This document summarizes research exploring the biochemical properties and remediation applications of an unusual P450 system (XplA/B) found in Rhodococcus bacteria that is able to degrade the explosive compound RDX. Key findings include:
1) XplA has a high affinity for RDX (Kd = 58 μM) and XplB functions as its native reductase partner to efficiently degrade RDX.
2) Expression of both XplA and XplB in Arabidopsis plants enables significantly faster removal of RDX from contaminated liquid culture and soil compared to plants expressing only XplA.
3) Under anaerobic conditions, RDX degradation by XplA/B produces
Structural Determinants of Drugs Acting on the Nav1.8 ChannelShahnaz Yusaf
1) The study investigated the roles of pore-lining residues in sodium channel Nav1.8 in drug binding and functional properties using alanine mutations and patch clamp recordings.
2) Mutations of some residues altered voltage dependence of activation and inactivation kinetics, indicating their importance in gating.
3) Mutations of residues I381A, F1710A, and Y1717A reduced affinity of tetracaine, while mutations of residues L1410A and F1710A altered affinity of compound A-803467, showing the involvement of these residues in drug binding.
This document summarizes a study that found evidence of a base triple interaction in the 58 nucleotide domain of 23S ribosomal RNA through comparative sequence analysis and experiments. The analysis identified covariations between positions 1092/1099 and the unpaired position 1072, suggesting they form a base triple. Mutation experiments showed disruption of the tertiary structure and reduced protein binding when position 1072 was altered, but not when the base pair 1092/1099 was altered, supporting a base triple. Fully compensating the mutations restored wild-type tertiary structure and binding.
This document describes a study characterizing a novel gene cluster involved in the degradation of 4-chlorocatechol by Pseudomonas reinekei MT1. The researchers found that during growth on 5-chlorosalicylate, a novel (chloro)catechol 1,2-dioxygenase (C12OccaA) and a novel (chloro)muconate cycloisomerase (MCIccaB) were induced. MCIccaB was found to transform 3-chloromuconate into equal amounts of cis-dienelactone and protoanemonin, acting as a functional intermediate between known chloromuconate cycloisomerases and muconate cycloisomerases
This document summarizes a study that investigated the complexes containing the RNA helicase DDX6, which is a key component of P-bodies involved in posttranscriptional regulation. The researchers identified DDX6 complexes using tandem affinity purification coupled with mass spectrometry. They found that DDX6 was present in three main complexes: the decapping complex, a CPEB-like complex, and an Ataxin2/Ataxin2L complex. Investigation of P-body assembly under various conditions identified three proteins required for assembly in all conditions: DDX6, 4E-T, and LSM14A. The results reveal that P-body assembly involves different pathways that nevertheless share these three key factors connecting
RNase contamination was preventing accurate measurement of RNA-protein binding between LARP6 and its RNA substrate. The researchers optimized native polyacrylamide gel electrophoresis with biotinylated RNA to visualize and quantify binding. They showed biotinylation worked without detecting RNase contamination. Continued gel condition optimization will improve resolution for determining the functional boundaries of the LARP6 La Module domain required for RNA binding.
The bc1 complex provides reduced cytochrome c to either the aa3 or cbb3 oxidases depending on oxygen conditions in R. sphaeroides. Strain BC-17 cannot photosynthesize due to lack of bc1 complex reducing cbb3. Some H217 mutations in the QI site can photosynthesize with DMSO but revert or are lethal without it. Future work should introduce H217 mutations into a DorR-/PpsR- background to uncouple effects on bc1 from changes to photosystem expression levels.
IRJET- Understanding the cDNA isolation and antimitogenic property in plant l...IRJET Journal
This document summarizes research on the isolation and characterization of cDNA from plant lectins and their anti-mitogenic properties. Key points include:
- Plant lectins are proteins found in many plants that bind carbohydrates and can agglutinate red blood cells. Their structure gives therapeutic and biotechnological potential.
- Researchers have isolated cDNA from various plants like Glechoma hederacea and Salvia stenophylla to study lectin genes and properties. Methods included RNA isolation, cDNA library construction, sequencing, and molecular modeling.
- Studies found that isolated lectins showed anti-mitogenic effects, inhibiting the growth and killing of some cancer cell lines, utilizing their carbohydrate-binding and toxic
tuning the pH Response of i-Motif DNA Oligonucleotides_Lannes_et_al-2015-Chem...saheli halder
This document discusses tuning the pH response of i-motif DNA oligonucleotides. The authors introduced 5-methylcytosines (5-MeC) and 5-bromocytosines (5-BrC) into the human telomeric i-motif sequence to shift its pH response range. They found that 5-MeC shifted the pH response towards more basic values, while 5-BrC shifted it towards more acidic values. Additionally, lengthening the sequence shifted the pH response in a more basic direction. The modifications did not thermally destabilize the i-motifs. 5-BrC substitution led to a ten-fold increase in folding kinetics compared to the other sequences.
Structural Determinants of Drugs Acting on the Nav1.8 ChannelShahnaz Yusaf
1) The study investigated the roles of pore-lining residues in sodium channel Nav1.8 in drug binding and functional properties using alanine mutations and patch clamp recordings.
2) Mutations of some residues altered voltage dependence of activation and inactivation kinetics, indicating their importance in gating.
3) Mutations of residues I381A, F1710A, and Y1717A reduced affinity of tetracaine, while mutations of residues L1410A and F1710A altered affinity of compound A-803467, showing the involvement of these residues in drug binding.
This document summarizes a study that found evidence of a base triple interaction in the 58 nucleotide domain of 23S ribosomal RNA through comparative sequence analysis and experiments. The analysis identified covariations between positions 1092/1099 and the unpaired position 1072, suggesting they form a base triple. Mutation experiments showed disruption of the tertiary structure and reduced protein binding when position 1072 was altered, but not when the base pair 1092/1099 was altered, supporting a base triple. Fully compensating the mutations restored wild-type tertiary structure and binding.
This document describes a study characterizing a novel gene cluster involved in the degradation of 4-chlorocatechol by Pseudomonas reinekei MT1. The researchers found that during growth on 5-chlorosalicylate, a novel (chloro)catechol 1,2-dioxygenase (C12OccaA) and a novel (chloro)muconate cycloisomerase (MCIccaB) were induced. MCIccaB was found to transform 3-chloromuconate into equal amounts of cis-dienelactone and protoanemonin, acting as a functional intermediate between known chloromuconate cycloisomerases and muconate cycloisomerases
This document summarizes a study that investigated the complexes containing the RNA helicase DDX6, which is a key component of P-bodies involved in posttranscriptional regulation. The researchers identified DDX6 complexes using tandem affinity purification coupled with mass spectrometry. They found that DDX6 was present in three main complexes: the decapping complex, a CPEB-like complex, and an Ataxin2/Ataxin2L complex. Investigation of P-body assembly under various conditions identified three proteins required for assembly in all conditions: DDX6, 4E-T, and LSM14A. The results reveal that P-body assembly involves different pathways that nevertheless share these three key factors connecting
RNase contamination was preventing accurate measurement of RNA-protein binding between LARP6 and its RNA substrate. The researchers optimized native polyacrylamide gel electrophoresis with biotinylated RNA to visualize and quantify binding. They showed biotinylation worked without detecting RNase contamination. Continued gel condition optimization will improve resolution for determining the functional boundaries of the LARP6 La Module domain required for RNA binding.
The bc1 complex provides reduced cytochrome c to either the aa3 or cbb3 oxidases depending on oxygen conditions in R. sphaeroides. Strain BC-17 cannot photosynthesize due to lack of bc1 complex reducing cbb3. Some H217 mutations in the QI site can photosynthesize with DMSO but revert or are lethal without it. Future work should introduce H217 mutations into a DorR-/PpsR- background to uncouple effects on bc1 from changes to photosystem expression levels.
IRJET- Understanding the cDNA isolation and antimitogenic property in plant l...IRJET Journal
This document summarizes research on the isolation and characterization of cDNA from plant lectins and their anti-mitogenic properties. Key points include:
- Plant lectins are proteins found in many plants that bind carbohydrates and can agglutinate red blood cells. Their structure gives therapeutic and biotechnological potential.
- Researchers have isolated cDNA from various plants like Glechoma hederacea and Salvia stenophylla to study lectin genes and properties. Methods included RNA isolation, cDNA library construction, sequencing, and molecular modeling.
- Studies found that isolated lectins showed anti-mitogenic effects, inhibiting the growth and killing of some cancer cell lines, utilizing their carbohydrate-binding and toxic
tuning the pH Response of i-Motif DNA Oligonucleotides_Lannes_et_al-2015-Chem...saheli halder
This document discusses tuning the pH response of i-motif DNA oligonucleotides. The authors introduced 5-methylcytosines (5-MeC) and 5-bromocytosines (5-BrC) into the human telomeric i-motif sequence to shift its pH response range. They found that 5-MeC shifted the pH response towards more basic values, while 5-BrC shifted it towards more acidic values. Additionally, lengthening the sequence shifted the pH response in a more basic direction. The modifications did not thermally destabilize the i-motifs. 5-BrC substitution led to a ten-fold increase in folding kinetics compared to the other sequences.
1) The document examines the effects of antimycin A and monofluoroacetate treatments on reactive oxygen species (ROS) production and citrate levels in Arabidopsis thaliana leaves.
2) The treatments were found to increase ROS production, as measured by dichloroflourscein diacetate and 3,3-diaminobenzidine. Citrate levels decreased over time with the treatments.
3) Antimycin A treatment led to the highest increase in ROS production and greatest decrease in citrate levels, while monofluoroacetate treatment resulted in lower ROS production and higher citrate levels compared to the control.
This document presents a structure/function model for the enzyme 1-pyrroline-5’ carboxylate reductase (P5CR) based on similarities to the β-hydroxyacid dehydrogenase enzyme family. The model is supported by evidence that recombinant E. coli P5CR has similar secondary structure to a β-hydroxyacid dehydrogenase and contains conserved functional domains. Site-directed mutagenesis of conserved residues in the proposed substrate-binding domain reduced catalytic efficiency. Chemical modification studies also provided insights into active site residues. The model proposes γ-glutamate semialdehyde as a potential true substrate based on inhibition studies.
This document summarizes a study that identified a novel reactive chlorine species (RCS) defense mechanism in the bacterium Azospira suillum. The study found:
1) A sigma factor (SigF) and its anti-sigma factor (NrsF) regulate expression of genes involved in RCS defense, including a methionine-rich periplasmic protein (MrpX) and a methionine sulfoxide reductase (YedY1).
2) MrpX is strongly induced by RCS like hypochlorite and acts to scavenge it through methionine oxidation, while YedY1 regenerates reduced MrpX.
1) Rv3717 is a novel N-acetylmuramoyl-L-alanine amidase enzyme from Mycobacterium tuberculosis that was determined to have a single-domain structure at 1.7 Angstrom resolution.
2) Unlike other bacterial autolysins, Rv3717 lacks a separate cell-wall binding domain and instead uses its net positive charge for substrate binding.
3) The crystal structure revealed a flexible hairpin turn that partially occludes the active site, which may be involved in autoregulation of enzymatic activity similar to other bacterial amidases.
Structural Modeling of the Ptf1a C2 Sequence Bound to Mammalian Rbpj and RbjlWard Coats
In this study, the researchers:
1) Generated structural models of the C2 sequence of Ptf1a bound to the β-trefoil domains of mammalian Rbpj and Rbpjl.
2) Found that the C2 sequence binds in an extended conformation, maintaining interactions seen in the Notch-IC/Rbpj complex.
3) Observed conserved residues in the hydrophobic pocket that maintain binding of proteins with a conserved tryptophan motif.
This document reports on a study of the oxygenation properties of hemoglobin from the earthworm Lumbricus terrestris under varying conditions of pH, salts, and temperature. Key findings include:
1) Hemoglobin from L. terrestris exhibits relatively small cooperativity (free energy of 1.6-2.8 kcal/mol) and a large, pH-dependent Hill coefficient that reaches a maximum of 7.9.
2) Cations, not anions, control oxygen binding, with divalent cations having a larger effect than monovalent cations. Effectiveness decreases in the order Ca2+ > Sr2+ > Ba2+ and Mg2+ > Na+.
1. A bacterium named GFAJ-1 was isolated from sediment in Mono Lake, California that can use arsenic instead of phosphorus for growth.
2. Experiments showed that GFAJ-1 was able to uptake arsenate from the growth medium and incorporate it into biomolecules like DNA, proteins, and metabolites.
3. X-ray spectroscopy analysis provided evidence that arsenate was incorporated into the bacterium's biomolecules in a similar configuration to phosphate. This finding suggests life may be possible in environments lacking phosphorus but containing arsenic.
- Ostreococcus tauri is a species of marine microalgae that is able to grow in minimal media lacking cobalt and cobalamin, even though it lacks the gene for the cobalamin-independent methionine synthase METE. This suggests it can synthesize methionine without cobalamin.
- The author proposes that the sole methionine synthase in O. tauri, METH, may be able to function similar to METE by facilitating direct methyl group transfer from methyltetrahydrofolate to homocysteine in the absence of cobalamin.
- Experiments transforming O. tauri to disrupt or replace METH could help determine if it is able to function as both a
The document discusses research on using phospholipase A2 (PLA2) antibodies to protect cells from radiation damage. PLA2 is an enzyme that releases fatty acids from phospholipids in cell membranes. Exposure to ionizing radiation activates PLA2, leading to cell death. The research proposal is to test whether antibodies that block PLA2 can inhibit this activation and thereby reduce the toxic effects of radiation exposure and increase radiation survival. Blocking PLA2 with antibodies may provide a new radiation protection strategy and tool for diagnosing and monitoring acute radiation sickness.
Voss et al. - 2006 - Identification and characterization of riproximin,Cristina Voss
1. Researchers purified and characterized a new type II ribosome-inactivating protein called riproximin from the plant Ximenia americana.
2. Riproximin was found to potently inhibit protein synthesis and cancer cell growth in vitro with picomolar IC50 values, and inhibit tumor growth in vivo after intraperitoneal or oral administration in a rat model.
3. The researchers identified the riproximin protein through mass spectrometry and cDNA sequencing. Molecular modeling showed riproximin has structural similarity to other toxic type II ribosome-inactivating proteins and an active site for its RNA N-glycosidase activity.
Nitrate Reductase Complex of Escherichia coli K-12: Participation of Specific...IPN
1) The study examined the components involved in nitrate reduction by Escherichia coli, including formate dehydrogenase and cytochrome b1.
2) Certain E. coli mutants unable to reduce nitrate had low or undetectable levels of formate dehydrogenase activity, suggesting distinct formate dehydrogenases are involved in nitrate reduction and hydrogen formation.
3) Five mutants formed gas when grown without nitrate and had benzyl viologen-linked formate dehydrogenase, while four mutants formed little gas and lacked multiple formate dehydrogenase activities, further supporting distinct formate dehydrogenases.
Principles of RNA compaction : insights from equilibrium folding pathway of p...Keiji Takamoto
Counterions are required for RNA folding, and divalent metal ions such as Mg2+ are often critical. To dissect the role of counterions, we have compared global and local folding of wild-type and mutant variants of P4- P6 RNA derived from the Tetrahymena group I ribozyme in monovalent and in divalent metal ions. A remarkably simple picture of the folding thermodynamics emerges. The equilibrium folding pathway in mono- valent ions displays two phases. In the first phase, RNA molecules that are initially in an extended conformation enforced by charge–charge repulsion are relaxed by electrostatic screening to a state with increased flexibility but without formation of long-range tertiary contacts. At higher concentrations of monovalent ions, a state that is nearly identical to the native folded state in the presence of Mg2C is formed, with tertiary contacts that involve base and backbone interactions but without the subset of interactions that involve specific divalent metal ion-binding sites. The folding model derived from these and previous results provides a robust framework for understanding the equilibrium and kinetic folding of RNA.
This document summarizes an experiment on isolating and characterizing the enzyme alkaline phosphatase (AP) from E. coli bacteria. Key steps included purifying AP using dialysis, salting-in/salting-out, and DEAE cellulose chromatography. SDS-PAGE was used to analyze purity and molecular weight. Kinetic experiments at varying pH levels used the substrate PNPP and spectrophotometry to generate Michaelis-Menten and Lineweaver-Burk plots, allowing determination of kinetic parameters like Vmax and Km. The goal was to understand AP enzymatic activity and affinity for substrate under different conditions.
1) The document discusses using NMR spectroscopy to analyze the metabolic profiles of clam mantle tissue and cultured lung epithelial cells. Spectra of extracts from different regions of clam mantle and control vs. cigarette smoke-exposed cells were obtained.
2) Glyceraldehyde and glucose levels were able to be quantified and showed differences between tissue and cell types. Glyceraldehyde levels suggested cigarette smoke exposure induced distress in lung cells.
3) Further identification of metabolites was needed using additional database comparisons to fully characterize the metabolic profiles obtained via NMR spectroscopy. Improvements were also needed in cell and tissue collection methods to better preserve metabolite levels.
Dual-enzyme natural motors incorporating decontamination and propulsion capab...Michael Galarnyk
This document describes dual-enzyme natural motors that incorporate both decontamination and propulsion capabilities. The motors consist of unmodified radish tissue and rely on the catalase and peroxidase enzymes in the tissue for propulsion and bioremediation, respectively. Hydrogen peroxide fuels the propulsion and also acts as a co-substrate for the peroxidase-mediated transformation of phenolic pollutants. The continuous movement of the biocatalytic tissue motors through contaminated water facilitates dynamic pollutant removal. Localized fluid mixing from motor movement and bubble generation improves remediation efficiency, allowing for maximal pollutant removal within 3 minutes.
This document summarizes a research study that used an anoxic-aerobic sequencing batch reactor (SBR) system to treat high-strength wastewater containing 1000 mg/L of nitrate and 4000 mg/L of chemical oxygen demand (COD). The SBR was able to simultaneously remove 98% of nitrate, 86% of phosphate, and 72% of COD after 180 days of operation. Pyrosequencing analysis of the microbial communities revealed that Proteobacteria, Alphaproteobacteria, Rhodobacterales, Rhodobacteraceae, and Paracoccous were the dominant taxa present. The surplus electron donors and acceptors in the anoxic phase helped enrich denitrifying phosphate accumulating organisms, while
1) Abscisic acid (ABA) induces stomatal closure in pea plants by raising both the cytosolic pH and nitric oxide (NO) levels in guard cells.
2) The rise in cytosolic pH occurs earlier than the increase in NO, suggesting that pH increases are upstream of NO production during ABA-induced stomatal closure.
3) Modulators that raise cytosolic pH like methylamine enhance stomatal closure and NO production by ABA, while agents that lower pH like butyrate prevent the effects of ABA.
1) The document examines the effects of mutations on the cAMP signaling pathway in Dictyostelium discoideum. When food is scarce, D. discoideum cells secrete cAMP to signal each other to aggregate.
2) It compares a wild type strain (AX3) to a mutant strain (RI-9) that is defective in cAMP receptor gene cARA. PCR and gel electrophoresis showed that RI-9 lacks expression of cARA, preventing it from sensing cAMP and aggregating.
3) The study also tested how different pH levels and chemicals affect AX3 development. AX3 grew best at pH 4.4 and showed higher aggregation and fruit
Bacteria Induced Cryptic Meroterpenoid Pathway in Pathogenic Aspergillus fumi...Debanjan Chatterjee
The document summarizes a presentation on inducing a cryptic meroterpenoid pathway in the pathogenic fungus Aspergillus fumigatus through co-cultivation with the actinomycete Streptomyces rapamycinicus. Co-cultivation led to the activation of a previously silent polyketide synthase gene cluster and the production of novel prenylated polyketides, including Fumicyclines A. Deletion of the polyketide synthase gene confirmed its involvement in biosynthesis. While co-cultivation induced pathway expression, inhibition of histone acetyltransferase did not, suggesting the bacterium alters fungal epigenetic regulation. Understanding secondary metabolism in A. f
DMSO treatment of mice bearing Dalton's lymphoma resulted in 3 key effects:
1) Increased expression of tumor necrosis factor (TNF) and p53 proteins in the lymphoma cells, activating the TNF-p53 mediated apoptotic pathway.
2) Decreased expression of anti-apoptotic Bcl-2 and increased expression of pro-apoptotic Bax in the lymphoma cells, reducing the protective Bcl-2/Bax ratio.
3) Activation of caspase 9 and cleavage of PARP-1 in the lymphoma cells, consistent with induction of apoptosis through the mitochondrial pathway.
This document describes a study that used transposon mutagenesis and targeted gene deletions to identify genes involved in perchlorate reduction in the bacterium Azospira suillum PS. Transposon mutagenesis identified 18 mutants that were completely unable to grow using perchlorate as an electron acceptor (perchlorate null mutants). Most of these mutants had transposon insertions in genes located within the previously identified perchlorate reduction genomic island. Targeted deletions of each gene within this island identified 8 genes that were essential for perchlorate reduction, including those encoding the key enzymes chlorite dismutase and perchlorate reductase as well as genes for a putative regulatory system. This
Transcriptional profiling of Halobacterium sp. NRC-1 showed changes in gene expression in response to changes in salinity and temperature. Growth under high salt stress resulted in modulation of genes for ion transporters like potassium and phosphate transporters. Growth at cold temperatures altered expression of genes for lipid metabolism, gas vesicles, and cold shock proteins. Heat shock induced several chaperone genes. The study provides insights into Halobacterium's responses to environmental stresses at the gene expression level.
1) The document examines the effects of antimycin A and monofluoroacetate treatments on reactive oxygen species (ROS) production and citrate levels in Arabidopsis thaliana leaves.
2) The treatments were found to increase ROS production, as measured by dichloroflourscein diacetate and 3,3-diaminobenzidine. Citrate levels decreased over time with the treatments.
3) Antimycin A treatment led to the highest increase in ROS production and greatest decrease in citrate levels, while monofluoroacetate treatment resulted in lower ROS production and higher citrate levels compared to the control.
This document presents a structure/function model for the enzyme 1-pyrroline-5’ carboxylate reductase (P5CR) based on similarities to the β-hydroxyacid dehydrogenase enzyme family. The model is supported by evidence that recombinant E. coli P5CR has similar secondary structure to a β-hydroxyacid dehydrogenase and contains conserved functional domains. Site-directed mutagenesis of conserved residues in the proposed substrate-binding domain reduced catalytic efficiency. Chemical modification studies also provided insights into active site residues. The model proposes γ-glutamate semialdehyde as a potential true substrate based on inhibition studies.
This document summarizes a study that identified a novel reactive chlorine species (RCS) defense mechanism in the bacterium Azospira suillum. The study found:
1) A sigma factor (SigF) and its anti-sigma factor (NrsF) regulate expression of genes involved in RCS defense, including a methionine-rich periplasmic protein (MrpX) and a methionine sulfoxide reductase (YedY1).
2) MrpX is strongly induced by RCS like hypochlorite and acts to scavenge it through methionine oxidation, while YedY1 regenerates reduced MrpX.
1) Rv3717 is a novel N-acetylmuramoyl-L-alanine amidase enzyme from Mycobacterium tuberculosis that was determined to have a single-domain structure at 1.7 Angstrom resolution.
2) Unlike other bacterial autolysins, Rv3717 lacks a separate cell-wall binding domain and instead uses its net positive charge for substrate binding.
3) The crystal structure revealed a flexible hairpin turn that partially occludes the active site, which may be involved in autoregulation of enzymatic activity similar to other bacterial amidases.
Structural Modeling of the Ptf1a C2 Sequence Bound to Mammalian Rbpj and RbjlWard Coats
In this study, the researchers:
1) Generated structural models of the C2 sequence of Ptf1a bound to the β-trefoil domains of mammalian Rbpj and Rbpjl.
2) Found that the C2 sequence binds in an extended conformation, maintaining interactions seen in the Notch-IC/Rbpj complex.
3) Observed conserved residues in the hydrophobic pocket that maintain binding of proteins with a conserved tryptophan motif.
This document reports on a study of the oxygenation properties of hemoglobin from the earthworm Lumbricus terrestris under varying conditions of pH, salts, and temperature. Key findings include:
1) Hemoglobin from L. terrestris exhibits relatively small cooperativity (free energy of 1.6-2.8 kcal/mol) and a large, pH-dependent Hill coefficient that reaches a maximum of 7.9.
2) Cations, not anions, control oxygen binding, with divalent cations having a larger effect than monovalent cations. Effectiveness decreases in the order Ca2+ > Sr2+ > Ba2+ and Mg2+ > Na+.
1. A bacterium named GFAJ-1 was isolated from sediment in Mono Lake, California that can use arsenic instead of phosphorus for growth.
2. Experiments showed that GFAJ-1 was able to uptake arsenate from the growth medium and incorporate it into biomolecules like DNA, proteins, and metabolites.
3. X-ray spectroscopy analysis provided evidence that arsenate was incorporated into the bacterium's biomolecules in a similar configuration to phosphate. This finding suggests life may be possible in environments lacking phosphorus but containing arsenic.
- Ostreococcus tauri is a species of marine microalgae that is able to grow in minimal media lacking cobalt and cobalamin, even though it lacks the gene for the cobalamin-independent methionine synthase METE. This suggests it can synthesize methionine without cobalamin.
- The author proposes that the sole methionine synthase in O. tauri, METH, may be able to function similar to METE by facilitating direct methyl group transfer from methyltetrahydrofolate to homocysteine in the absence of cobalamin.
- Experiments transforming O. tauri to disrupt or replace METH could help determine if it is able to function as both a
The document discusses research on using phospholipase A2 (PLA2) antibodies to protect cells from radiation damage. PLA2 is an enzyme that releases fatty acids from phospholipids in cell membranes. Exposure to ionizing radiation activates PLA2, leading to cell death. The research proposal is to test whether antibodies that block PLA2 can inhibit this activation and thereby reduce the toxic effects of radiation exposure and increase radiation survival. Blocking PLA2 with antibodies may provide a new radiation protection strategy and tool for diagnosing and monitoring acute radiation sickness.
Voss et al. - 2006 - Identification and characterization of riproximin,Cristina Voss
1. Researchers purified and characterized a new type II ribosome-inactivating protein called riproximin from the plant Ximenia americana.
2. Riproximin was found to potently inhibit protein synthesis and cancer cell growth in vitro with picomolar IC50 values, and inhibit tumor growth in vivo after intraperitoneal or oral administration in a rat model.
3. The researchers identified the riproximin protein through mass spectrometry and cDNA sequencing. Molecular modeling showed riproximin has structural similarity to other toxic type II ribosome-inactivating proteins and an active site for its RNA N-glycosidase activity.
Nitrate Reductase Complex of Escherichia coli K-12: Participation of Specific...IPN
1) The study examined the components involved in nitrate reduction by Escherichia coli, including formate dehydrogenase and cytochrome b1.
2) Certain E. coli mutants unable to reduce nitrate had low or undetectable levels of formate dehydrogenase activity, suggesting distinct formate dehydrogenases are involved in nitrate reduction and hydrogen formation.
3) Five mutants formed gas when grown without nitrate and had benzyl viologen-linked formate dehydrogenase, while four mutants formed little gas and lacked multiple formate dehydrogenase activities, further supporting distinct formate dehydrogenases.
Principles of RNA compaction : insights from equilibrium folding pathway of p...Keiji Takamoto
Counterions are required for RNA folding, and divalent metal ions such as Mg2+ are often critical. To dissect the role of counterions, we have compared global and local folding of wild-type and mutant variants of P4- P6 RNA derived from the Tetrahymena group I ribozyme in monovalent and in divalent metal ions. A remarkably simple picture of the folding thermodynamics emerges. The equilibrium folding pathway in mono- valent ions displays two phases. In the first phase, RNA molecules that are initially in an extended conformation enforced by charge–charge repulsion are relaxed by electrostatic screening to a state with increased flexibility but without formation of long-range tertiary contacts. At higher concentrations of monovalent ions, a state that is nearly identical to the native folded state in the presence of Mg2C is formed, with tertiary contacts that involve base and backbone interactions but without the subset of interactions that involve specific divalent metal ion-binding sites. The folding model derived from these and previous results provides a robust framework for understanding the equilibrium and kinetic folding of RNA.
This document summarizes an experiment on isolating and characterizing the enzyme alkaline phosphatase (AP) from E. coli bacteria. Key steps included purifying AP using dialysis, salting-in/salting-out, and DEAE cellulose chromatography. SDS-PAGE was used to analyze purity and molecular weight. Kinetic experiments at varying pH levels used the substrate PNPP and spectrophotometry to generate Michaelis-Menten and Lineweaver-Burk plots, allowing determination of kinetic parameters like Vmax and Km. The goal was to understand AP enzymatic activity and affinity for substrate under different conditions.
1) The document discusses using NMR spectroscopy to analyze the metabolic profiles of clam mantle tissue and cultured lung epithelial cells. Spectra of extracts from different regions of clam mantle and control vs. cigarette smoke-exposed cells were obtained.
2) Glyceraldehyde and glucose levels were able to be quantified and showed differences between tissue and cell types. Glyceraldehyde levels suggested cigarette smoke exposure induced distress in lung cells.
3) Further identification of metabolites was needed using additional database comparisons to fully characterize the metabolic profiles obtained via NMR spectroscopy. Improvements were also needed in cell and tissue collection methods to better preserve metabolite levels.
Dual-enzyme natural motors incorporating decontamination and propulsion capab...Michael Galarnyk
This document describes dual-enzyme natural motors that incorporate both decontamination and propulsion capabilities. The motors consist of unmodified radish tissue and rely on the catalase and peroxidase enzymes in the tissue for propulsion and bioremediation, respectively. Hydrogen peroxide fuels the propulsion and also acts as a co-substrate for the peroxidase-mediated transformation of phenolic pollutants. The continuous movement of the biocatalytic tissue motors through contaminated water facilitates dynamic pollutant removal. Localized fluid mixing from motor movement and bubble generation improves remediation efficiency, allowing for maximal pollutant removal within 3 minutes.
This document summarizes a research study that used an anoxic-aerobic sequencing batch reactor (SBR) system to treat high-strength wastewater containing 1000 mg/L of nitrate and 4000 mg/L of chemical oxygen demand (COD). The SBR was able to simultaneously remove 98% of nitrate, 86% of phosphate, and 72% of COD after 180 days of operation. Pyrosequencing analysis of the microbial communities revealed that Proteobacteria, Alphaproteobacteria, Rhodobacterales, Rhodobacteraceae, and Paracoccous were the dominant taxa present. The surplus electron donors and acceptors in the anoxic phase helped enrich denitrifying phosphate accumulating organisms, while
1) Abscisic acid (ABA) induces stomatal closure in pea plants by raising both the cytosolic pH and nitric oxide (NO) levels in guard cells.
2) The rise in cytosolic pH occurs earlier than the increase in NO, suggesting that pH increases are upstream of NO production during ABA-induced stomatal closure.
3) Modulators that raise cytosolic pH like methylamine enhance stomatal closure and NO production by ABA, while agents that lower pH like butyrate prevent the effects of ABA.
1) The document examines the effects of mutations on the cAMP signaling pathway in Dictyostelium discoideum. When food is scarce, D. discoideum cells secrete cAMP to signal each other to aggregate.
2) It compares a wild type strain (AX3) to a mutant strain (RI-9) that is defective in cAMP receptor gene cARA. PCR and gel electrophoresis showed that RI-9 lacks expression of cARA, preventing it from sensing cAMP and aggregating.
3) The study also tested how different pH levels and chemicals affect AX3 development. AX3 grew best at pH 4.4 and showed higher aggregation and fruit
Bacteria Induced Cryptic Meroterpenoid Pathway in Pathogenic Aspergillus fumi...Debanjan Chatterjee
The document summarizes a presentation on inducing a cryptic meroterpenoid pathway in the pathogenic fungus Aspergillus fumigatus through co-cultivation with the actinomycete Streptomyces rapamycinicus. Co-cultivation led to the activation of a previously silent polyketide synthase gene cluster and the production of novel prenylated polyketides, including Fumicyclines A. Deletion of the polyketide synthase gene confirmed its involvement in biosynthesis. While co-cultivation induced pathway expression, inhibition of histone acetyltransferase did not, suggesting the bacterium alters fungal epigenetic regulation. Understanding secondary metabolism in A. f
DMSO treatment of mice bearing Dalton's lymphoma resulted in 3 key effects:
1) Increased expression of tumor necrosis factor (TNF) and p53 proteins in the lymphoma cells, activating the TNF-p53 mediated apoptotic pathway.
2) Decreased expression of anti-apoptotic Bcl-2 and increased expression of pro-apoptotic Bax in the lymphoma cells, reducing the protective Bcl-2/Bax ratio.
3) Activation of caspase 9 and cleavage of PARP-1 in the lymphoma cells, consistent with induction of apoptosis through the mitochondrial pathway.
This document describes a study that used transposon mutagenesis and targeted gene deletions to identify genes involved in perchlorate reduction in the bacterium Azospira suillum PS. Transposon mutagenesis identified 18 mutants that were completely unable to grow using perchlorate as an electron acceptor (perchlorate null mutants). Most of these mutants had transposon insertions in genes located within the previously identified perchlorate reduction genomic island. Targeted deletions of each gene within this island identified 8 genes that were essential for perchlorate reduction, including those encoding the key enzymes chlorite dismutase and perchlorate reductase as well as genes for a putative regulatory system. This
Transcriptional profiling of Halobacterium sp. NRC-1 showed changes in gene expression in response to changes in salinity and temperature. Growth under high salt stress resulted in modulation of genes for ion transporters like potassium and phosphate transporters. Growth at cold temperatures altered expression of genes for lipid metabolism, gas vesicles, and cold shock proteins. Heat shock induced several chaperone genes. The study provides insights into Halobacterium's responses to environmental stresses at the gene expression level.
This document summarizes research characterizing a chlorite dismutase (Cld) enzyme from Klebsiella pneumoniae. The enzyme, KpCld, is part of a subfamily of dimeric Clds found in non-perchlorate respiring bacteria. While it shares structural similarities in its active site with efficient O2-producing Clds, it exhibits limited turnover due to degradation of its heme cofactor. Experiments show KpCld can generate O2 from chlorite, and a K. pneumoniae mutant lacking Cld has reduced growth in the presence of chlorate under nitrate-respiring conditions, suggesting KpCld functions to detoxify endogenously produced chlorite. The
This document describes a study that characterized the major and minor groove environments of DNA using fluorescent probes. Specifically:
- Fluorescent oligonucleotides were created by incorporating a dansyl fluorophore into the major groove at specific sites.
- The fluorescence properties of these probes were used to estimate that the dielectric constant of the major groove is around 55D, compared to 20D for the minor groove.
- Binding of the minor groove ligand netropsin could be quantitatively monitored by changes in fluorescence of the dansyl group in the major groove, suggesting an information network between the two grooves.
This document summarizes an investigation into using lysine-functionalized dendrimers as potential detoxification agents for the organophosphate pesticide dichlorvos. Zeroth-, first-, and second-generation polyester dendrimers were synthesized with exactly 4, 8, and 16 lysine groups respectively on their periphery. The dendrimers were found to be water-soluble and showed low toxicity to cell lines. They were also able to efficiently capture dichlorvos, demonstrating their potential as antidotes to maintain acetylcholinesterase activity in cases of organophosphate poisoning.
This document summarizes a laboratory experiment that investigated the effects of hydraulic retention time (HRT) on root oxygen release and pollutant removal in subsurface flow constructed wetlands. The experiment found that average root oxygen release was higher at a 7 day HRT (36.9 μmol/gDW/hr) than a 3.5 day HRT (19.5 μmol/gDW/hr). Average removal efficiencies of biochemical oxygen demand, ammonium, and total nitrogen were not significantly different between the two HRTs. However, the average nitrate removal efficiency was higher at a 3.5 day HRT (86%) than a 7 day HRT (60.5%), indicating that shorter HRTs
Probing the chemistries of flavin ring systems of p hydroxybenzoate hydroxyla...John Clarkson
J. Clarkson, B. Pulfey & P.R. Carey, “Probing the Chemistries of Flavin Ring Systems of p-Hydroxybenzoate Hydroxylase by Raman Difference Spectroscopy”, Biochemistry, 36, 12560-12566, 1997.
P68 RNA helicase unwinds the human let-7 microRNA precursor duplex and is req...David W. Salzman
P68 RNA helicase was identified as being required for unwinding the human let-7 microRNA precursor duplex. Recombinant P68 RNA helicase was shown to unwind the let-7 duplex in vitro. Knockdown of P68 inhibited let-7 microRNA function, indicating P68 is essential for loading let-7 into the silencing complex. This study identifies P68 RNA helicase as playing a key role in the human let-7 microRNA pathway.
The document discusses lipid peroxidation in seeds and its effects. It defines lipid peroxidation as the oxidative degradation of lipids caused by reactive oxygen species that damage cell membranes. Lipid peroxidation occurs through initiation, propagation, and termination steps and produces reactive aldehydes. It is a major cause of seed deterioration that damages membranes and DNA. Levels of lipid peroxidation enzymes like lipoxygenases correlate with seed storability, with "good storers" having lower lipoxygenase activity. The document also describes methods to measure lipid peroxidation products.
This document summarizes a study that investigated the physiological, biochemical, and genotoxic effects of wastewater on maize seedlings. The study exposed maize seeds and seedlings to different concentrations (0, 10, 50, and 100%) of wastewater collected from three sources: municipal wastewater, woolen mill wastewater, and polyvinylchloride wastewater. It found that the wastewater negatively impacted germination rates, biomass, seedling length, and photosynthetic pigments in a concentration-dependent manner. It also observed increases in oxidative stress markers and antioxidant enzyme activity in response to the wastewater. Various sources of wastewater were found to cause genotoxic effects
This document discusses reactive oxygen species (ROS) and their role in periodontal tissue damage. It begins with an introduction to periodontal diseases and defines ROS and free radicals. It describes the various ROS like superoxide, hydrogen peroxide, hydroxyl radicals, and lists sources of free radicals. Oxidative stress is defined. Mechanisms of tissue injury caused by ROS affecting proteins, lipids, DNA are outlined. Methods to measure ROS and oxidative damage in biological samples are presented. The role of ROS in periodontal tissue damage is discussed based on Halliwell's postulates. Several studies measuring local ROS in periodontitis are summarized. The antioxidant defense system and various antioxidants like vitamin C, vitamin E, carotenoids,
This document describes the design, synthesis, and evaluation of a series of 1,3-disubstituted pyrrolo[2,3-b]quinoxalines as potential inhibitors of phosphodiesterase 4 (PDE4) and cancer cell growth. A ligand- and phase transfer catalyst-free intramolecular Heck reaction was used to synthesize the target compounds. Some compounds showed significant inhibition of PDE4B and growth inhibition of oral cancer cells in vitro. They also showed acceptable safety profiles in zebrafish embryos, but no apoptosis was observed. The goal was to develop PDE4 inhibitors that do not inhibit luciferase, which could produce false positives in assays.
The document discusses the analysis of key transformation products of the explosive RDX (hexahydro-1,3,5-trinitro-1,3,5-triazine) in groundwater samples from various US military sites. It finds that nitroso derivatives (MNX, DNX, TNX) and 4-nitro-2,4-diazabutanal (NDAB) are stable under typical environmental conditions, but methylenedinitramine (MEDINA) is highly unstable. Adding 10% sea salts was found to stabilize MEDINA when samples were stored at 4°C. Appropriate preservation allowed detection of nitroso derivatives and NDAB, but not MEDINA, at some
Cytochrome P450 enzymes play an important role in metabolizing and detoxifying drugs, toxins, and other foreign substances in fish and aquatic organisms. They are involved in phase I and phase II biotransformation reactions that make lipophilic compounds more hydrophilic so they can be eliminated. While this helps reduce toxicity, in some cases bioactivation can occur which increases reactivity and toxicity. Understanding the functions and regulation of these enzymes provides insights into using them as biomarkers for assessing aquatic pollution.
10 nazir ahmad malla and mudasir bashir 215 plant protein kinases in signal ...Dheeraj Vasu
ABSTRACT: A protein kinase is a enzyme that modifies other proteins by adding phosphate groups to them. This results in a functional change of the target protein by changing enzyme activity, cellular location, or association with other proteins. Cells can interact to environmental fluctuations by transduction of extracellular signals, to produce intracellular responses. Membrane-impermeable signal molecules are recognized by receptors, which are localized on the plasma membrane of the cell. Binding of a ligand can result in the stimulation of an intrinsic enzymatic activity of its receptor or the modulation of a transducing protein. This review discusses the various protein kinases and their role in plants.
- The study characterized the kinetic properties of wild-type human Δ1-pyrroline-5-carboxylate reductase 2 (HsPYCR2) and its R251C mutant found in patients.
- Kinetic analysis showed the R251C mutant had slightly lower catalytic efficiency (4-5 fold) for NADH and NADPH substrates compared to wild-type, suggesting the mutation impacts proline biosynthesis.
- Additional studies on protein structure may help understand how the R251C mutation contributes to neurological disease phenotypes seen in patients.
This document describes research on a flavin-dependent monooxygenase (HsaAB) from Mycobacterium tuberculosis that is involved in cholesterol catabolism. Key findings include:
1) HsaAB was purified from Mtb and shown to hydroxylate its substrate 3-hydroxy-9,10-seconandrost-1,3,5(10)-triene-9,17-dione (3-HSA) to a catechol product.
2) Crystal structures of HsaA revealed a folding pattern similar to other monooxygenases and a flexible flap that could control access to the active site.
3) Docking studies suggested this flap adopts a
This document summarizes the results of a quantitative phosphoproteomic analysis that revealed common regulatory mechanisms between effector-triggered immunity (ETI) and PAMP-triggered immunity (PTI) in plants. Key findings include:
1) 264 phosphorylation sites were differentially regulated by RPS2 activation during ETI. Some sites were also regulated during PTI by FLS2.
2) Phosphorylation of common residues on RBOHD was required for ROS production during both ETI and PTI.
3) Phosphorylation of AHA1/2 ATPases may inhibit stomatal opening and pathogen entry.
The study provides new phosphoproteomic data to better understand
This document describes a study that used solid-phase microextraction (SPME) combined with gas chromatography-mass spectrometry (GC-MS) to characterize metabolites produced during the biodesulfurization of two model organosulfur compounds, dibenzothiophene (DBT) and 4,6-diethyl-dibenzothiophene (DEDBT), by Rhodococcus sp. strain ECRD-1. The following metabolites were identified for DBT: DBT sulfoxide, DBT sulfone, dibenz[c,e][1,2]oxathiin 6-oxide (sultine), dibenz[c,e][1,2]oxathiin
This document summarizes a study that compared the genomes of two Shewanella bacteria (S. halifaxensis and S. sediminis) that are able to degrade the explosive RDX in cold marine conditions to other Shewanella genomes. The study found that the RDX-degrading bacteria had genomic adaptations for life in cold marine environments, including acquiring genes for sodium-dependent nutrient transporters to use sodium as an energy source. They also decreased their genome GC content and increased flexibility proteins to adapt to low temperatures. Compared to other Shewanella, they had more genes related to cytochromes and enzymes involved in RDX degradation pathways. One cytochrome in particular was found to degrade RDX through mono-denit
This study examined the sorption and desorption of 2,4,6-trinitrotoluene (TNT) and its metabolites 4-amino-2,6-dinitrotoluene (4-ADNT) and 2,4-diamino-6-nitrotoluene (2,4-DANT) in natural and model soil systems. The study found that the sorption of these nitroaromatic compounds increased with the number of amino groups in topsoil. It also observed significant hysteresis between sorption and desorption in topsoil. In nonsterile topsoil, it detected the formation of acetylated metabolites of 2,4-DANT over longer contact times.
This study examined biodegradation of petroleum hydrocarbons and microbial activity in contaminated sub-Arctic soils under seasonal freeze-thaw conditions. Pilot-scale experiments subjected soils to temperatures representative of post-summer freezing and pre-summer thawing periods. In nutrient-amended soils, semi-volatile hydrocarbons decreased 32% during freezing, compared to 14% in unamended soils. Microbial respiration and hydrocarbon-degrading bacteria were observed even at subzero temperatures when unfrozen water was present. Bacterial populations shifted with temperature changes, indicating adaptation to freeze-thaw cycles. The study suggests biodegradation potential exists under seasonal sub-Arctic temperature fluctuations.
This document describes the development of a sensitive in vitro bioassay to quantify the biological activity of phorbol esters in Jatropha oil. The researchers:
1) Confirmed that exposure to Jatropha oil triggered the same cellular response in MDCK cells as the model phorbol ester TPA.
2) Showed that Jatropha oil's phorbol esters activate protein kinase C, similarly to TPA.
3) Measured the expression of COX-2, an inflammation-related gene, in MDCK cells exposed to Jatropha oil and used this to quantify phorbol ester activity in terms of TPA toxic equivalents (TEQ).
This study used electron spin resonance and infrared spectroscopy to examine ivory fragments from Nimrud, Iraq to determine the extent of ancient pyrolysis and deterioration. Spectroscopic analysis of ancient ivory samples of different colors (black, blue-grey, cream) was able to ascertain thermal breakdown from non-thermal deterioration. Comparative studies on ancient ivory and modern ivory heated to high temperatures provided insights. Ash analyses of ancient ivories from different sites showed a complex relationship between color and composition that was influenced by burial conditions.
This document summarizes an ESR study of the photolysis of dicyclopentadienyltitanium dichloride. The study aimed to monitor the radicals formed under various conditions.
The main findings were:
1) Photolysis produced the cyclopentadienyl radical, providing direct evidence of its formation. It also formed a titanium(III) fragment.
2) In some solvents or with added reagents like pyridine, spectra indicated the presence of two distinct titanium(III) radicals with resolvable hyperfine structure.
3) Spin trapping with nitrosodurene was found to be unreliable, as the observed spectra could also be produced by photolysis of just the nitros
This document reports on research measuring the strength of silicon-hydrogen bonds in various silane compounds using photoacoustic calorimetry. The main findings are:
1) Silicon-hydrogen bond strengths are significantly weakened by the successive substitution of silyl groups, with the bond in tris(trimethylsilyl)silane having one of the weakest bond strengths measured at 79.0 kcal/mol.
2) Steric effects and radical stabilization may contribute to the weakening of the silicon-hydrogen bond from additional silyl substitutions, though the exact origin is unclear.
3) The weak silicon-hydrogen bond in tris(trimethylsilyl)silane
This document describes an interlaboratory study conducted by 11 laboratories to evaluate the precision and practicality of a nonaqueous capillary electrophoresis (NACE) method for determining the content of R-timolol impurity in S-timolol maleate samples. The study was designed according to ISO guidelines and involved qualitative and quantitative assessments of the method performances within and between laboratories. Statistical analysis of the results allowed estimation of variances within and between laboratories, days, and replicates to determine the method's repeatability and reproducibility. The estimated measurement uncertainty was found to be concentration-dependent above a certain threshold.
This document reports on an electron spin resonance study of the reactivity of alkylchlorotin radicals, RnC13-n* (n = 0-3), toward alkenes, alkyl bromides, and biacetyl. The radicals were generated by photolysis of cyclopentadienyltin compounds. Reactivity decreased as the number of chloro ligands increased, likely due to reduced interaction of the radical's highest occupied molecular orbital and the alkene or alkyl bromide's lowest unoccupied molecular orbital. All radicals reacted with biacetyl to form tin derivatives of butane-2,3-semidione, whose spectra and structures are analyzed.
1) Rhodococcus sp. strain Q15 was examined for its ability to degrade individual alkanes and diesel fuel at low temperatures of 0 and 5°C.
2) Q15 was able to mineralize short chain alkanes like dodecane and hexadecane to a greater extent than long chain alkanes like octacosane and dotriacontane at 0 and 5°C.
3) Q15 utilized a broad range of aliphatic hydrocarbons present in diesel fuel, including linear and branched alkanes, at 5°C.
The document summarizes research on the biodegradation kinetics of three nitrogen-substituted naphthalenes (1-aminonaphthalene, 2-aminonaphthalene, and 1-amino-2-methylnaphthalene) under aerobic conditions in flooded soil. The researchers found that mineralization of the compounds proceeded in two phases - an initial fast phase followed by a slower second phase. Sorption of the compounds onto the soil followed hyperbolic isotherms described by the Langmuir model. Initial mineralization rates obeyed Michaelis-Menten kinetics and were directly proportional to aqueous concentrations, reaching a maximum at 100 μg/g soil slurry. The second phase mineralization rates were
This document summarizes a study investigating the sorption and biodegradation of six nitrogen-substituted naphthalenes (I-VI) in flooded soil under different pH and redox conditions. The compounds showed curvilinear adsorption patterns. Adsorption of the ionizable amino-compounds (I-III) increased under acidic conditions, suggesting cation exchange is an important mechanism. Adsorption of the nonionizable nitro-compounds (IV, VI) did not vary with pH. Aerobic biodegradation occurred in two phases, with an initial fast phase followed by a slower phase. Methyl substitution increased adsorption but decreased biodegradation rates. All compounds showed recalcitrance under an
This document describes research on the degradation of RDX (hexahydro-1,3,5-trinitro-1,3,5-triazine), a common contaminant, using zerovalent iron nanoparticles (ZVINs) with and without stabilizing additives like carboxymethyl cellulose (CMC) or poly(acrylic acid) (PAA). RDX degradation rates with the different treatments followed the order CMC-ZVINs > PAA-ZVINs > ZVINs. Degradation involved initial denitration and reduction of RDX to nitroso intermediates like MNX and TNX before complete decomposition. When MNX and TNX were treated with
This document describes a new method for quantifying poly(3-hydroxybutyrate) (PHB) in microbial cells using headspace solid-phase microextraction (SPME) coupled with gas chromatography. The method involves either methanolyzing or hydrolyzing PHB in samples to form methyl 3-hydroxybutyrate (Me-3-HB) or crotonic acid, respectively. These products are then extracted using SPME and analyzed by gas chromatography. The new SPME-based methods provide accurate results, are easier to perform than existing methods, and avoid use of hazardous chlorinated solvents. The document compares the new methods to the commonly used methanolysis/chloroform method and finds excellent agreement between all
This document summarizes a study on the aerobic biodegradation of RDX (hexahydro-1,3,5-trinitro-1,3,5-triazine) by Rhodococcus sp. strain DN22. Key metabolites identified during degradation included nitrite (NO2-), nitrous oxide (N2O), ammonia, and formaldehyde. Isotope labeling experiments revealed that RDX carbon is converted to carbon dioxide and incorporated into a dead-end product with a molecular weight of 119. The proposed degradation pathway involves initial denitration of RDX followed by ring cleavage producing formaldehyde and the metabolite with a molecular weight of 119.
This study investigated the ability of two cyclodextrins (CDs), heptakis-2,6-di-O-methyl-β-cyclodextrin (DMβCD) and hydroxypropyl-β-cyclodextrin (HPβCD), to desorb and solubilize 2,4,6-trinitrotoluene (TNT) and its metabolites from contaminated soils. DMβCD was more effective than HPβCD at desorbing TNT, 4-amino-2,6-dinitrotoluene (4-ADNT), and 2,4-diamino-4-nitrotoluene (2,4-DANT
The document discusses the benefits of exercise for mental health. Regular physical activity can help reduce anxiety and depression and improve mood and cognitive functioning. Exercise causes chemical changes in the brain that may help protect against mental illness and improve symptoms.
This document summarizes an article that appeared in a journal published by Elsevier. The attached copy is provided to the author for non-commercial research and education purposes only. Other uses such as reproduction, distribution, selling or posting online are prohibited without permission. The document also provides a link for authors to view Elsevier's full archiving and manuscript policies.
This document summarizes a study on the hydrothermal dissolution of willow biomass in hot compressed water. The key findings are:
1) A 95% dissolution of willow was achieved at temperatures as low as 200°C and pressures of 10 MPa, with lignin and hemicellulose dissolving first, followed by cellulose between 280-320°C.
2) A proposed dissolution mechanism involves the rapid fragmentation and hydrolysis of lignin, hemicellulose, and cellulose into oligomers and other water-soluble products like glucose.
3) A continuous flow process was found to be more effective for dissolution than a batch process, due to reduced recondensation of dissolved oligomers.
2. RDX from liquid culture and resistance to the phytotoxic effects of
RDX; however, this activity relies on support from endogenous
plant reductases (9). Here, the expression of both xplA and xplB in
Arabidopsis enabled the rapid removal of RDX from liquid culture
and soil leachate, a rate significantly faster than for plants express-
ing xplA alone. These results demonstrate that this technology can
be applied to remediate RDX from contaminated sites.
Results and Discussion
Optimizing Expression and Assay Conditions. The purification of
XplA to homogeneity has been described (9). Soluble expression
and purification of XplB was achieved by using a pGEX vector
where GST is fused to the N terminus of XplB (Fig. 1A).
Cleavage of the GST resulted in the loss of the 72-kDa XplB
band from SDS/PAGE gels, the appearance of several smaller
bands, and Ͻ5% protein recovery, suggesting insolubility of any
cleaved protein (data not shown). The soluble, fused XplB was
able to transfer electrons to XplA for the degradation of RDX,
whereas GST alone had no such activity (Fig. 1B), therefore
fused GST-XplB was used in subsequent studies. Fig. 1C shows
that a 2-fold molar excess of XplB to XplA was the ratio at which
XplA became limiting (as measured by flavin levels). Con-
versely, a 10-fold molar excess of XplA to XplB was the ratio at
which XplB became limiting (Fig. 1D). At lower ratios, the
concentration of both enzymes influenced the rate of activity
toward RDX, as expected for a second-order reaction, suggest-
ing that collision of the two subunits is a major rate-limiting
contribution. The optimal pH for RDX degradation was pH
6.5–7.0 irrespective of the buffer used, and potassium phosphate
at pH 6.8 was used subsequently. Activity was not significantly
affected by ionic strength between 0 and 100 mM NaCl, but
above 100 mM, an inhibitory effect of sodium chloride was seen
(data not shown), thus NaCl was omitted from further assays.
Spectral Analysis of XplA and XplB. XplA had previously been
shown to contain a classic P450 heme and to be able to bind
carbon monoxide when reduced, producing a spectral shift to 450
nm, and a flavin binding domain (9), but the nature of the flavin
was not determined. Purified XplB also possessed a classic flavin
absorbance spectra, and release of the flavin from XplA and
XplB by boiling and subsequent analysis by HPLC showed XplA
to contain predominantly FMN and XplB FAD [supporting
information (SI) Fig. 8].
Reduction of XplA by sodium dithionite causes a character-
istic decrease in the heme 420-nm peak and a shift to a maximum
of 389 nm. The dominating heme spectrum masked any flavin
absorbance. Six nanomoles of XplA was fully reduced by be-
tween 8 and 10 nmol of sodium dithionite, suggesting the
majority of XplA has flavin bound (full reduction of heme and
flavin would take 9 nmol) (Fig. 2 A and B).
On reduction of XplB by NADPH, the flavin absorbance was
completely bleached. No changes were observed between 550 and
600 nm, consistent with a lack of the stabilized semiquinone form,
and implying a two-electron reduction (Fig. 2C). For XplB, the
concentration of NADPH required for full reduction was approx-
Fig. 1. Recombinant expression of XplB and assay of activity with XplA. (A) Protein purification on 10% SDS/PAGE. Lane 1, molecular weight markers; lane 2,
solubilized recombinant protein; lane 3, affinity-purified XplB. (B) Aerobic activity of GST-XplB (0.26 M; filled symbol) and GST (0.71 M; open symbol) with
XplA (0.27 M). (C) Anaerobic activity of 60 nM XplA with various ratios of XplB. (D) Anaerobic activity of 60 nM XplB with various ratios of XplA. Values are
the mean Ϯ SD of triplicates.
Fig. 2. Spectral analysis of the reduction of XplA and XplB. (A) UV-visible
spectra of 6 nmol of XplA (determined by protein concentration), titrated with
the indicated amount of sodium dithionite (nmol) under anaerobic condi-
tions. (B) Difference spectra of the sodium dithionite titration of XplA, gen-
erated by subtraction of the original XplA spectrum from those with sodium
dithionite. (C) Anaerobic titration of 37 nmol XplB (by protein) with the
indicated amount of NADPH (nmol).
Jackson et al. PNAS ͉ October 23, 2007 ͉ vol. 104 ͉ no. 43 ͉ 16823
APPLIEDBIOLOGICAL
SCIENCES
3. imately half the protein concentration, indicating that half of the
XplB has flavin bound. Addition of flavin during purification and
varying growth conditions did not improve this level. XplB was not
readily reduced by NADH nor was NADH a successful electron
donor for RDX degradation (data not shown).
RDX Binding and Activity of XplA and XplB. The binding of RDX to
XplA has been examined in two ways. Titration of XplA with RDX
in an anaerobic environment revealed the low spin to high spin
change in the heme often seen on substrate binding and a binding
affinity (Kd) of 57.9 Ϯ 2.8 M for RDX (Fig. 3 A and B). The Km
was calculated to be 83.7 Ϯ 17.8 M, and the maximum turnover
(kcat) of the enzyme was 4.44 Ϯ 0.46 per s using a saturating ratio
of XplB (2-fold molar excess) and anaerobic conditions (Fig. 3C).
The Km and Kd values are similar to each other, and a turnover of
4.44 per s is comparable with the Pseudomonal P450cam toward its
natural substrate camphor (27 per s) (13), perhaps surprising given
the xenobiotic nature of RDX. The number of electron transfer
steps involved in a P450 system often prevent the turnover from
being substantially faster (1).
RDX Breakdown Pathways. Initially, the breakdown products of
RDX degradation were analyzed anaerobically to determine the
amount of NADPH required without losses to uncoupled cleav-
age of oxygen. Formaldehyde and nitrite were measured directly,
whereas RDX and other products were assayed after freezing
the samples. It was surprising to find ratios of nitrite to RDX,
after 70 min, of 1.4:1.0 and formaldehyde to RDX of 1.96:1.00
as it was previously thought that the breakdown pathway would
follow that proposed by Fournier et al. (14) with 2:1 nitrite and
1:1 formaldehyde and production of 4-nitro-2,4, diazabutanal
(NDAB) (Fig. 4A). NDAB was not detected; however, the RDX
breakdown product methylenedinitramine (MEDINA) was,
reaching a ratio of 0.68:1 after 70 min and then decreasing,
possibly because of instability in water (15). The ratio of NADPH
to RDX degraded was 1.26:1.00 at 70 min, suggesting these
compounds are tightly coupled.
When the breakdown pathway under aerobic conditions was
examined, a different picture arose with an increase in the ratio
of nitrite to RDX to 2.49:1.00 after 130 min and a decrease in
the formaldehyde to RDX ratio to 1.4:1.0 (Fig. 4B). NDAB was
detected, and levels continued to increase throughout the time
course; MEDINA was not detected.
The mechanism for denitration of RDX by XplA is not yet
fully known; however, once denitration and hydration have
occurred, whether under aerobic or anaerobic conditions, the
resulting imine intermediate would be highly unstable in water
and spontaneously decompose (16). Under anaerobic condi-
tions, mono-denitration and mono-hydration of RDX followed
by ring cleavage would produce MEDINA (Fig. 5, route A).
Under aerobic conditions, it is proposed that RDX is subjected
to di-denitration–di-hydration before ring cleavage. This mech-
anism, leading to the formation of NDAB (see Fig. 5, route B),
has been described (14). Degradation of RDX with radiolabeled
Fig. 4. Mass balance of RDX breakdown. (A) Anaerobic degradation of RDX
(60 nM XplA and XplB) and analyses were carried out as in Materials and
Methods. Controls with boiled XplA and XplB (not shown) contained the
following levels of analytes (nmol/ml) over the time course: RDX, 100 Ϯ 4.3;
nitrite, 0 Ϯ 3.9; formaldehyde, 0 Ϯ 6.3; and MEDINA, 0–6.3. (B) Aerobic
degradation of RDX. Reactions contained 90 nM XplA and XplB. Controls with
boiled XplA and XplB (not shown) contained RDX (100 Ϯ 2.5), nitrite (0 Ϯ 2),
formaldehyde (0 Ϯ 16), and NDAB (0–2.6) over the time course. Values are the
mean Ϯ SD of triplicates.
Fig. 3. XplA and RDX binding. All analyses were carried out anaerobically.
(A) UV-visible spectral changes in 4.5 nmol XplA on the addition of 0–150 nmol
of RDX (in DMSO). (Inset) Difference spectra generated by subtraction of
nonbound XplA spectrum from the spectra of XplA with RDX. (B) Plot of A391 Ϫ
A425 generated from the difference spectra against RDX concentration. (C)
Initial rates of substrate use at a range of RDX concentrations plotted against
RDX concentration with 60 nM XplA and 120 nM XplB. Values are the mean Ϯ
SD of triplicates.
16824 ͉ www.pnas.org͞cgi͞doi͞10.1073͞pnas.0705110104 Jackson et al.
4. oxygen and another P450 system suggests that direct hydroxy-
lation of the RDX molecule by XplA is unlikely (17). The role
oxygen plays in the mechanism of RDX degradation by XplA,
either within the enzyme or within the reaction environment, is
therefore currently unclear. The pathway presented in Fig. 5 is
based on the analysis of the final degradation products and the
proposed intermediates by analogy from previously published
work (14, 17). Additional work involving labeled RDX and
deuterated solvent may allow precise details of the mechanism
to be determined.
Other examples of P450s catalyzing different reactions depend-
ing on the presence of oxygen are known. For example, under
anaerobic conditions human CYP2A6 and CYP101 both catalyze
reductive reactions toward halogenated substrates, whereas under
aerobic conditions, CYP2A6 catalyzes dehalogenation, (18) and
CYP101 catalyzes a hydroxylation reaction (19).
XplA Activity with a Wider Range of Substrates and Inhibitors. RDX
as a synthetic compound may not be the native substrate for
XplA, so the activity toward a range of other substrates was
tested. The related nitramine explosive, octahydro-1,3,5,7-
tetranitro-1,3,5,7-tetrazocine (HMX), was not transformed at
the aqueous solubility limit for HMX of 15 M, even after
several hours of incubation. Trace levels of XplA activity toward
the nitroaromatic explosive trinitrotoluene (TNT) were found
(turnover was Ͻ1% per h at 100 M), but transformation
products could not be identified. The heme spectrum of XplA
was not altered by the presence of TNT. To test the ability of
XplA to perform classic P450 hydroxylation and demethylation
reactions, established P450 substrates were tested. No hydroxy-
lating activity was detected toward testosterone or paclitaxel, nor
demethylating activity toward 7-ethoxycoumarin or
ethoxyresorufin. However, oxidizing activity was detected to-
ward both methyl tolyl and methyl phenyl sulfides generating
sulfoxide products (data not shown).
Methyl tolyl sulfide was also shown to inhibit RDX catabolism,
as was the P450-specific inhibitor metyrapone. The strongest
inhibition was seen by TNT (Fig. 6), whereas the rate of carbon
monoxide inhibition was less than expected, given the usual high
affinity of P450s for carbon monoxide. This inhibition was not
increased by a higher concentration of carbon monoxide. XplA
may have a lower affinity for CO in the presence of RDX, as seen
with other substrates of P450s (20).
Application of the Enzymes for Phytodegradation of RDX. It has
previously been shown that transgenic plants expressing xplA can
degrade RDX (9), but this activity relies on the availability of
endogenous plant reductases, which may be limiting. Thus, xplB
was transformed into Arabidopsis, and transgenic plant lines
expressing both xplA and xplB were generated. A previously
characterized plant line expressing xplA (XplA-10) (9) was used
to produce five independently transformed lines expressing xplB.
In addition, five independently transformed lines expressing only
xplB were characterized. The results presented here are from
plants homozygous for these transgenes. Quantitative analysis by
real-time PCR showed that xplA was expressed in all five XplAB
lines (Fig. 7A), although expression levels varied from that of the
original parental line, XplA-10. A range in the level of xplB
transcript was seen; with line XplAB-27 exhibiting the highest
levels of both xplA and xplB transcripts (Fig. 7A). These lines
were grown in axenic liquid culture to determine rates of RDX
uptake. As reported (9), line XplA-10 removed all 180 M RDX
from the medium within 5 days; however, the XplAB lines
removed the RDX significantly faster, with lines XplAB-2 and
XplAB-27 removing Ͼ50% of the RDX within 4 h, 30 times
faster than the XplA-10 line (Fig. 7B). The xplB-only lines had
uptake rates similar to those of untransformed, wild-type plants
(Fig. 7C). NDAB and MEDINA levels were not measured in the
liquid culture or soil-grown plants. Liquid culture-grown plants
and water-saturated soil-grown roots are likely to be hypoxic. It
is possible from our characterization that, depending on oxygen
availability, either NDAB or MEDINA is produced by xplA–
expressing plants.
To investigate the ability of the XplAB lines to reduce levels
of RDX in contaminated ground water, 8-week-old plants were
watered with 180 M RDX. After 1 week, the soil was flushed
with water and the level of RDX in the soil leachate was
measured. After this time, the level of RDX in the leachate from
untransformed, wild-type plants was unaltered, whereas leachate
from the XplA-10 line had decreased by 25%. The RDX in the
leachate from lines XplAB-2 and XplAB27 had decreased by
90–97% (Fig. 7D).
Conclusions
XplA and XplB constitute a novel P450 redox system and
together efficiently degrade the xenobiotic RDX. Degradation
follows two different routes dependent on the presence of
Fig. 5. Proposed degradation pathway of RDX under aerobic and anaerobic
conditions. Ring cleavage occurs at ab under anaerobic conditions (route A)
and at cb under aerobic conditions (route B). Compounds in brackets are
hypothetical, and the mechanisms are based on detection of nitrite and
formaldehyde, the final products, and analogy with previous work (14, 17).
Fig. 6. Activity of XplA and XplB with inhibitors. Standard anaerobic activity
assays using 100 M RDX as substrate were carried out in the presence of 100
M metyrapone or 100 M TNT, and activity was compared with that with only
RDX (100%). Carbon monoxide (CO) and methyl tolyl sulfide (MTS) inhibition
was tested in standard aerobic conditions using 100 M RDX as substrate.
Values are the mean Ϯ SD of triplicates.
Jackson et al. PNAS ͉ October 23, 2007 ͉ vol. 104 ͉ no. 43 ͉ 16825
APPLIEDBIOLOGICAL
SCIENCES
5. oxygen. One mole of MEDINA and nitrite are the dominant
products anaerobically, whileas 1 mol of NDAB and 2 mol of
nitrite are produced in aerobic conditions. With both pathways
resulting in ring cleavage and nitrite release, applications of
these enzymes for bioremediation look encouraging. One of the
biggest concerns of RDX as a pollutant is that it migrates readily
through soil into the groundwater and subsequently contami-
nates drinking water supplies. Here, we show that Arabidopsis
plants expressing xplA and xplB have the ability to effectively
remove RDX from the soil leachate. The studies here illustrate
that these genes, or possibly an xplA–xplB gene fusion, could be
engineered into plant species suited to growth on military
training ranges and used to remediate RDX.
Materials and Methods
RDX was supplied by the Defense Science and Technology
Laboratory at the U.K. Ministry of Defense (Fort Halstead,
Kent, U.K.). MEDINA and NDAB were provided by Ron
Spanggord (SRI International, Menlo Park, CA).
XplA and XplB Expression and Purification. The xplA gene was cloned
and expressed as described (9). The xplB gene was amplified from
pHSX1 by PCR using primers containing overhanging BamH1
sites, 5Ј-GGATCCGACATCATGAGTGAAGTGGAC and 3Ј-
GGATCCGCAGACCGATTCGGCCGG and ligated into
pGEX2T (Merck Chemicals, Nottingham, U.K.), which engineers
an N-terminal GST domain. The construct was sequenced, trans-
formed into Escherichia coli BL21 (DE3) and grown at 20°C in
Luria broth containing 100 g/ml carbenicillin to OD600 (1.0), 1
mM isopropyl -d-thiogalactopyranoside was added, and the cul-
ture was grown for an additional 24 h. The cell pellet was resus-
pended in 10 ml of PBS (140 mM NaCl/15 mM KH2PO4/80 mM
Na2HPO4) containing 0.2 mM PMSF and lysed at 1,500 psi (1 psi ϭ
6.89 kPa) in a French Press (Thermo IEC). The lysate was
centrifuged (10,000 ϫ g for 15 min), and the soluble protein was
purified by using 200 l of 50% glutathione-coupled Sepharose gel
(Amersham, Piscataway, NJ) according to the manufacturer’s
instructions and recovered in glutathione elution buffer (20 mM
reduced glutathione/100 mM Tris⅐HCl, pH 8.5/120 mM NaCl).
Protein assays were carried out with Coomassie Protein Assay
Reagent (Pierce, Rockford, IL) using BSA as reference. Proteins
were analyzed as described (21).
Flavin Content Determination. The flavin content of XplA and XplB
was determined after boiling for 20 min then centrifugation of the
precipitated protein and trichloroacetic acid precipitation (10% of
240 mg/ml), followed by centrifugation and sodium bicarbonate
neutralization. Both methods gave similar results for each protein.
The concentration of released flavin was used to measure XplA and
XplB concentration for activity assays. The released flavins were
identified by HPLC according to ref. 22 and compared with
commercially available standards for identification.
Spectral Analyses. Spectral analyses were performed on a spec-
trophotometer (v560; Jasco, Easton, MD) scanning between 800
and 300 nm at 400 nm/min. Anaerobic analyses were carried out
in an anaerobic chamber (Coy Laboratory Products, Ann Arbor,
MI). For all spectral analyses, enzyme concentrations quoted are
for sample protein. The XplA titration with sodium dithionite in
the anaerobic chamber followed desalting of the protein on a
PD-10 column (GE Healthcare) into 50 mM potassium phos-
phate, pH 6.8 (bubbled with nitrogen before equilibrating in the
chamber for 2 days). For RDX titration, RDX was dissolved in
DMSO and no more than 3 l was added per ml.
Fig. 7. Characterization of XplAB and XplB transgenic Arabidopsis lines. (A) Expression of xplA and xplB in rosette leaves. Quantitative analysis was done by
real-time PCR of xplA and xplB transcript abundance in rosette leaves of the transgenic lines relative to line XplAB-2. ACTIN2 mRNA was used as an internal
reference. Results represent the mean of three independent RNA isolations measured in duplicate from the pooled rosette leaves of 10 plants Ϯ SE. (B and C)
Uptake of RDX from media by Arabidopsis seedlings. Results are the mean Ϯ SE of five replicate flasks, each containing 200 10-day-old seedlings. (D) Levels of
RDX in soil leachate from Arabidopsis plants watered with 180 M RDX. Results are the mean Ϯ SE of five replicate pots. NPC, no plant control.
16826 ͉ www.pnas.org͞cgi͞doi͞10.1073͞pnas.0705110104 Jackson et al.
6. XplA and XplB Activity Assays Toward RDX. Anaerobic conditions. XplA
and XplB were placed on ice in an anaerobic chamber in open
vials for 3 h for the palladium catalyst to remove oxygen. Buffer
was bubbled with nitrogen before equilibration in the chamber.
The reaction mixture contained 60 nM XplA and XplB in 50 mM
potassium phosphate (pH 6.8), 300 M NADPH, and 100 M
RDX in a total volume of 1 ml. Other reagents and solutions
were placed overnight in the anaerobic chamber with a nitrogen
atmosphere, before use. Oxygen levels were monitored with a
model 10 gas analyzer (Coy Laboratory Products) and main-
tained Ͻ1 ppm by using a 5% (vol/vol) hydrogen mix in the
presence of a palladium catalyst.
Aerobic conditions. The reaction mixture contained 175 nM XplA
and 150 nM XplB, 50 mM potassium phosphate (pH 6.8), 300
M NADPH, 100 M RDX, 0.72 units Thermoanaerobium
brockii alcohol dehydrogenase (Sigma, St. Louis, MO), and 30 l
isopropanol in a total volume of 1 ml. All reactions were
performed at room temperature (20°C), and assays were stopped
by the addition of 10% trichloroacetic acid (240 mg/ml) or, for
the mass balance experiments, 30-kDa cut-off spin columns
(Microcon YM-30; Amicon). The reaction was initiated by the
addition of RDX.
Analysis of Products. RDX removal was measured by using RP-
HPLC with a HPLC system (2695 Separations Module and 2996
Photodiode Array Detector; Waters) using a Techsphere C18
column (250 ϫ 4.6 mm) under isocratic conditions of 60% water
and 40% acetonitrile at a flow rate of 1 ml/min over 10 min. RDX
elution was monitored at 205 nm, and intergrations were per-
formed with Empower software.
Formaldehyde analysis was carried out according to Nash (23).
Nitrite analysis followed the method of Scheideler and Ninnemann
(24) terminated by removal of proteins with 30-kDa cut-off spin
columns. The concentration of NDAB and MEDINA was deter-
mined by using an HPLC system as reported (25).
Activity Assays Toward Other Substrates and with Inhibitors. Analysis
of octahydro-1,3,5,7-tetranitro-1,3,5,7-tetrazocine was as de-
scribed for RDX. Loss of TNT was analyzed by using a water
mobile phase of 50% MeCN, 50% water over 12 min with
monitoring at 230 nm. Paclitaxel was analyzed by using a
methanol and water gradient from 60–70% MeOH over 20 min
with monitoring at 230 nm. Testosterone was analyzed by HPLC
using a 58–62% MeOH gradient over 8 min. Activity toward
7-ethoxycoumarin was tested by following fluorescence of 7-hy-
droxy coumarin, with excitation at 350 nm and emission at 450
nm adapted from ref. 26 and TLC. Activity toward ethoxyresoru-
fin was determined fluorometrically with excitation at 530 nm
and emission at 590 nm, adapted from ref. 26. Carbon monoxide
inhibition was carried out aerobically by adding 100 or 500 l per
ml of carbon monoxide-saturated buffer.
Plant Transformation Methods. The xplB gene was cloned into the
binary vector pART27 (27) under the control of the CaMV35S
promoter and ocs terminator, and transformed by Agrobacte-
rium-mediated floral dipping into wild-type and xplA-expressing
Arabidopsis thaliana, ecotype Columbia-0 as in ref. 9.
Liquid Culture and Soil Leachate Experiments. Liquid culture exper-
iments were performed as described (9). Soil leachate studies
were carried out on 6-week-old Arabidopsis plants grown under
180 m⅐m2
⅐s Ϫ1
light in a 12-h photoperiod. Plants were grown
in pots containing 30 g of uncontaminated soil (Levingtons F2
compost), five plants per pot. Each pot was flooded with 50 ml
of 180 M RDX, then 7 days later, flushed through with 50 ml
of water. The collected soil leachates were analyzed for RDX
content by using HPLC as described above.
This work was funded by the Strategic Environmental Research and
Development Program of the U.S. Department of Defense, the Bio-
technology and Biological Sciences Research Council, and the U.K.
Ministry of Defense.
1. Guengerich FP (2001) Chem Res Toxicol 14:611–650.
2. Prosser DE, Jones G (2004) Trends Biochem Sci 29:664–673.
3. Green AJ, Rivers SL, Cheeseman M, Reid GA, Quaroni LG, Macdonald ID,
Chapman SK, Munro AW (2001) J Biol Inorg Chem 6:523–533.
4. Schoch G, Goepfert S, Morant M, Hehn A, Meyer D, Ullmann P, Werck-
Reichhart D (2001) J Biol Chem 276:36566–36574.
5. Seth-Smith HMB, Rosser SJ, Basran A, Travis ER, Dabbs ER, Nicklin S, Bruce
NC (2002) Appl Environ Microbiol 68:4764–4771.
6. Munro AW, Lindsay JG, Coggins JR, Kelly SM, Price NC (1996) Biochim
Biophys Acta 1296:127–137.
7. Hunter DJ, Roberts GA, Ost TW, White JH, Muller S, Turner NJ, Flitsch SL,
Chapman SK (2005) FEBS Lett 579:2215–2220.
8. Nakayama N, Takemae A, Shoun H (1996) J Biochem (Tokyo) 119:435–440.
9. Rylott EL, Jackson RG, Edwards J, Womack GL, Seth-Smith HM, Rathbone
DA, Strand SE, Bruce NC (2006) Nat Biotechnol 24:216–219.
10. Cao PR, Bulow H, Dumas B, Bernhardt R (2000) Biochim Biophys Acta
1476:253–264.
11. Zollner A, Nogues I, Heinz A, Medina M, Gomez-Moreno C, Bernhardt R
(2004) Bioelectrochemistry 63:61–65.
12. Clausen J, Robb J, Curry D, Korte N (2004) Environ Pollut 129:13–21.
13. Peterson JA, Mock DM (1975) Adv Exp Med Biol 58:311–324.
14. Fournier D, Halasz A, Spain J, Fiurasek P, Hawari J (2002) Appl Environ
Microbiol 68:166–172.
15. Halasz A, Spain J, Paquet L, Beaulieu C, Hawari J (2002) Environ Sci Technol
36:633–638.
16. Melius CF (1990) in Chemistry and Physics of Energetic Materials: Thermochemical
Modeling, ed Bulusu SN (Kluwer, Dordrecht, The Netherlands), pp 21–49.
17. Bhushan B, Trott S, Spain JC, Halasz A, Paquet L, Hawari J (2003) Appl
Environ Microbiol 69:1347–1351.
18. Spracklin DK, Kharasch ED (1998) Drug Metab Dispos 26:605–607.
19. Koe GS, Vilker VL (2005) Biotechnol Prog 21:1119–1127.
20. Sevrioukova IF, Peterson JA (1995) Arch Biochem Biophys 317:397–404.
21. Sambrook J, Russell DW (2001) Molecular Cloning: A Laboratory Manual (Cold
Spring Harbor Lab Press, Cold Spring, NY).
22. Aliverti A, Curti B, Vanoni M (1999) in Flavoprotein Protocol, eds Chapman
SK, Reid GA (Humana, Totowa, NJ), pp 9–23.
23. Nash T (1953) Biochem J 55:416–421.
24. Scheideler L, Ninnemann H (1986) Anal Biochem 154:29–33.
25. Fournier D, Halasz A, Spain J, Spanggord RJ, Bottaro JC, Hawari J (2004) Appl
Environ Microbiol 70:1123–1128.
26. Werck-Reichhart D, Gabriac B, Teutsch H, Durst F (1990) Biochem J 270:729–735.
27. Gleave AP (1992) Plant Mol Biol 20:1203–1207.
Jackson et al. PNAS ͉ October 23, 2007 ͉ vol. 104 ͉ no. 43 ͉ 16827
APPLIEDBIOLOGICAL
SCIENCES