Trends in deep learning in 2020 - International Journal of Artificial Intelli...gerogepatton
The International Journal of Artificial Intelligence & Applications (IJAIA) is a bi monthly open access peer-reviewed journal that publishes articles which contribute new results in all areas of the Artificial Intelligence & Applications (IJAIA). It is an international journal intended for professionals and researchers in all fields of AI for researchers, programmers, and software and hardware manufacturers. The journal also aims to publish new attempts in the form of special issues on emerging areas in Artificial Intelligence and applications.
New Research Articles 2019 October Issue Signal & Image Processing An Interna...sipij
Signal & Image Processing: An International Journal (SIPIJ)
ISSN: 0976 – 710X [Online]; 2229 - 3922 [Print]
http://www.airccse.org/journal/sipij/index.html
Current Issue; October 2019, Volume 10, Number 5
Free- Reference Image Quality Assessment Framework Using Metrics Fusion and Dimensionality Reduction
Besma Sadou1, Atidel Lahoulou2, Toufik Bouden1, Anderson R. Avila3, Tiago H. Falk3 and Zahid Akhtar4, 1Non Destructive Testing Laboratory, University of Jijel, Algeria, 2LAOTI laboratory, University of Jijel, Algeria, 3University of Québec, Canada and 4University of Memphis, USA
Test-cost-sensitive Convolutional Neural Networks with Expert Branches
Mahdi Naghibi1, Reza Anvari1, Ali Forghani1 and Behrouz Minaei2, 1Malek-Ashtar University of Technology, Iran and 2Iran University of Science and Technology, Iran
Robust Image Watermarking Method using Wavelet Transform
Omar Adwan, The University of Jordan, Jordan
Improvements of the Analysis of Human Activity Using Acceleration Record of Electrocardiographs
Itaru Kaneko1, Yutaka Yoshida2 and Emi Yuda3, 1&2Nagoya City University, Japan and 3Tohoku University, Japan
http://www.airccse.org/journal/sipij/vol10.html
A graduation project at the Faculty of Computer and Information Sciences, Ain Shams University, Cairo, Egypt.
Interactive
wall Allows users to interact with the computer using his/her hands
gestures,
The application uses an optical camera to detect and track
the hands using image processing techniques,
The desktop is projected
on a wall using a projector, which gives the user the free experience
of interacting with the computer freely.
_________________________________________________________________
Windows Live™: Keep your life in sync. Check it out!
http://windowslive.com/explore?ocid=TXT_TAGLM_WL_t1_allup_explore_012009
Metric-based Few-shot Classification in Remote Sensing Image
Safety-critical Policy Iteration Algorithm for Control under Model Uncertainty
Elderly Fall Detection by Sensitive Features Based on Image Processing and Machine Learning
Efficient Parallel Processing of k-Nearest Neighbor Queries by Using a Centroid-based and Hierarchical Clustering Algorithm
Class imbalance is a pervasive issue in the field of disease classification from
medical images. It is necessary to balance out the class distribution while training a model. However, in the case of rare medical diseases, images from affected
patients are much harder to come by compared to images from non-affected
patients, resulting in unwanted class imbalance. Various processes of tackling
class imbalance issues have been explored so far, each having its fair share of
drawbacks. In this research, we propose an outlier detection based image classification technique which can handle even the most extreme case of class imbalance. We have utilized a dataset of malaria parasitized and uninfected cells. An
autoencoder model titled AnoMalNet is trained with only the uninfected cell images at the beginning and then used to classify both the affected and non-affected
cell images by thresholding a loss value. We have achieved an accuracy, precision, recall, and F1 score of 98.49%, 97.07%, 100%, and 98.52% respectively,
performing better than large deep learning models and other published works.
As our proposed approach can provide competitive results without needing the
disease-positive samples during training, it should prove to be useful in binary
disease classification on imbalanced datasets.
Object Detection on Dental X-ray Images using R-CNNMinhazul Arefin
In dentistry, Dental X-ray systems help dentists by showing the basic structure of tooth bones to detect various kinds of dental problems. However, depending only on dentists can sometimes impede treatment since identifying things in X-ray pictures requires human effort, experience, and time, which can lead to delays in the process. In image classification, segmentation, object identification, and machine translation, recent improvements in deep learning have been effective. Deep learning may be used in X-ray systems to detect objects. Radiology and pathology have benefited greatly from the use of deep convolutional neural networks, which are a fast-growing new area of a medical study. Deep learning techniques for the identification of objects in dental X-ray systems are the focus of this study. As part of the study, Deep Neural Network algorithms were evaluated for their ability to identify dental cavities and a root canal on periapical radiographs.
Trends in deep learning in 2020 - International Journal of Artificial Intelli...gerogepatton
The International Journal of Artificial Intelligence & Applications (IJAIA) is a bi monthly open access peer-reviewed journal that publishes articles which contribute new results in all areas of the Artificial Intelligence & Applications (IJAIA). It is an international journal intended for professionals and researchers in all fields of AI for researchers, programmers, and software and hardware manufacturers. The journal also aims to publish new attempts in the form of special issues on emerging areas in Artificial Intelligence and applications.
New Research Articles 2019 October Issue Signal & Image Processing An Interna...sipij
Signal & Image Processing: An International Journal (SIPIJ)
ISSN: 0976 – 710X [Online]; 2229 - 3922 [Print]
http://www.airccse.org/journal/sipij/index.html
Current Issue; October 2019, Volume 10, Number 5
Free- Reference Image Quality Assessment Framework Using Metrics Fusion and Dimensionality Reduction
Besma Sadou1, Atidel Lahoulou2, Toufik Bouden1, Anderson R. Avila3, Tiago H. Falk3 and Zahid Akhtar4, 1Non Destructive Testing Laboratory, University of Jijel, Algeria, 2LAOTI laboratory, University of Jijel, Algeria, 3University of Québec, Canada and 4University of Memphis, USA
Test-cost-sensitive Convolutional Neural Networks with Expert Branches
Mahdi Naghibi1, Reza Anvari1, Ali Forghani1 and Behrouz Minaei2, 1Malek-Ashtar University of Technology, Iran and 2Iran University of Science and Technology, Iran
Robust Image Watermarking Method using Wavelet Transform
Omar Adwan, The University of Jordan, Jordan
Improvements of the Analysis of Human Activity Using Acceleration Record of Electrocardiographs
Itaru Kaneko1, Yutaka Yoshida2 and Emi Yuda3, 1&2Nagoya City University, Japan and 3Tohoku University, Japan
http://www.airccse.org/journal/sipij/vol10.html
A graduation project at the Faculty of Computer and Information Sciences, Ain Shams University, Cairo, Egypt.
Interactive
wall Allows users to interact with the computer using his/her hands
gestures,
The application uses an optical camera to detect and track
the hands using image processing techniques,
The desktop is projected
on a wall using a projector, which gives the user the free experience
of interacting with the computer freely.
_________________________________________________________________
Windows Live™: Keep your life in sync. Check it out!
http://windowslive.com/explore?ocid=TXT_TAGLM_WL_t1_allup_explore_012009
Metric-based Few-shot Classification in Remote Sensing Image
Safety-critical Policy Iteration Algorithm for Control under Model Uncertainty
Elderly Fall Detection by Sensitive Features Based on Image Processing and Machine Learning
Efficient Parallel Processing of k-Nearest Neighbor Queries by Using a Centroid-based and Hierarchical Clustering Algorithm
Class imbalance is a pervasive issue in the field of disease classification from
medical images. It is necessary to balance out the class distribution while training a model. However, in the case of rare medical diseases, images from affected
patients are much harder to come by compared to images from non-affected
patients, resulting in unwanted class imbalance. Various processes of tackling
class imbalance issues have been explored so far, each having its fair share of
drawbacks. In this research, we propose an outlier detection based image classification technique which can handle even the most extreme case of class imbalance. We have utilized a dataset of malaria parasitized and uninfected cells. An
autoencoder model titled AnoMalNet is trained with only the uninfected cell images at the beginning and then used to classify both the affected and non-affected
cell images by thresholding a loss value. We have achieved an accuracy, precision, recall, and F1 score of 98.49%, 97.07%, 100%, and 98.52% respectively,
performing better than large deep learning models and other published works.
As our proposed approach can provide competitive results without needing the
disease-positive samples during training, it should prove to be useful in binary
disease classification on imbalanced datasets.
Object Detection on Dental X-ray Images using R-CNNMinhazul Arefin
In dentistry, Dental X-ray systems help dentists by showing the basic structure of tooth bones to detect various kinds of dental problems. However, depending only on dentists can sometimes impede treatment since identifying things in X-ray pictures requires human effort, experience, and time, which can lead to delays in the process. In image classification, segmentation, object identification, and machine translation, recent improvements in deep learning have been effective. Deep learning may be used in X-ray systems to detect objects. Radiology and pathology have benefited greatly from the use of deep convolutional neural networks, which are a fast-growing new area of a medical study. Deep learning techniques for the identification of objects in dental X-ray systems are the focus of this study. As part of the study, Deep Neural Network algorithms were evaluated for their ability to identify dental cavities and a root canal on periapical radiographs.
Deep learning methods applied to physicochemical and toxicological endpointsValery Tkachenko
Chemical and pharmaceutical companies, and government agencies regulating both chemical and biological compounds, all strive to develop new methods to provide efficient prioritization, evaluation and safety assessments for the hundreds of new chemicals that enter the market annually. While there is a lot of historical data available within the various agencies, organizations and companies, significant gaps remain in both the quantity and quality of data available coupled with optimal predictive methods. Traditional QSAR methods are based on sets of features (fingerprints) which representing the functional characteristics of chemicals. Unfortunately, due to both data gaps and limitations in the development of QSAR models, read-across approaches have become a popular area of research. Successes in the application of Artificial Neural Networks, and specifically in Deep Learning Neural Networks, has delivered a new optimism that the lack of data and limited feature sets can be overcome by using Deep Learning methods. In this poster we will present a comparison of various machine learning methods applied to several toxicological and physicochemical parameter endpoints. This abstract does not reflect U.S. EPA policy.
A brief study on rice diseases recognition and image classification: fusion d...IJECEIAES
In the regions of southern Andhra Pradesh, rice brown spot, rice blast, and rice sheath blight have emerged as the most prevalent diseases. The goal of this research is to increase the precision and effectiveness of disease diagnosis by proposing a framework for the automated recognition and classification of rice diseases. Therefore, this work proposes a hybrid approach with multiple stages. Initially, the region of interest (ROI) is extracted from the dataset and test images. Then, the multiple features are extracted, such as color-moment-based features, grey-level cooccurrence matrix (GLCM)-based texture, and shape features. Then, the S-particle swarm optimization (SPSO) model selects the best features from the extracted features. Moreover, the deep belief network (DBN) model trained by SPSO is based on optimal features, which classify the different types of rice diseases. The SPSO algorithm also optimized the losses generated in the DBN model. The suggested model achieves a hit rate of 94.85% and an accuracy of 97.48% with the 10-fold cross-validation approach. The traditional machine learning (ML) model is significantly less accurate than the area under the receiver operating characteristic curve (AUC), which has an accuracy of 97.48%.
Social media marketing (SMM) is a form of digital marketing that utilizes social media platforms to promote products, services, or brands. The goal of social media marketing is to connect with the target audience, build brand awareness, increase website traffic, and drive engagement and conversions. Here are some key aspects of social media marketing:
Strategy Development:
Identify your target audience: Understand the demographics, interests, and online behavior of your target audience.
Set clear goals: Define specific, measurable, achievable, relevant, and time-bound (SMART) goals for your social media campaigns.
Choose the right platforms: Select social media platforms that align with your target audience and business objectives.
Content Creation:
Create engaging content: Develop content that resonates with your audience, such as images, videos, infographics, and text posts.
Maintain consistency: Establish a consistent posting schedule to keep your audience engaged and informed.
Use a variety of content types: Experiment with different content formats to keep your social media presence diverse and interesting.
Audience Engagement:
Respond to comments and messages: Engage with your audience by responding to comments, messages, and mentions in a timely manner.
Encourage user-generated content: Encourage your followers to create and share content related to your brand.
Run contests and giveaways: Organize contests or giveaways to boost engagement and attract new followers.
Paid Advertising:
Utilize paid social media advertising: Platforms like Facebook, Instagram, Twitter, and LinkedIn offer advertising options to reach a larger audience.
Targeted advertising: Use advanced targeting options to reach specific demographics, interests, and behaviors.
Analytics and Monitoring:
Use analytics tools: Monitor the performance of your social media campaigns using analytics tools provided by the platforms or third-party tools.
Adjust strategies based on data: Analyze the data and adjust your strategies to optimize performance and achieve better results.
Influencer Marketing:
Collaborate with influencers: Partner with influencers who align with your brand to reach a wider audience and build credibility.
Leverage user trust: Influencers can help establish trust with their followers, leading to increased brand credibility.
Social Media Trends:
Stay updated: Keep track of emerging trends in social media marketing and adapt your strategies accordingly.
Experiment with new features: Platforms regularly introduce new features; experiment with these features to stay ahead of the curve.
Remember that effective social media marketing requires a consistent and strategic approach. Regularly assess your performance, listen to your audience, and adjust your strategies to meet your goals.
TOP 5 Most View Article From Academia in 2019sipij
TOP 5 Most View Article From Academia in 2019
Signal & Image Processing : An International Journal (SIPIJ)
ISSN : 0976 - 710X (Online) ; 2229 - 3922 (print)
http://www.airccse.org/journal/sipij/index.html
TOC- Current Issue: December 2020, Volume 11, Number 6sipij
Signal & Image Processing : An International Journal is an Open Access peer-reviewed journal intended for researchers from academia and industry, who are active in the multidisciplinary field of signal & image processing. The scope of the journal covers all theoretical and practical aspects of the Digital Signal Processing & Image processing, from basic research to development of application.
Knowledge Science for AI-based biomedical and clinical applicationsCatia Pesquita
The great barrier to AI adoption in healthcare and biomedical research is lack of trust.
Assessing trustworthiness requires data, domain and user context, which can be supported by ontologies, knowledge graphs and FAIR data.
DevFest19 - Early Diagnosis of Chronic Diseases by Smartphone AIGaurav Kheterpal
Session by Sabyasachi Mukhopadhyay
Kolkata Lead, Facebook Developer Circle
GDE in ML
Intel Software Innovator
Visiting Faculty, SCIT Pune
Co-Founder & Chief Research Officer, Twelit MedTech Pvt. Ltd
Deep learning methods applied to physicochemical and toxicological endpointsValery Tkachenko
Chemical and pharmaceutical companies, and government agencies regulating both chemical and biological compounds, all strive to develop new methods to provide efficient prioritization, evaluation and safety assessments for the hundreds of new chemicals that enter the market annually. While there is a lot of historical data available within the various agencies, organizations and companies, significant gaps remain in both the quantity and quality of data available coupled with optimal predictive methods. Traditional QSAR methods are based on sets of features (fingerprints) which representing the functional characteristics of chemicals. Unfortunately, due to both data gaps and limitations in the development of QSAR models, read-across approaches have become a popular area of research. Successes in the application of Artificial Neural Networks, and specifically in Deep Learning Neural Networks, has delivered a new optimism that the lack of data and limited feature sets can be overcome by using Deep Learning methods. In this poster we will present a comparison of various machine learning methods applied to several toxicological and physicochemical parameter endpoints. This abstract does not reflect U.S. EPA policy.
A brief study on rice diseases recognition and image classification: fusion d...IJECEIAES
In the regions of southern Andhra Pradesh, rice brown spot, rice blast, and rice sheath blight have emerged as the most prevalent diseases. The goal of this research is to increase the precision and effectiveness of disease diagnosis by proposing a framework for the automated recognition and classification of rice diseases. Therefore, this work proposes a hybrid approach with multiple stages. Initially, the region of interest (ROI) is extracted from the dataset and test images. Then, the multiple features are extracted, such as color-moment-based features, grey-level cooccurrence matrix (GLCM)-based texture, and shape features. Then, the S-particle swarm optimization (SPSO) model selects the best features from the extracted features. Moreover, the deep belief network (DBN) model trained by SPSO is based on optimal features, which classify the different types of rice diseases. The SPSO algorithm also optimized the losses generated in the DBN model. The suggested model achieves a hit rate of 94.85% and an accuracy of 97.48% with the 10-fold cross-validation approach. The traditional machine learning (ML) model is significantly less accurate than the area under the receiver operating characteristic curve (AUC), which has an accuracy of 97.48%.
Social media marketing (SMM) is a form of digital marketing that utilizes social media platforms to promote products, services, or brands. The goal of social media marketing is to connect with the target audience, build brand awareness, increase website traffic, and drive engagement and conversions. Here are some key aspects of social media marketing:
Strategy Development:
Identify your target audience: Understand the demographics, interests, and online behavior of your target audience.
Set clear goals: Define specific, measurable, achievable, relevant, and time-bound (SMART) goals for your social media campaigns.
Choose the right platforms: Select social media platforms that align with your target audience and business objectives.
Content Creation:
Create engaging content: Develop content that resonates with your audience, such as images, videos, infographics, and text posts.
Maintain consistency: Establish a consistent posting schedule to keep your audience engaged and informed.
Use a variety of content types: Experiment with different content formats to keep your social media presence diverse and interesting.
Audience Engagement:
Respond to comments and messages: Engage with your audience by responding to comments, messages, and mentions in a timely manner.
Encourage user-generated content: Encourage your followers to create and share content related to your brand.
Run contests and giveaways: Organize contests or giveaways to boost engagement and attract new followers.
Paid Advertising:
Utilize paid social media advertising: Platforms like Facebook, Instagram, Twitter, and LinkedIn offer advertising options to reach a larger audience.
Targeted advertising: Use advanced targeting options to reach specific demographics, interests, and behaviors.
Analytics and Monitoring:
Use analytics tools: Monitor the performance of your social media campaigns using analytics tools provided by the platforms or third-party tools.
Adjust strategies based on data: Analyze the data and adjust your strategies to optimize performance and achieve better results.
Influencer Marketing:
Collaborate with influencers: Partner with influencers who align with your brand to reach a wider audience and build credibility.
Leverage user trust: Influencers can help establish trust with their followers, leading to increased brand credibility.
Social Media Trends:
Stay updated: Keep track of emerging trends in social media marketing and adapt your strategies accordingly.
Experiment with new features: Platforms regularly introduce new features; experiment with these features to stay ahead of the curve.
Remember that effective social media marketing requires a consistent and strategic approach. Regularly assess your performance, listen to your audience, and adjust your strategies to meet your goals.
TOP 5 Most View Article From Academia in 2019sipij
TOP 5 Most View Article From Academia in 2019
Signal & Image Processing : An International Journal (SIPIJ)
ISSN : 0976 - 710X (Online) ; 2229 - 3922 (print)
http://www.airccse.org/journal/sipij/index.html
TOC- Current Issue: December 2020, Volume 11, Number 6sipij
Signal & Image Processing : An International Journal is an Open Access peer-reviewed journal intended for researchers from academia and industry, who are active in the multidisciplinary field of signal & image processing. The scope of the journal covers all theoretical and practical aspects of the Digital Signal Processing & Image processing, from basic research to development of application.
Knowledge Science for AI-based biomedical and clinical applicationsCatia Pesquita
The great barrier to AI adoption in healthcare and biomedical research is lack of trust.
Assessing trustworthiness requires data, domain and user context, which can be supported by ontologies, knowledge graphs and FAIR data.
DevFest19 - Early Diagnosis of Chronic Diseases by Smartphone AIGaurav Kheterpal
Session by Sabyasachi Mukhopadhyay
Kolkata Lead, Facebook Developer Circle
GDE in ML
Intel Software Innovator
Visiting Faculty, SCIT Pune
Co-Founder & Chief Research Officer, Twelit MedTech Pvt. Ltd
Official announcement of the next edition of the event.BMRS Meeting
Presentation of the XXI B-MRS Meeting (Maceió, AL, Oct 1st to 5th, 2023) by the chair Prof. Carlos Jacinto da Silva (UFAL) at the closing session of the XX B-MRS Meeting.
What is greenhouse gasses and how many gasses are there to affect the Earth.moosaasad1975
What are greenhouse gasses how they affect the earth and its environment what is the future of the environment and earth how the weather and the climate effects.
ESR spectroscopy in liquid food and beverages.pptxPRIYANKA PATEL
With increasing population, people need to rely on packaged food stuffs. Packaging of food materials requires the preservation of food. There are various methods for the treatment of food to preserve them and irradiation treatment of food is one of them. It is the most common and the most harmless method for the food preservation as it does not alter the necessary micronutrients of food materials. Although irradiated food doesn’t cause any harm to the human health but still the quality assessment of food is required to provide consumers with necessary information about the food. ESR spectroscopy is the most sophisticated way to investigate the quality of the food and the free radicals induced during the processing of the food. ESR spin trapping technique is useful for the detection of highly unstable radicals in the food. The antioxidant capability of liquid food and beverages in mainly performed by spin trapping technique.
hematic appreciation test is a psychological assessment tool used to measure an individual's appreciation and understanding of specific themes or topics. This test helps to evaluate an individual's ability to connect different ideas and concepts within a given theme, as well as their overall comprehension and interpretation skills. The results of the test can provide valuable insights into an individual's cognitive abilities, creativity, and critical thinking skills
Travis Hills' Endeavors in Minnesota: Fostering Environmental and Economic Pr...Travis Hills MN
Travis Hills of Minnesota developed a method to convert waste into high-value dry fertilizer, significantly enriching soil quality. By providing farmers with a valuable resource derived from waste, Travis Hills helps enhance farm profitability while promoting environmental stewardship. Travis Hills' sustainable practices lead to cost savings and increased revenue for farmers by improving resource efficiency and reducing waste.
Observation of Io’s Resurfacing via Plume Deposition Using Ground-based Adapt...Sérgio Sacani
Since volcanic activity was first discovered on Io from Voyager images in 1979, changes
on Io’s surface have been monitored from both spacecraft and ground-based telescopes.
Here, we present the highest spatial resolution images of Io ever obtained from a groundbased telescope. These images, acquired by the SHARK-VIS instrument on the Large
Binocular Telescope, show evidence of a major resurfacing event on Io’s trailing hemisphere. When compared to the most recent spacecraft images, the SHARK-VIS images
show that a plume deposit from a powerful eruption at Pillan Patera has covered part
of the long-lived Pele plume deposit. Although this type of resurfacing event may be common on Io, few have been detected due to the rarity of spacecraft visits and the previously low spatial resolution available from Earth-based telescopes. The SHARK-VIS instrument ushers in a new era of high resolution imaging of Io’s surface using adaptive
optics at visible wavelengths.
Professional air quality monitoring systems provide immediate, on-site data for analysis, compliance, and decision-making.
Monitor common gases, weather parameters, particulates.
ANAMOLOUS SECONDARY GROWTH IN DICOT ROOTS.pptxRASHMI M G
Abnormal or anomalous secondary growth in plants. It defines secondary growth as an increase in plant girth due to vascular cambium or cork cambium. Anomalous secondary growth does not follow the normal pattern of a single vascular cambium producing xylem internally and phloem externally.
Materials Science in the Era of Knowledge Discovery and Artificial Inteligence
1. Materials Sciences in the Era of Knowledge
Discovery and Artificial Intelligence
Osvaldo N. Oliveira Jr
chu@ifsc.usp.br
University of São Paulo, Brazil
2. Language is so important that
we should teach it to our
children and to our machines
Osvaldo N. Oliveira Jr - 2021
3. Outline
• Knowledge Discovery
• Sensors and Biosensors
• Machine Learning and Natural Language
Processing
• The Fifth Paradigm
5. Aykol M.; et al., The Materials Research Platform: Defining the Requirements from User
Stories, Matter, 1, 1433-1438 (2019).
Adaptive systems—active-learning and
beyond;
Automation of experiments;
Automation of simulations;
Collaboration;
Data ingestion and sharing;
Integration;
Knowledge discovery;
Machine learning for experiments;
Machine learning for simulations;
Multi-fidelity and uncertainty
quantification;
Reproducibility and provenance;
Scale bridging;
Simulation tools;
Software infrastructure;
Text mining and natural language
processing;
Visualization.
Materials research of the future
6. Data
collection
Visualization
Clustering
Unsupervised ML
Classification
Supervised ML
Data processing pipeline
Data collection: planned experiments for balanced classes
Visualization: multiple methods, user interaction, attribute selection
Clustering: unsupervised machine learning, classes unknown a priori
Classification: supervised machine learning, classes are known. Care to
avoid overfitting on small data sets (as in sensor data)
7. Popolin et al., Bull. Japanese Chem. Soc. 2021
Machine Learning Used to Create a Multidimensional Calibration
Space for Sensing and Biosensing Data
Multidimensional calibration space
• Calibration curve replaced by multidimensional space
• Equation replaced by rules from Decision Trees or Random Forests
• Number of dimensions is the number of features
• Minimum number of rules is number of classes
• Rule coverage – 1 if all instances are classified correctly
• Feature importance – percentage of samples explained
8. Rule r1: Coverage 1.0 (supporting all instances)
IF 5.0 ≤ C (F) @ F1000 (Hz) < 6.0
THEN Class 0.0
Distinction:
4 samples at
10 Hz.
higher
feature
importance
2 samples at
1MHz
1D MCS
6 rules
(minimum)
Full coverage
Same feature
importance
2D MCS
Multidimensional calibration space
9. Popolin et al., Bull. Japanese Chem. Soc. - 2021
Machine Learning Used to Create a Multidimensional Calibration
Space for Sensing and Biosensing Data
Multidimensional calibration space
Detection of phytic acid with a bad sensor. Capacitance at
three frequencies to generate MCS (3D)
Seven rules used to classify samples with 5 concentrations. Rule coverage was
usually lower than one, and the highest feature importance applied to F100
10. Popolin et al., Bull. Japanese Chem. Soc. - 2021
Machine Learning Used to Create a Multidimensional Calibration
Space for Sensing and Biosensing Data
Multidimensional calibration space
Rules from
Decision
Trees
11. Milk samples: S.aureus concentrations: 0 - 107 CFU/mL discretized as classes. MCS has 5 dimensions
(F1000, F21, F46, F10000 and F464158). Most important feature: F1000 with importance value of 0.33.
Soares et al. Detection of Staphylococcus aureus in milk samples using impedance spectroscopy and data
processing with information visualization and machine learning (Sensors & Actuators Reports, 2022)
Immunosensor to detect bacteria in milk
12. • MCS
• Nested K-Fold
Riul Jr et al. Analyst, 135, 2010.
• Salmonella
• Lactose
• Mucin
• NaOH
• H2O
Detection of S.aureus with immunosensors
A.C. Soares et al., Analyst, 2020
Mastitis Diagnosis
Diagnosis with an electronic tongue
6-Dimension MCS to detect bacteria in
crude milk samples: Average accuracy:
94%.
A.C. Soares et al, Chem. Eng. J., 2022
13. Braz et al. Using machine learning and an electronic tongue for discriminating saliva
samples from cancer patients and healthy individuals (Talanta, 2022)
MCS: 26 dimensions - 19 frequencies and 7 clinic features. Most important
features: 2 first columns, frequency 215 Hz and "alcoholism_no".
E-tongue for cancer diagnosis
14. Genosensor to detect SARS-CoV-2
Gold electrodes coated with SAM
functionalized with EDC/NHS and a
layer of ssDNA sequences
Probe: cp DNA SARS-CoV-2: 5’-5AmMC6/-
ATTTCGCTGATTTTGGGGTC-3’
Positive Control: ssDNA SARS-CoV-2
5’-
TGATAATGGACCCCAAAATCAGCGAAATGC
ACCCCGCATTACGTTTGGTGGACCCTCAGA
TTCAACTGGCAGTAACCAGA-3’
Negative control: From TP53 gene
5’ - CCCATCCTCACCATCATCACA
CTGGAAGACTCCAGTGGTAATCTACTGGGA
CGGAACAGCTTTGAGGTGCGGTTTGTG - 3’
Impedance spectroscopy (IS)
Electrochemical IS
Optical – LSPR
Image analysis J.C. Soares et al, Materials Chemistry Frontiers, 2021
15. (a) blank
(b) negative control
(c) HPV16
(d) PCA3
(e) 10−18 mol L−1
(f) 10−16 mol L−1
(g) 10−14 mol L-1
(h) 10−12 mol L−1
(i) 10−10 mol L−1
(j) 10−8 mol L−1
(k) 10−6 mol L−1
Scale bar: 50µm.
Image Analysis
Supervised machine learning
99.7% accuracy in binary
classification with SVM
95.8% accuracy in multiclass
with LDA Soares et al, Materials Chemistry Frontiers, 2021
16. 250 PFU
6000 PFU
100 nm
200 nm 200 nm
200 nm 200 nm
200 nm
Functionalized AuNPs aggregate after exposure to 250 and
6000 PFU of inactivated SARS-CoV-2.
(D)
(E)
(F)
(G)
(H)
(I)
Absorbance
Efficiency
0.0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
Absorbance
Efficiency
Wavelength (nm)
500 600 700
Wavelength (nm)
500 600 700
Conf_1
Conf_2
Conf_3
Conf_4
Conf_5
Avg_3
Conf_1
Conf_2
Conf_3
Conf_4
Conf_5
Avg_2
Conf_1
Conf_2
Conf_3
Conf_4
Conf_5
Avg_1
Gold_NP
0.0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
Absorbance
Efficiency
Wavelength (nm)
500 600 700
30
40
50
60
70
80
90
100
X (nm)
-60 -20 20
-40 0
Z
(nm)
30
40
50
60
70
80
90
100
Z
(nm)
X (nm)
0 40 80
20 60
-40
-30
-20
-10
0
10
20
30
Z
(nm)
X (nm)
-60 -20 20
-40 0 40
100
-10
0
10
20
30
Z
(nm)
90
X (nm)
80 60 40
70 50 30
-40
X (nm)
-60 -20 20
-40 0 40
-30
-20
-10
0
10
20
30
Z
(nm)
-40
X (nm)
-60 -20 20
-40 0 40
-30
-20
-10
0
10
20
30
Z
(nm)
3
3.5
4
4.5
5
5.5
6
6.5
2.5
2
1.5
1
10
12
14
16
18
20
22
24
8
6
4
2
50
100
150
200
250
(A)
(B)
(C)
Computer simulations indicate that clustering of the
functionalized AuNPs is essential for detection
Colorimetric detection of SARS-CoV-2 virus using a smartphone app and a plasmonic biosensor
Materón et al, Unpublished
Detection in 5 min
17. 400 500 600 700
0.0
0.2
0.4
0.6
0.8
1.0
Absorbance
Wavelength (nm)
A
400 500 600 700 800
0.0
0.2
0.4
Absorbance
Wavelength (nm)
AuNp
avg_1
avg_2
avg_3
avg_4
avg_8
avg_16
avg_32
avg_69
B
636
526
2981
0
f-AuNPs with SARS-CoV-2 (0 - 2980 PFU mL-1). Spectral
absorption efficiency clusters (FDTD simulations).
Inactivated SARS-CoV-2 and tests
with human saliva.
Colorimetric detection of SARS-CoV-2 virus using a smartphone app and a plasmonic biosensor
Materón et al, Unpublished
Distinction of SARS-CoV-2 at various concentrations.
No effects from interferents
18. Elastic mechanochromic sensor
Color change
is reversible
Color changes
during stretching/releasing
cycles
Mechanochromic sensors
Works under sunlight and
under water
20. Machine Learning prediction
The CV system predicts deformation based on color change
Castro et al, Experts Systems with Applications, 2022
21. Data analysis and diagnostics
Materials design and discovery
Knowledge discovery
Machine learning and materials
“machine learning and
(chemistry or
materials discovery)”
• Students trained to interact with AI experts, and identify opportunities. No need to write
computer programs, but they should understand the concepts, limitations, risks of misuse.
• Students could be trained to use the software packages
• Students trained to use the software packages and write programs implementing ML algorithms.
22. Starting point: clustering of atomic species and structures. ML model to group structures
according to the possible composition, crystal point group, and local distortions.
ML strategy to determine and predict magnetism (step
I) in a 2D compound and specific magnetic ordering
(step II).
23. Two glasses discovered with machine learning and genetic algorithms from a database of 45,032 compositions:
Refractive index for Glass 1 and Glass 2: 1.713(1) and 1.749(1), within predicted values (1.71(3) and 1.76(3)).
They met the design properties (refractive index above 1.7 and a glass transition temperature below 500 °C).
Designing optical glasses by machine learning coupled with a genetic algorithm
Daniel R. Cassar, Gisele G. Santos, Edgar D. Zanotto, Ceramics International 47 (2021)
Predicted
Refractive index
Glass transition
temperature
Materials Discovery - Glass
25. Identify:
• Precursors (sludge, agriculture waste)
• Synthesis and post-synthesis methods
• Synthesis conditions
Find correlations:
• Most used precursors for agriculture, fuel, adsorbents
• Most efficient precursors for CFM production depending on the
synthesis method
• Optimized synthesis conditions depending on the precursors and
method
• CFM properties and possible applications
10,975 scientific articles
on carbon functional materials (CFM)
Knowledge Discovery in practice
26. Patient History
Repository
Preprocessing Data Mining
Diagnosis
Visualization
INPUT
Knowledge
Transformation
Discretization
Cleaning
Selection,
binarization,
...
Clustering
Classification
Regression,
...
Reports
Sensors
Images
Patient
History of
Patients
Holy Grail: Diagnostics in the future
Oliveira et al., Chem. Lett. Japan, 2014
27. The Fifth Paradigm
• 1st Empirical, descriptive
• 2nd Theory and experiment
• 3rd Theory, experiment, computer simulation
• 4th All of the above + Big Data
• 5th Machine-generated knowledge
29. Some Requirements
• Text analytics – large text databases
• Lots of data: experimental, theoretical (DFT, etc)
and simulation (MD, etc)
• Internet of Things
• Machine Learning Methods (Deep Learning, etc)
Computer-assisted diagnosis as an example
30. Machine learning will change the landscape of science and
technology in the XXI century.
In a few decades, most intellectual tasks will be better
performed by machines.
Is society being prepared for that?
The machines of the future
Final Recommendation/Provocation
• How would an intelligent machine solve the scientific problem you
are addressing?
• Are you sure the problem could not be obviated by other means?
31. ACS Applied Materials & Interfaces
ACS Applied Nano Materials
ACS Applied Polymer Materials
ACS Applied Energy Materials
ACS Applied Bio Materials
ACS Applied Electronic Materials
ACS Applied Optical Materials
ACS Applied Engineering Materials
Available for free
32. Acknowledgments
Roberto M. Faria, Débora Gonçalves, Paulo B. Miranda, Gregório C. Faria, Débora T. Balogh, Rafael M. Maki, Robson R.
Silva, Maria Cristina F. Oliveira, Fernando V. Paulovich, José F. Rodrigues Jr., Tácito A. Neves, Alexandre Delbem, Valtencir
Zucolotto, Frank N. Crespilho, Andrey C. Soares, Flávio M. Shimizu, Juliana C. Soares, Nirav Joshi, Gustavo F. Nascimento,
Valquíria C. R. Barioto, Paulo A. R. Pereira, Nathália O. Gomes, Sérgio A.S. Machado, Cristiane M. Daikuzono, Giovana
Rosso, Deivy Wilson, Rafael O. Pedro, Olívia Carr, Gisela Ibañez-Redin, Beatriz Tirich, Elsa M. Materón, Anderson M.
Campos, Lorenzo Buscaglia, Eder Cavalheiro, Lucas Ribas, Leonardo Scabini, Odemir M. Bruno, Luciano F. Costa, Sandra M.
Aluísio, Graça Nunes, Thiago A. Pardo, Diego R. Amancio, Filipi N. Silva, Daniel C. Braz, Lucas C. Castro, Faustino Reyez-
Gómez, José Luiz Bott, Thiago S. Martins, André Ponce de Leon Carvalho, Emanuel Carrilho (USP)
Carlos J.L. Constantino, Priscila Aléssio, Sabrina A. Camacho (FCT-Unesp), Luciano Caseli (Unifesp-Diadema), Pedro Aoki
(Unesp-Assis), Marystela Ferreira, Fábio L. Leite, Carolina Bueno, Jéssica Ierich, Cléber Dantas (UFSCar – Sorocaba), Caio G.
Otoni, Ronaldo C. Faria (UFSCar), Marli L. Moraes (Unifesp-SJ Campos), José R. Siqueira Jr. (UFTM-Uberaba), Antonio Riul
Jr, Monara Kaelle, Pedro Vieira, Varlei Rodrigues (Unicamp), Luiz H. C. Mattoso, João M. Naime, Rejane Trombini, Ednaldo
J. Ferreira, Paulo S.P. Herrmann, Daniel S. Corrêa (Embrapa), Hernane S. Barud (Uniara), Rafael R. Domeneguetti, Sidney J.
L. Ribeiro (Unesp, Araraquara), Ângelo L. Gobbi, Carlos Costa, Maria Helena Piazzetta (LNNano), Matias Melendez, Ana
Carolina Carvalho, Alexandre C. Santos, Eliney F. Faria, Lídia Rebolho Arantes, André L. Carvalho, Rui M. Reis (HCB),
Ricardo Azevedo (UnB)
Martin Taylor (Bangor, UK), Ricardo F. Aroca (Windsor, Canada), Maria Bardosova (Cork, Ireland), Dermot Diamond, Larisa
Florea (Dublin, Ireland), Alexandre Brolo (Victoria, Canada), Ana Barros (Aveiro, Portugal), Maria Raposo, Paulo A. Ribeiro,
Elvira Fortunato, Rodrigo Martins (Lisbon, Portugal)