving.
Your One-Stop Shop for Python Success: Top 10 US Python Development Providersakankshawande
Simplify your search for a reliable Python development partner! This list presents the top 10 trusted US providers offering comprehensive Python development services, ensuring your project's success from conception to completion.
A Comprehensive Guide to DeFi Development Services in 2024Intelisync
DeFi represents a paradigm shift in the financial industry. Instead of relying on traditional, centralized institutions like banks, DeFi leverages blockchain technology to create a decentralized network of financial services. This means that financial transactions can occur directly between parties, without intermediaries, using smart contracts on platforms like Ethereum.
In 2024, we are witnessing an explosion of new DeFi projects and protocols, each pushing the boundaries of what’s possible in finance.
In summary, DeFi in 2024 is not just a trend; it’s a revolution that democratizes finance, enhances security and transparency, and fosters continuous innovation. As we proceed through this presentation, we'll explore the various components and services of DeFi in detail, shedding light on how they are transforming the financial landscape.
At Intelisync, we specialize in providing comprehensive DeFi development services tailored to meet the unique needs of our clients. From smart contract development to dApp creation and security audits, we ensure that your DeFi project is built with innovation, security, and scalability in mind. Trust Intelisync to guide you through the intricate landscape of decentralized finance and unlock the full potential of blockchain technology.
Ready to take your DeFi project to the next level? Partner with Intelisync for expert DeFi development services today!
Ocean lotus Threat actors project by John Sitima 2024 (1).pptxSitimaJohn
Ocean Lotus cyber threat actors represent a sophisticated, persistent, and politically motivated group that poses a significant risk to organizations and individuals in the Southeast Asian region. Their continuous evolution and adaptability underscore the need for robust cybersecurity measures and international cooperation to identify and mitigate the threats posed by such advanced persistent threat groups.
leewayhertz.com-AI in predictive maintenance Use cases technologies benefits ...alexjohnson7307
Predictive maintenance is a proactive approach that anticipates equipment failures before they happen. At the forefront of this innovative strategy is Artificial Intelligence (AI), which brings unprecedented precision and efficiency. AI in predictive maintenance is transforming industries by reducing downtime, minimizing costs, and enhancing productivity.
HCL Notes and Domino License Cost Reduction in the World of DLAUpanagenda
Webinar Recording: https://www.panagenda.com/webinars/hcl-notes-and-domino-license-cost-reduction-in-the-world-of-dlau/
The introduction of DLAU and the CCB & CCX licensing model caused quite a stir in the HCL community. As a Notes and Domino customer, you may have faced challenges with unexpected user counts and license costs. You probably have questions on how this new licensing approach works and how to benefit from it. Most importantly, you likely have budget constraints and want to save money where possible. Don’t worry, we can help with all of this!
We’ll show you how to fix common misconfigurations that cause higher-than-expected user counts, and how to identify accounts which you can deactivate to save money. There are also frequent patterns that can cause unnecessary cost, like using a person document instead of a mail-in for shared mailboxes. We’ll provide examples and solutions for those as well. And naturally we’ll explain the new licensing model.
Join HCL Ambassador Marc Thomas in this webinar with a special guest appearance from Franz Walder. It will give you the tools and know-how to stay on top of what is going on with Domino licensing. You will be able lower your cost through an optimized configuration and keep it low going forward.
These topics will be covered
- Reducing license cost by finding and fixing misconfigurations and superfluous accounts
- How do CCB and CCX licenses really work?
- Understanding the DLAU tool and how to best utilize it
- Tips for common problem areas, like team mailboxes, functional/test users, etc
- Practical examples and best practices to implement right away
Best 20 SEO Techniques To Improve Website Visibility In SERPPixlogix Infotech
Boost your website's visibility with proven SEO techniques! Our latest blog dives into essential strategies to enhance your online presence, increase traffic, and rank higher on search engines. From keyword optimization to quality content creation, learn how to make your site stand out in the crowded digital landscape. Discover actionable tips and expert insights to elevate your SEO game.
2. INTRODUCTION
Menkes disease is an X-linked disease due to mutations in a gene which is designated as ATP7A
gene (basolateral form). The apical form of this gene, ATP7B is known to cause Wilson disease.
ATP7A gene is known as the Cu++ transporting alpha polypeptide while the beta polypeptide is
the ATP7B gene. Copper is necessary for the cells but a defect in the ATP7A gene leads to toxic
accumulation of this heavy metal in the body. Menkes disease effects the bone, hair, skin,
blood vessels and nerve function.
ATP7A gene encodes for a P-type copper transolcating ATPase which generally stays in the
trans-Golgi network and then shuttles in and out as per requirement. It has heavy-metal
binding domains in the N-terminal and these are six in number which bind Cu via their CxxC
amino acid motifs, where X is any amino acid ( C is the acronym for Cysteine). The Cysteine
residues aid in the Cu metal binding to these domains via their thiol groups. Also, these
Cysteine residues (thiol groups) are glucathionylated which triggers the binding of Glrx1 to the
CxxC motif of the N-terminal side of ATP7A thus forwarding the entire process of ATP7A to
supply Copper to the enzymes needing it and to help the cells in the efflux of excess Copper
from it.
A mutation in the ATP7A gene results in the production of an abnormal truncated protein which
gets stuck in the cell membrane and thus cannot shuttle in and out from the Golgi apparatus.
This mutated activity disrupts the normal distribution of Copper in the body leading to
accumulation of Copper , also impairing the Copper-dependent enzyme activities in the body
affecting the bone, skin, hair, blood and nervous system.
GENE INFORMATION :
Name of the Gene : ATP7A; ATPase, Cu++ transporting, alpha polypeptide
Accession number : NM_000052
Species : Homo sapiens
Size : 8499 base pairs (bp)
Chromosome location : Xq 13.2 (q is the long arm)
Reason for the disease : Mutations such as ‘Deletions’ ‘Transitions’ ‘Nonsense’ or ‘Mismatch’
are the most common mutations causing Menkes disease and thus, a truncated ATP7A protein
which is not long enough to bind Copper and activate Glrx1 activity for further metabolism. The
shortened ATP7A remains in the Trans-Golgi network because it can not reach out for the
normal activity.
3. cDNA sequence of ATP7A
5’atggatccaa gtatgggtgtgaattctgtt accatttctg ttgagggtat gacttgcaat tcctgtgttt
ggaccattgagcagcagatt ggaaaagtga atggtgtgca tcacattaag gtatcactgg aagaaaaaaa
tgcaactatt atttatgacc ctaaactaca gactccaaag accctacagg aagctattgatgacatgggc
///////////////////////////////////////////////////////////////////////////
taaactttac aggaaaccaa tcagcgttca tgttggaata gatgatacct caaggaattctcctaaactg
ggtttgctgg accggattgt taattatagc actgtctgat aaacgctccc taaacagtgt tgttaccagt
gaacctgaca agcactcactcctggtggga gacttcaggg aagatgatga cactgcatta taa 3’
3’ cc ttctactact gtgacgtaat att 5’
Protein size : 8499bp/3 x 110=311.63 kDa
Requisites for PCR
Primers (Primer design)
Top Primer :
- Tm = 70⁰C
- Sequence
5’ atggatccaa gtatgggtgtgaatt 3’
Bottom Primer :
- Tm = 68⁰C
- Sequence
5’ ttataatgcagtgtcatcatcttcc 3’
LINKERS
The restriction sites on pmWasabi-C and our gene of interest gives us two restriction enzymes –
BsaAI and DraI.
Top Primer with BsaAI Linker
5’ acgt atggatccaa gtatgggtgtgaatt 3’
Bottom Primer with DraI Linker
5’ ttt ttataatgcagtgtcatcatcttcc 3’
*Used NEBcutter online version for the above restriction site determination; we can also
MOLECULAR COMBING technique.
4. In-vitro protocol for the process:
Raw Material. Amniotic stem cells (diseased and normal), DNA isolation kit, enzymes, cell
culture system, PCR, synthetic tRNA suppressors (amber, UAG; opal, UGA)
Procedure. ATP7A gene is also expressed in the placenta, due to its functional importance.
Amniocentesis allows us to isolate few amniotic stem cells from the amniotic fluid around the
growing embryo. These cells are grown in vitro in a culture dish. When these cells are at least
70-80% confluent in the dish, they are Trypsinised and the cell suspension is centrifuged . The
pellet that is obtained now contains DNA and RNA. It is treated with Dnases. The mRNA from
total RNA content is isolated using Oligo (dT) magnetic beads. To isolate ATP7A mRNA, we use
His Trap ᵀᴹ Column for Affinity chromatographical separation of Histidine rich ATP7A mRNA.
Wash the column with Elution buffer and the eluate contains ATP7A mRNA. mRNA is Reverse
Transcribed into cDNA using RT-PCR and the above designed primers. cDNA is amplified by PCR.
The product is then purified using PCR product purifying kit. The cDNA is then subjected to
restriction digestioin with enzymes BsaAI and DraI. The vector Allᵉᴵᵉustrious pmWasabi-C is also
treated with the same two restriction enzymes. Followin digestion, the cDNA is inserted into
the expression vector using Ligase. The plasmid is transformed into competent DH5α cells
(better strain than others) by heat shock. These cells are plated in LB-Agar medium containing
Ampicillin (ampᴿ gene present in the Vector is used for selection of transformed cells). The
selected cells are inoculated and cultured in LB media containing Ampicillin. The recombinant
plasmids are then isolated by screening and selection.
Validation of cDNA. The plasmids obtained can be validated by :
1) Restriction digestion of the plasmids with BsaAI and DraI. The produced fragments are then
run on gel and the bands obtained corresponding to the ‘gene of interest’ and ‘vector used’ are
observed.
2) Automated DNA sequencing of the resultant recombinant plasmid will also give us the ‘gene’
and ‘vector’ sequence.
3) Restriction digestion using only BsaAI will give a linear molecule from which the cDNA can be
validated using DNA Microarray technique by using probed DNA primers complementary to the
gene/cDNA region.
5. Transfection of the recombinant plasmid
TARGET CELLS : Paneth or Goblet cell lines (Small Intestine where Cu²⁺ absorption occurs)
TRANSFECTION METHOD : Liposome mediated transfection
VALIDATION of TRANSFECTION :
The expression vector we are using is a Green Fluorescent protein (GFP) which can be detected
and thus our protein localisation can be visualised under Flourescent microscope.
Two more methods that we may use for validation :
1) IMMUNOSTAINING : A primary antibody is used against target ATP7A protein. Then a
secondary antibody tagged with a Fluorophore/Chromophore is used against the primary
antibody. The reaction between these two give detectable results which can be visualised
under the microscope if the protein is translated successfully.
2) WESTERN BLOT : The protein is isolated traditionally and run on SDS-PAGE gel. This gel is
then transferred onto the membrane and a primary antibody agains ATP7A protein is used. We
then incubate this membrane with a secondary antibody against the primary antibody. The
binding of these two gives a chemiluminiscent reaction which can be developed on the X-ray
film in a dark room.
6. RESEARCH PROPOSAL
GOAL : The goal is to design codon read-through ‘tRNA suppressors’ for UGA termination
codons which occur in some exons of the ATP7A gene due to mutations (Nonsense) leading to
sudden termination and thus a non-functional truncated protein which remains in the Trans-
Golgi network due to unusually shortened length.
BACKGROUND : According to many experiments conducted on the Mouse homolog of Human
ATP7A gene, it was found that this gene produces a protein which help in Cu ²⁺ absorption as
well as efflux of the excess and is Copper-transporting ATPase (Vulpe et al, 1993). The different
mutations of the ATP7A gene that lead to Menkes Disease were X-linked recessive with point
mutations and exon skipping were observed and identified by Kaler et al, 1994; Tumer et al,
1997; Poulsen et al, 2002; Moller et al, 2005; Moizard et al, 2011. Almost all of these mutations
led to a truncated ATP7A protein.
The work of Chiara Cecchi, Mario Tosi et al, 1997 indicated the 3D model of the ATP7A gene
which showed the transmembrane properties of the protein and indicated the 6 metal binding
domains on the -NH₂ terminal and an ATP-binding domain on the –COOH terminal. The
presence of this protein in the Gastrointestinal tract and Golgi body was determined by Ilia
Voskoboinik et al, 2002 and Subba Rao Gangi Setty et al, 2008 and Sharon La Fontaine et al,
1998. The metal binding sites have a consensus sequence of MXCXXC where X is any amino acid
and the main domains important for proper functioning of ATP7A is Metal binding site 5 and 6
was determined by Daniel Strausak et al, 1999. The ATP7A is also rich in amino acid Histidine
and Methionine, which is found to be essential for ATP7A was studied by Yan Guo et al, 2004.
OUTLINE : The ATP7A protein (an ATPase) is truncated due to the mutations (nonsense, etc)
and thus its Cu²⁺effluxing is affected leading to accumulation of Cu²⁺ in high toxic
concentrations. Glrx1 interacts with ATP7A’s CXXC motifs in the N-terminal which is signalled by
glutathionylation of the ‘Cysteine’s thiol residues’ but Glrx1 cannot sense that in a truncated
protein. Thus, we can create an expression cassette including ATP7A gene and Glrx1 and insert
into the same vector.
RESULT ANALYSIS : The validation can be done using the GFP in the pmWasabi-C vector. Once
the glutathionylation (post-translational modification) occurs, Glrx1, due to close proximity of
transcription of the gene, might be able to bind to the N-terminal of ATP7A and carry forth the
functional responsibility as in a normal situation. We can make use of the Locus control regions
(LCR) of both genes to stimulate gene expression as per the layout. If this works, we can then
use this ‘expression cassette’ as a gene therapy for Menkes Disease.
(*http://www.ncbi.nlm.nih.gov/projects/gorf/orfig.cgi- the mutation can be counted and
analysed using ORF Finder, maximum are point mutations of various kinds)
8. REFERENCES
1. Danks, D. M., Campbell, P. E., Stevens, B. J., Mayne, V., Cartwright, E. Menkes’ kinky
hair syndrome: an inherited defect in copper absorption with widespread effects.
Pediatrics 50: 188-201, 1972
2. Tumer, Z., Horn, N. Menkes disease: recent advances and new aspects.
J.Med. Genet. 34: 265-274, 1997
3. Moller, L. B., Bukrinsky, J. T., Molgaard, A., Paulsen, M., Lund, C., Tumer, Z., Larsen, S.,
Horn, N. Identification and analysis of 21 novel disease-causing amino acid
substitutions in the conserved part of ATP7A.
Hum. Mutat. 26: 84-93, 2005
4. Poulsen, L., Horn, N., tumer, Z., Heilstrup, H., Lund, C., Moller, L. B. X-linked recessive
Menkes disease : identification of partial gene deletions in affected males.
Clin. Genet. 62: 449-457, 2002
5. Moizard, M., Ronce, N., Blessen, S., Bieth, E., Burglen, L., Mignot, C., Mortemousque,
I., Marmin, N., Dessay, B., Danesino, C., Feillet, F., Castelnau, P., Toutain, A., Moraine,
C., Raynaud M Twenty-five novel mutations includiing duplications in the ATP7A gene.
Clin. Genet. 79: 243-253, 2011
6. Zeynep, T., Lisbeth, B. M., Nina, H. Mutation spectrum of ATP7A, the gene defective in
Menkes disease. Adv. Exp. Med. Biol. 448: 83-95, 1999
7. Baci, L., Bertini, I., Cantini, F., Migliardi, M., Rosato, A., Wang, S.
An atomic-level investigation of the disease causing A629P mutant of the Menked
protein, ATP7A. J Mol Biol 16: 352(2) : 409-17, 2005
8. Kuo, Y. M., Gitshcier, J., Packman, S. Developmental expression of the mouse mottled
and toxic milk genes suggests distinct functions for the Menkes and Wilson disease
Copper transporters. Hum. Molec. Genet. 6: 1043-1049, 1997
9. Tumer, Z., Lund, C., Tolshave, J., Vural, B., Tonnesen, T., Horn, N.
Identification of point mutations in 41 unrelated patients affected with Menkes disease.
Am. J. Hum. Genet. 60: 63-71, 1997
10. Gourdon, P., Liu, X. Y., Skjorringe, T., Morth, J. P., Moller, L. B., Pedersen, B. P., Nissen,
P. Crystal structure of copper-transporting PIB-type ATPase. Nature 475: 59-64, 2011
11. William C. J., Kelly T. M., Michael A. C., Wendy R. W., Ross M., Yu Y., Philip E. T., Julian
F. B. M., Sharon L. F. Role of Glutaredoxin 1 and Glutathione in regulating the activity of
the copper-transporting P-type ATPases, ATP7A and ATP7B.
The Journal of Biological Chemistry 285 : 27111-27121, 2010
12. http://www.ncbi.nlm.nih.gov/nuccore/NM_000052.5
The source pages are attached on the next page, for ATP7A sequence as obtained from
NCBI site.