Outlines and exemplified how bioinformatics is particularily well to facilitate the discovery of oligonucleotide drugs.
One hour talk I gave a Aalborg University in 2010.
WDR7 up-regulation upon knocking down of neighboring noncoding RNA using siRN...Vahid Erfani-Moghadam
1) The document examines the effect of silencing the long non-coding RNA lincRNA-RoR using siRNAs delivered by polyamidoamine dendrimers on the expression of the neighboring WDR7 gene in breast cancer cells.
2) The study showed that lincRNA-RoR expression was significantly decreased after transfection with siRNA encapsulated in PAMAM dendrimers. WDR7 expression correspondingly increased significantly upon lincRNA-RoR silencing.
3) This study demonstrates that PAMAM dendrimers can effectively deliver siRNAs to silence lincRNA-RoR and upregulate the adjacent WDR7 gene, suggesting their potential as a non-viral gene therapy vector
Functional Analysis of miRNA: miRNA and its Role in Human Disease Webinar Ser...QIAGEN
This slideshow highlights the use of miRNA mimics, inhibitors and target protectors to increase, decrease and adjust the cellular concentration of miRNA and disrupt specific miRNA–mRNA interactions. A ready-to-use screening tool for identifying miRNA targets and info on how to predict mRNA targets using miRNA expression data are also highlighted.
Presentation on host virus interaction(2008432018)Jahed Ahmed
The presentation discusses the role of microRNAs (miRNAs) in host-virus interactions and their implications. Human miRNAs can target conserved regions in viral genes, while some viruses encode miRNAs that may influence cellular processes and lead to oncogenesis. Analysis of miRNA levels in humans may serve as molecular markers for disease susceptibility and prognosis. The development of artificial miRNAs could provide a therapeutic approach for modulating viral infections.
Receptor targeted polyplexes for pdna and sirna delivery emadiElaheh Emadi- Andani
This document discusses receptor-targeted polyplexes for delivering plasmid DNA (pDNA) and small interfering RNA (siRNA). It describes the challenges of nucleic acid delivery, including degradation and immune responses. Nonviral vectors like polyplexes are formed through electrostatic interactions between nucleic acids and polymers. Cellular delivery involves binding ligands for targeting, endocytosis, endosomal escape, and intracellular trafficking. Strategies to improve delivery include PEGylation, proton sponge polymers, lysosomotropic agents, and fusogenic peptides. The document compares delivery methods and considers optimization of polyplex properties, targeting, and intracellular release.
1. siRNA and miRNA are types of non-coding RNAs that play important roles in post-transcriptional gene regulation. siRNA induces gene silencing through RNA interference, while miRNA binds to target mRNAs to inhibit translation.
2. Both siRNA and miRNA have shown promise in developing therapies for diseases like cancer, asthma, neurodegenerative disorders, and viral infections by silencing genes involved in disease pathways. Delivery methods continue to be improved to enhance their therapeutic potential.
3. The key differences between siRNA and miRNA are their biogenesis, targeting specificity, and mechanisms of gene regulation. siRNA is synthesized from long double-stranded RNA and can perfectly complement target mRNAs, while miRNA originates from
This document summarizes a study that prepared and characterized nanolipoparticles (NLPs) containing MDR1 siRNA for delivery to cancer cells. NLPs were produced using the detergent dialysis method with PEGylated lipids. The resulting NLPs were 80-90 nm in size with a neutral surface charge and over 80% siRNA encapsulation efficiency. In vitro studies showed the NLPs had low cytotoxicity and improved cellular uptake of siRNA compared to a commercial transfection agent. The document concludes that NLPs containing MDR1 siRNA may be a good candidate for further in vivo siRNA delivery studies aimed at reversing multidrug resistance in cancer therapy.
SiRNA Delivery for Cancer Therapy: Challenges and Future Perspective by Suvadeep Sen in Advancements in Bioequivalence & Bioavailability
https://crimsonpublishers.com/abb/fulltext/ABB.000518.php
Meeting the challenges of miRNA research: miRNA and its Role in Human Disease...QIAGEN
This document discusses a 4-part webinar series on microRNA (miRNA) research presented by QIAGEN. Part 1 will cover miRNA profiling from biofluids, part 2 will discuss challenges in miRNA research, part 3 will focus on advanced miRNA expression analysis, and part 4 will analyze functional analysis of miRNA. The document provides background on miRNAs and their role in gene expression and disease. It also describes QIAGEN products and solutions for miRNA sample preparation, real-time PCR, data analysis, and functional validation to help researchers overcome challenges in miRNA analysis.
WDR7 up-regulation upon knocking down of neighboring noncoding RNA using siRN...Vahid Erfani-Moghadam
1) The document examines the effect of silencing the long non-coding RNA lincRNA-RoR using siRNAs delivered by polyamidoamine dendrimers on the expression of the neighboring WDR7 gene in breast cancer cells.
2) The study showed that lincRNA-RoR expression was significantly decreased after transfection with siRNA encapsulated in PAMAM dendrimers. WDR7 expression correspondingly increased significantly upon lincRNA-RoR silencing.
3) This study demonstrates that PAMAM dendrimers can effectively deliver siRNAs to silence lincRNA-RoR and upregulate the adjacent WDR7 gene, suggesting their potential as a non-viral gene therapy vector
Functional Analysis of miRNA: miRNA and its Role in Human Disease Webinar Ser...QIAGEN
This slideshow highlights the use of miRNA mimics, inhibitors and target protectors to increase, decrease and adjust the cellular concentration of miRNA and disrupt specific miRNA–mRNA interactions. A ready-to-use screening tool for identifying miRNA targets and info on how to predict mRNA targets using miRNA expression data are also highlighted.
Presentation on host virus interaction(2008432018)Jahed Ahmed
The presentation discusses the role of microRNAs (miRNAs) in host-virus interactions and their implications. Human miRNAs can target conserved regions in viral genes, while some viruses encode miRNAs that may influence cellular processes and lead to oncogenesis. Analysis of miRNA levels in humans may serve as molecular markers for disease susceptibility and prognosis. The development of artificial miRNAs could provide a therapeutic approach for modulating viral infections.
Receptor targeted polyplexes for pdna and sirna delivery emadiElaheh Emadi- Andani
This document discusses receptor-targeted polyplexes for delivering plasmid DNA (pDNA) and small interfering RNA (siRNA). It describes the challenges of nucleic acid delivery, including degradation and immune responses. Nonviral vectors like polyplexes are formed through electrostatic interactions between nucleic acids and polymers. Cellular delivery involves binding ligands for targeting, endocytosis, endosomal escape, and intracellular trafficking. Strategies to improve delivery include PEGylation, proton sponge polymers, lysosomotropic agents, and fusogenic peptides. The document compares delivery methods and considers optimization of polyplex properties, targeting, and intracellular release.
1. siRNA and miRNA are types of non-coding RNAs that play important roles in post-transcriptional gene regulation. siRNA induces gene silencing through RNA interference, while miRNA binds to target mRNAs to inhibit translation.
2. Both siRNA and miRNA have shown promise in developing therapies for diseases like cancer, asthma, neurodegenerative disorders, and viral infections by silencing genes involved in disease pathways. Delivery methods continue to be improved to enhance their therapeutic potential.
3. The key differences between siRNA and miRNA are their biogenesis, targeting specificity, and mechanisms of gene regulation. siRNA is synthesized from long double-stranded RNA and can perfectly complement target mRNAs, while miRNA originates from
This document summarizes a study that prepared and characterized nanolipoparticles (NLPs) containing MDR1 siRNA for delivery to cancer cells. NLPs were produced using the detergent dialysis method with PEGylated lipids. The resulting NLPs were 80-90 nm in size with a neutral surface charge and over 80% siRNA encapsulation efficiency. In vitro studies showed the NLPs had low cytotoxicity and improved cellular uptake of siRNA compared to a commercial transfection agent. The document concludes that NLPs containing MDR1 siRNA may be a good candidate for further in vivo siRNA delivery studies aimed at reversing multidrug resistance in cancer therapy.
SiRNA Delivery for Cancer Therapy: Challenges and Future Perspective by Suvadeep Sen in Advancements in Bioequivalence & Bioavailability
https://crimsonpublishers.com/abb/fulltext/ABB.000518.php
Meeting the challenges of miRNA research: miRNA and its Role in Human Disease...QIAGEN
This document discusses a 4-part webinar series on microRNA (miRNA) research presented by QIAGEN. Part 1 will cover miRNA profiling from biofluids, part 2 will discuss challenges in miRNA research, part 3 will focus on advanced miRNA expression analysis, and part 4 will analyze functional analysis of miRNA. The document provides background on miRNAs and their role in gene expression and disease. It also describes QIAGEN products and solutions for miRNA sample preparation, real-time PCR, data analysis, and functional validation to help researchers overcome challenges in miRNA analysis.
Insilico & Genomics Approaches for the Characterization of Abiotic Stress ...rishiraj1992
This document discusses insilico and genomics approaches for characterizing microRNAs responsive to abiotic stress. It describes microRNA nomenclature, conserved microRNAs involved in stress response in plants like Arabidopsis, and differentially expressed wheat miRNAs under heat stress. It discusses mechanisms of microRNA action in plants, computational tools for microRNA prediction and target prediction, and methodologies used in microRNA sequencing and validation experiments including novel microRNA discovery and differential expression analysis. Two case studies analyzing drought responsive genes in rice through clustering based on epigenetic features and miRNA targeting are also summarized.
- MicroRNAs (miRNAs) are small non-coding RNAs that regulate gene expression through base pairing with messenger RNA (mRNA) molecules. They are encoded in the genome and are abundant in many human cell types.
- miRNAs play a vital role in genetic regulation and are involved in most biological processes. Aberrant miRNA expression has been implicated in many diseases.
- miRNAs are initially transcribed as long primary transcripts that are processed in the nucleus by the Drosha enzyme into hairpin-shaped precursor miRNAs. These are then exported into the cytoplasm and further processed by the Dicer enzyme into mature miRNAs that can regulate gene expression through pairing with mRNAs.
A descoberta da capacidade de certos RNAs serem capazes de bloquear o RNA mensageiro (por serem complementares base a base) há alguns anos,abriu as portas do tratamento de inibição da expressão nucleica de proteínas anormais, responsáveis por doenças. Agora, surgem os miRNA que são produzidos em introns ou exons de gens formadores de proteínas. Estão relacionados ao câncer e diabetes.
This document discusses microRNAs (miRNAs), which are 22 nucleotide non-coding RNAs that play important regulatory roles in plants. miRNAs are processed from stem-loop precursors by the enzyme Dicer and mediate post-transcriptional gene silencing by guiding mRNA cleavage or translational repression. Bioinformatic and genetic studies have identified many conserved miRNA families in plants and shown that miRNAs regulate key transcription factors to control developmental processes.
This document summarizes the role of microRNAs (miRNAs) in host-virus interactions. It discusses that miRNAs are small non-coding RNAs encoded by both hosts and viruses that regulate gene expression. Viruses like herpesviruses encode miRNAs that can regulate viral latency, prevent apoptosis, evade the immune system, and alter the cell cycle. Cellular miRNAs can also impact viral replication by restricting or enhancing viruses. The applications of viral and cellular miRNAs include attenuated vaccines, oncolytic virotherapy, determining cell tropism, and antiviral drug development. While progress has been made, further research is still needed to fully understand viral and host miRNA functions in their complex interactions.
An introduction to RNAi technology - Petr Svoboda - Institute of Molecular Ge...OECD Environment
10-12 April 2019: The OECD Conference on RNAi based pesticides provided an overview on the current status and future possibilities for the regulation of externally applied dsRNA-based products that are proposed for use as pesticides. The event facilitated exchanges between policy makers, academia, industry on their implications in health, environment, and regulation.
This document discusses SH RNA and SI RNA techniques for gene silencing. SH RNA (short hairpin RNA) involves introducing short hairpin RNA molecules into cells to silence target genes, while SI RNA (short interfering RNA) introduces short double-stranded RNA molecules to interfere with gene expression. Both techniques use RNA interference to down regulate particular genes. The document outlines the applications of SH RNA and SI RNA, and notes that while SI RNA has advantages like being cost effective and specific, both techniques face challenges for gene therapy like potential immune responses and off-target effects of silencing other genes.
This document discusses RNA-RNA cross talk through competing endogenous RNAs (ceRNAs). It explains that protein-coding and non-coding RNA transcripts can act as endogenous miRNA sponges or ceRNAs by competing for shared miRNAs. Many types of RNAs can have ceRNA activity, including pseudogenes, lncRNAs, circRNAs, and mRNAs. Effective ceRNA interaction depends on factors like miRNA and ceRNA expression levels, number of shared miRNA binding sites, and binding affinity. RNA editing and changes in ceRNA regulation can contribute to human disease.
RNAi and microRNA-mediated gene regulationBrianna Bibel
The document discusses RNA interference and microRNA, which are types of small non-coding RNAs that regulate gene expression through translational inhibition or degradation of target messenger RNAs. Small interfering RNAs and microRNAs are produced from precursor molecules through a biogenesis pathway involving the enzymes Dicer and the Microprocessor complex, and are then loaded onto an Argonaute protein within the RNA-induced silencing complex to target messenger RNAs with either perfect or partial complementarity, leading to repression of gene expression.
1) The document summarizes antisense RNA technology, which involves producing RNA sequences that are complementary to target mRNAs to inhibit gene expression.
2) Two case studies are described where antisense RNA was used to suppress ethylene biosynthesis genes (ACC oxidase) in orchids and carnations, extending their vase life.
3) The technology has potential applications in crop improvement by extending shelf life and improving traits like fruit ripening and flower longevity.
This document discusses microRNAs (miRNAs), which are small non-coding RNAs that regulate gene expression. It describes several strategies to inhibit oncogenic miRNAs that are overexpressed in tumors, including anti-miRNA oligonucleotides, miRNA antagomirs, and miRNA sponges. Lentiviral vectors derived from HIV-1 can be used to deliver short hairpin RNAs, miRNAs, or genes into cells. Several tumor suppressor miRNAs (miR-145, miR-34a, miR-29b, Let-7a, miR-340, miR495) and oncogenic miRNAs (miR155, miR-21) are described along with their gene targets and the results of in
Small interfering RNAs (siRNAs) can silence gene expression through RNA interference and show promise for breast cancer therapy. siRNAs are non-coding RNAs that can regulate genes post-transcriptionally. For breast cancer treatment, potential siRNA targets include genes involved in estrogen receptor expression and signaling like HER2, NFAT3, and other cofactors. Effective delivery of siRNAs to breast cancer cells remains a challenge but is being explored through various modes of administration. siRNA therapy holds potential as a new method of gene therapy for cancers like breast cancer in the future.
MicroRNAs (miRNAs) are small non-coding RNAs that play important gene regulatory roles in eukaryotic cells. They are approximately 22 nucleotides in length and are transcribed from independent genes or introns, then processed through a biogenesis pathway before targeting mRNAs for silencing or degradation. MiRNAs regulate genes involved in development, metabolism, and diseases like cancer. Their expression and function is tightly controlled through transcriptional and post-transcriptional mechanisms in order to influence protein expression levels. While much progress has been made in understanding miRNAs, further study is still needed to elucidate their complex regulatory networks and roles in development and disease.
Mirna biogenesis, mechanism of action, isolation protocol, and quantification...SAIMA BARKI
The document discusses miRNA biogenesis, isolation, quantification, and applications. It describes how miRNAs are noncoding RNAs that regulate gene expression post-transcriptionally through imperfect base pairing. Several methods are discussed for isolating miRNAs from different sample types like plasma, urine, and cells using specific kits or a single optimized protocol. Quantitative PCR methods for miRNA quantification and their advantages are also summarized, including using stem-loop primers and S-poly(T) primers which provide accurate, specific and sensitive results. In conclusion, the choice of sample and isolation/quantification method depends on the research needs and available protocols/kits, and miRNAs have potential as novel diagnostic and therapeutic targets.
Integrative transcriptomics to study non-coding RNA functionsMaté Ongenaert
Integrative transcriptomics to study non-coding RNA functions
by dr. ir. Pieter Mestdagh - Center for Medical Genetics, Ghent University
Over the last years, non-coding RNAs (e.g. microRNAs and long non-coding RNAs) have emerged as an important layer of the transcriptome. In order to elucidate their function in disease biology, multiple tools have been developed, ranging from miRNA target prediction algorithms to the more advanced integrative genomics approaches. Through the combination of multiple layers of information, integrative genomics allows a more accurate and comprehensive assessment of non-coding RNA functions in human disease. In this presentation, I will discuss different approaches on how to combine multi-level transcriptome data in order to functionally characterize non-coding RNA networks.
This document discusses antisense RNA and DNA technology. It explains that antisense works by introducing short DNA or RNA sequences that are complementary to target mRNA, preventing translation into protein. This can inhibit genetic disorders caused by mutated proteins. The document provides examples of using antisense to treat diseases like cancer and viruses. It describes various methods of delivering antisense sequences into cells and notes that while promising, most antisense therapies have yet to produce significant clinical results, though one was approved by the FDA to treat cytomegalovirus retinitis.
RNA interference (RNAi):A therapeutic strategy for aquacultureidrish123
The document discusses RNA interference (RNAi) as a therapeutic strategy for aquaculture. It describes how RNAi works through a two-step mechanism involving initiation by the enzyme Dicer and effector stage involving the RISC complex. Some successful implementations of RNAi in aquaculture are presented, including reducing mortality from WSSV in shrimp through intramuscular injection of siRNA. The document outlines developing RNAi therapies and applications in aquaculture but also notes limitations such as effective delivery and off-target effects that require further study.
This research article examines how the virus Kaposi's sarcoma-associated herpesvirus (KSHV) regulates microRNA (miRNA) biogenesis in host cells. The researchers found that:
1) MCPIP1, a human protein, can directly cleave precursor miRNAs (pre-miRNAs) from KSHV, EBV, and human miRNAs in vitro.
2) Following KSHV infection, MCPIP1 expression is repressed while the expression of key miRNA processing proteins Dicer and TRBP are increased.
3) KSHV miRNAs can target the 3'UTR of MCPIP1, repressing its expression. Conversely, KSHV infection upreg
Gene silencing is a method of regulating gene expression to reduce or prevent the expression of certain genes. It can occur during transcription or translation and is often used in research. Methods of gene silencing like RNAi, CRISPR, and siRNA are being researched as potential therapeutics for diseases. Gene silencing reduces gene expression by at least 70% but does not eliminate it entirely, allowing study of essential genes. RNA interference is a common method of gene silencing that uses small interfering RNAs or microRNAs to regulate gene expression.
RNA Drugs Informatics - 90 min lecture with questionsMorten Lindow
The document discusses RNA-directed drugs from a bioinformatics perspective. It begins by outlining the goals of explaining the rationale for RNA-directed drugs, differences from traditional small molecules, roles of bioinformatics in sequence analysis and target detection. It then describes locked nucleic acids (LNA) and how they improve oligonucleotide drug properties. Different classes of RNA-directed drugs like siRNA, gapmers and mixmers are also discussed. The document touches on using expression data to increase statistical power by analyzing gene groups. It provides examples of metabolic targets like ApoB and PCSK9 being targeted with gapmers, and miR-122 being targeted to reduce HCV and cholesterol levels. Combining expression data with target prediction and pathway
This document discusses microRNAs (miRNAs) and methods for studying their function and regulation of genes. It describes:
1) What miRNAs are, how they work by incorporating into the RISC complex and repressing target mRNAs through translational repression or degradation.
2) Techniques for manipulating miRNAs in cell lines using reporter assays, mimics, inhibitors and target protectors to study their effects on genes.
3) How to screen for miRNAs that regulate a target gene using ready-made cDNA panels and quantitative PCR. Several examples are provided of identifying miRNAs that regulate important cancer genes.
Insilico & Genomics Approaches for the Characterization of Abiotic Stress ...rishiraj1992
This document discusses insilico and genomics approaches for characterizing microRNAs responsive to abiotic stress. It describes microRNA nomenclature, conserved microRNAs involved in stress response in plants like Arabidopsis, and differentially expressed wheat miRNAs under heat stress. It discusses mechanisms of microRNA action in plants, computational tools for microRNA prediction and target prediction, and methodologies used in microRNA sequencing and validation experiments including novel microRNA discovery and differential expression analysis. Two case studies analyzing drought responsive genes in rice through clustering based on epigenetic features and miRNA targeting are also summarized.
- MicroRNAs (miRNAs) are small non-coding RNAs that regulate gene expression through base pairing with messenger RNA (mRNA) molecules. They are encoded in the genome and are abundant in many human cell types.
- miRNAs play a vital role in genetic regulation and are involved in most biological processes. Aberrant miRNA expression has been implicated in many diseases.
- miRNAs are initially transcribed as long primary transcripts that are processed in the nucleus by the Drosha enzyme into hairpin-shaped precursor miRNAs. These are then exported into the cytoplasm and further processed by the Dicer enzyme into mature miRNAs that can regulate gene expression through pairing with mRNAs.
A descoberta da capacidade de certos RNAs serem capazes de bloquear o RNA mensageiro (por serem complementares base a base) há alguns anos,abriu as portas do tratamento de inibição da expressão nucleica de proteínas anormais, responsáveis por doenças. Agora, surgem os miRNA que são produzidos em introns ou exons de gens formadores de proteínas. Estão relacionados ao câncer e diabetes.
This document discusses microRNAs (miRNAs), which are 22 nucleotide non-coding RNAs that play important regulatory roles in plants. miRNAs are processed from stem-loop precursors by the enzyme Dicer and mediate post-transcriptional gene silencing by guiding mRNA cleavage or translational repression. Bioinformatic and genetic studies have identified many conserved miRNA families in plants and shown that miRNAs regulate key transcription factors to control developmental processes.
This document summarizes the role of microRNAs (miRNAs) in host-virus interactions. It discusses that miRNAs are small non-coding RNAs encoded by both hosts and viruses that regulate gene expression. Viruses like herpesviruses encode miRNAs that can regulate viral latency, prevent apoptosis, evade the immune system, and alter the cell cycle. Cellular miRNAs can also impact viral replication by restricting or enhancing viruses. The applications of viral and cellular miRNAs include attenuated vaccines, oncolytic virotherapy, determining cell tropism, and antiviral drug development. While progress has been made, further research is still needed to fully understand viral and host miRNA functions in their complex interactions.
An introduction to RNAi technology - Petr Svoboda - Institute of Molecular Ge...OECD Environment
10-12 April 2019: The OECD Conference on RNAi based pesticides provided an overview on the current status and future possibilities for the regulation of externally applied dsRNA-based products that are proposed for use as pesticides. The event facilitated exchanges between policy makers, academia, industry on their implications in health, environment, and regulation.
This document discusses SH RNA and SI RNA techniques for gene silencing. SH RNA (short hairpin RNA) involves introducing short hairpin RNA molecules into cells to silence target genes, while SI RNA (short interfering RNA) introduces short double-stranded RNA molecules to interfere with gene expression. Both techniques use RNA interference to down regulate particular genes. The document outlines the applications of SH RNA and SI RNA, and notes that while SI RNA has advantages like being cost effective and specific, both techniques face challenges for gene therapy like potential immune responses and off-target effects of silencing other genes.
This document discusses RNA-RNA cross talk through competing endogenous RNAs (ceRNAs). It explains that protein-coding and non-coding RNA transcripts can act as endogenous miRNA sponges or ceRNAs by competing for shared miRNAs. Many types of RNAs can have ceRNA activity, including pseudogenes, lncRNAs, circRNAs, and mRNAs. Effective ceRNA interaction depends on factors like miRNA and ceRNA expression levels, number of shared miRNA binding sites, and binding affinity. RNA editing and changes in ceRNA regulation can contribute to human disease.
RNAi and microRNA-mediated gene regulationBrianna Bibel
The document discusses RNA interference and microRNA, which are types of small non-coding RNAs that regulate gene expression through translational inhibition or degradation of target messenger RNAs. Small interfering RNAs and microRNAs are produced from precursor molecules through a biogenesis pathway involving the enzymes Dicer and the Microprocessor complex, and are then loaded onto an Argonaute protein within the RNA-induced silencing complex to target messenger RNAs with either perfect or partial complementarity, leading to repression of gene expression.
1) The document summarizes antisense RNA technology, which involves producing RNA sequences that are complementary to target mRNAs to inhibit gene expression.
2) Two case studies are described where antisense RNA was used to suppress ethylene biosynthesis genes (ACC oxidase) in orchids and carnations, extending their vase life.
3) The technology has potential applications in crop improvement by extending shelf life and improving traits like fruit ripening and flower longevity.
This document discusses microRNAs (miRNAs), which are small non-coding RNAs that regulate gene expression. It describes several strategies to inhibit oncogenic miRNAs that are overexpressed in tumors, including anti-miRNA oligonucleotides, miRNA antagomirs, and miRNA sponges. Lentiviral vectors derived from HIV-1 can be used to deliver short hairpin RNAs, miRNAs, or genes into cells. Several tumor suppressor miRNAs (miR-145, miR-34a, miR-29b, Let-7a, miR-340, miR495) and oncogenic miRNAs (miR155, miR-21) are described along with their gene targets and the results of in
Small interfering RNAs (siRNAs) can silence gene expression through RNA interference and show promise for breast cancer therapy. siRNAs are non-coding RNAs that can regulate genes post-transcriptionally. For breast cancer treatment, potential siRNA targets include genes involved in estrogen receptor expression and signaling like HER2, NFAT3, and other cofactors. Effective delivery of siRNAs to breast cancer cells remains a challenge but is being explored through various modes of administration. siRNA therapy holds potential as a new method of gene therapy for cancers like breast cancer in the future.
MicroRNAs (miRNAs) are small non-coding RNAs that play important gene regulatory roles in eukaryotic cells. They are approximately 22 nucleotides in length and are transcribed from independent genes or introns, then processed through a biogenesis pathway before targeting mRNAs for silencing or degradation. MiRNAs regulate genes involved in development, metabolism, and diseases like cancer. Their expression and function is tightly controlled through transcriptional and post-transcriptional mechanisms in order to influence protein expression levels. While much progress has been made in understanding miRNAs, further study is still needed to elucidate their complex regulatory networks and roles in development and disease.
Mirna biogenesis, mechanism of action, isolation protocol, and quantification...SAIMA BARKI
The document discusses miRNA biogenesis, isolation, quantification, and applications. It describes how miRNAs are noncoding RNAs that regulate gene expression post-transcriptionally through imperfect base pairing. Several methods are discussed for isolating miRNAs from different sample types like plasma, urine, and cells using specific kits or a single optimized protocol. Quantitative PCR methods for miRNA quantification and their advantages are also summarized, including using stem-loop primers and S-poly(T) primers which provide accurate, specific and sensitive results. In conclusion, the choice of sample and isolation/quantification method depends on the research needs and available protocols/kits, and miRNAs have potential as novel diagnostic and therapeutic targets.
Integrative transcriptomics to study non-coding RNA functionsMaté Ongenaert
Integrative transcriptomics to study non-coding RNA functions
by dr. ir. Pieter Mestdagh - Center for Medical Genetics, Ghent University
Over the last years, non-coding RNAs (e.g. microRNAs and long non-coding RNAs) have emerged as an important layer of the transcriptome. In order to elucidate their function in disease biology, multiple tools have been developed, ranging from miRNA target prediction algorithms to the more advanced integrative genomics approaches. Through the combination of multiple layers of information, integrative genomics allows a more accurate and comprehensive assessment of non-coding RNA functions in human disease. In this presentation, I will discuss different approaches on how to combine multi-level transcriptome data in order to functionally characterize non-coding RNA networks.
This document discusses antisense RNA and DNA technology. It explains that antisense works by introducing short DNA or RNA sequences that are complementary to target mRNA, preventing translation into protein. This can inhibit genetic disorders caused by mutated proteins. The document provides examples of using antisense to treat diseases like cancer and viruses. It describes various methods of delivering antisense sequences into cells and notes that while promising, most antisense therapies have yet to produce significant clinical results, though one was approved by the FDA to treat cytomegalovirus retinitis.
RNA interference (RNAi):A therapeutic strategy for aquacultureidrish123
The document discusses RNA interference (RNAi) as a therapeutic strategy for aquaculture. It describes how RNAi works through a two-step mechanism involving initiation by the enzyme Dicer and effector stage involving the RISC complex. Some successful implementations of RNAi in aquaculture are presented, including reducing mortality from WSSV in shrimp through intramuscular injection of siRNA. The document outlines developing RNAi therapies and applications in aquaculture but also notes limitations such as effective delivery and off-target effects that require further study.
This research article examines how the virus Kaposi's sarcoma-associated herpesvirus (KSHV) regulates microRNA (miRNA) biogenesis in host cells. The researchers found that:
1) MCPIP1, a human protein, can directly cleave precursor miRNAs (pre-miRNAs) from KSHV, EBV, and human miRNAs in vitro.
2) Following KSHV infection, MCPIP1 expression is repressed while the expression of key miRNA processing proteins Dicer and TRBP are increased.
3) KSHV miRNAs can target the 3'UTR of MCPIP1, repressing its expression. Conversely, KSHV infection upreg
Gene silencing is a method of regulating gene expression to reduce or prevent the expression of certain genes. It can occur during transcription or translation and is often used in research. Methods of gene silencing like RNAi, CRISPR, and siRNA are being researched as potential therapeutics for diseases. Gene silencing reduces gene expression by at least 70% but does not eliminate it entirely, allowing study of essential genes. RNA interference is a common method of gene silencing that uses small interfering RNAs or microRNAs to regulate gene expression.
RNA Drugs Informatics - 90 min lecture with questionsMorten Lindow
The document discusses RNA-directed drugs from a bioinformatics perspective. It begins by outlining the goals of explaining the rationale for RNA-directed drugs, differences from traditional small molecules, roles of bioinformatics in sequence analysis and target detection. It then describes locked nucleic acids (LNA) and how they improve oligonucleotide drug properties. Different classes of RNA-directed drugs like siRNA, gapmers and mixmers are also discussed. The document touches on using expression data to increase statistical power by analyzing gene groups. It provides examples of metabolic targets like ApoB and PCSK9 being targeted with gapmers, and miR-122 being targeted to reduce HCV and cholesterol levels. Combining expression data with target prediction and pathway
This document discusses microRNAs (miRNAs) and methods for studying their function and regulation of genes. It describes:
1) What miRNAs are, how they work by incorporating into the RISC complex and repressing target mRNAs through translational repression or degradation.
2) Techniques for manipulating miRNAs in cell lines using reporter assays, mimics, inhibitors and target protectors to study their effects on genes.
3) How to screen for miRNAs that regulate a target gene using ready-made cDNA panels and quantitative PCR. Several examples are provided of identifying miRNAs that regulate important cancer genes.
MiRaGE: Inference of gene expression regulation via microRNA transfection IIY-h Taguchi
This document describes the MiRaGE method for inferring gene expression regulation via microRNA transfection. MiRaGE ranks microRNAs based on the expression levels of their predicted target genes after transfection. It compares target gene expression between control and treated samples and calculates significance values and false discovery rates. The method was tested on human lung cancer cells transfected with miR-107, miR-185, and let-7a, correctly identifying the transfected microRNAs as the top regulators after 1 and 3 days. A MiRaGE web server and database are now available to perform and collect miRNA regulation inferences.
This document summarizes research into measuring the inhibition of miRNAs by antimiRs. It finds that using interference (loss of miRNA detection signal) as a measure of inhibition can be misleading. For some miRNA-antimiR pairs like miR-122, interference underestimates inhibition, but for miR-21 it overestimates due to positive interference where the antimiR increases detection of the miRNA. The magnitude of interference does not correlate with the actual proportion of free vs bound miRNA as seen by gel electrophoresis. Overall, interference is not an accurate measure of the amount of miRNA inhibition achieved by antimiRs.
Single-cell microRNA expression profiling is a challenging workflow. From cell lysis, reverse transcription, preamplificatin to real-time PCR, every step involves technical pitfalls. Therefore it is critical to have a robust system that facilitates universal cDNA synthesis and universal amplification of all miRNAs in one workflow without introducing bias. Here we present a new poster – introducing a robust real-time PCR workflow and protocol for profiling miRNA expression from a single cell and how we analyze the single cells by using the free data analysis software.
RNA interference (RNAi) is a mechanism where double-stranded RNA inhibits gene expression. It was discovered in plants, fungi, and animals. The mechanism involves dicer enzymes cleaving long double-stranded RNA into short interfering RNAs (siRNAs). These siRNAs are incorporated into an RNA-induced silencing complex (RISC) which guides the complex to mRNAs with complementary sequences, resulting in their degradation. RNAi has applications in therapeutics for cancer, viruses, and genetic disorders, as well as research in gene function and pathways.
Introduction:
RNA interference (RNAi) or Post-Transcriptional Gene Silencing (PTGS) is an important biological process for modulating eukaryotic gene expression.
It is highly conserved process of posttranscriptional gene silencing by which double stranded RNA (dsRNA) causes sequence-specific degradation of mRNA sequences.
dsRNA-induced gene silencing (RNAi) is reported in a wide range of eukaryotes ranging from worms, insects, mammals and plants.
This process mediates resistance to both endogenous parasitic and exogenous pathogenic nucleic acids, and regulates the expression of protein-coding genes.
What are small ncRNAs?
micro RNA (miRNA)
short interfering RNA (siRNA)
Properties of small non-coding RNA:
Involved in silencing mRNA transcripts.
Called “small” because they are usually only about 21-24 nucleotides long.
Synthesized by first cutting up longer precursor sequences (like the 61nt one that Lee discovered).
Silence an mRNA by base pairing with some sequence on the mRNA.
Discovery of siRNA?
The first small RNA:
In 1993 Rosalind Lee (Victor Ambros lab) was studying a non- coding gene in C. elegans, lin-4, that was involved in silencing of another gene, lin-14, at the appropriate time in the
development of the worm C. elegans.
Two small transcripts of lin-4 (22nt and 61nt) were found to be complementary to a sequence in the 3' UTR of lin-14.
Because lin-4 encoded no protein, she deduced that it must be these transcripts that are causing the silencing by RNA-RNA interactions.
Types of RNAi ( non coding RNA)
MiRNA
Length (23-25 nt)
Trans acting
Binds with target MRNA in mismatch
Translation inhibition
Si RNA
Length 21 nt.
Cis acting
Bind with target Mrna in perfect complementary sequence
Piwi-RNA
Length ; 25 to 36 nt.
Expressed in Germ Cells
Regulates trnasposomes activity
MECHANISM OF RNAI:
First the double-stranded RNA teams up with a protein complex named Dicer, which cuts the long RNA into short pieces.
Then another protein complex called RISC (RNA-induced silencing complex) discards one of the two RNA strands.
The RISC-docked, single-stranded RNA then pairs with the homologous mRNA and destroys it.
THE RISC COMPLEX:
RISC is large(>500kD) RNA multi- protein Binding complex which triggers MRNA degradation in response to MRNA
Unwinding of double stranded Si RNA by ATP independent Helicase
Active component of RISC is Ago proteins( ENDONUCLEASE) which cleave target MRNA.
DICER: endonuclease (RNase Family III)
Argonaute: Central Component of the RNA-Induced Silencing Complex (RISC)
One strand of the dsRNA produced by Dicer is retained in the RISC complex in association with Argonaute
ARGONAUTE PROTEIN :
1.PAZ(PIWI/Argonaute/ Zwille)- Recognition of target MRNA
2.PIWI (p-element induced wimpy Testis)- breaks Phosphodiester bond of mRNA.)RNAse H activity.
MiRNA:
The Double-stranded RNAs are naturally produced in eukaryotic cells during development, and they have a key role in regulating gene expression .
This document describes miScript miRNA PCR Arrays, which allow for the simultaneous detection of genome-wide or pathway-focused microRNA (miRNA) expression. It provides an overview of miRNA biology and research, details the miScript miRNA PCR Array system workflow from isolation to data analysis, and discusses applications in cancer research, development, differentiation, and genome-wide discovery. The system offers validated miRNA assays, controls, and optimized reagents to enable reproducible and reliable miRNA expression profiling from RNA samples.
Micro RNARNA INTERFERENCE AND ITS APPLICATIONS IN CROP IMPROVE...SANIVARAPUNAGALAKSHM
This document provides an overview of RNA interference (RNAi) and its applications in crop improvement. It discusses the history and discovery of RNAi, the mechanism of RNAi involving initiation by Dicer and effector function of RISC complexes, and methods of transforming plants with RNAi constructs. Applications of RNAi described in the document include modifying traits in rice, maize, barley, cotton, jute, tomato, lathyris, and coffee to improve nutritional quality, increase yields, confer virus resistance, and remove toxic compounds.
RNA silencing/RNAi involves the knock-down of genes through two types of small RNA molecules, miRNAs and siRNAs, that are involved in post-transcriptional and transcriptional gene silencing as an antiviral mechanism; short double-stranded RNAs are processed by the Dicer enzyme into siRNAs which are incorporated into the RISC complex to guide degradation of homologous mRNA targets; RNAi is an important endogenous gene regulatory mechanism and has applications in gene function analysis, gene therapy, and cancer treatment.
Total RNA Discovery for RNA Biomarker Development WebinarQIAGEN
Precision medicine offers to transform patient care by targeting treatment to those with most to gain. To date the most significant advances have been at the level of DNA, for example, the use of somatic DNA alterations as diagnostic indicators of disease and for prediction of pharmacodynamic response. Development of RNA expression signatures as biomarkers has been more problematic. While RNA expression analysis has yielded valuable insights into the biological mechanisms of disease, RNA is a more unstable molecule than DNA, and more easily damaged or degraded during sample collection and isolation. In addition, RNA levels are inherently dynamic and gene expression signatures are extraordinarily complex. Recently, much progress has been made in identifying key changes in gene expression in cancer and other diseases, as well as identifying expression signatures in circulating nucleic acid that have the potential to be developed into diagnostic and prognostic indicators.
This presentation provides an overview of RNA interference (RNAi) including its history, components, mechanism, advantages, and applications. It discusses how RNAi involves long double-stranded RNAs being cut by the enzyme Dicer into short interfering RNAs (siRNAs) that then guide the RNA-induced silencing complex (RISC) to degrade messenger RNAs with complementary base sequences, preventing gene expression. The presentation also compares siRNAs and microRNAs (miRNAs), noting similarities in their biogenesis and roles in post-transcriptional gene silencing, while distinguishing their origins, sizes, targets, and effects on mRNA. Recent applications of RNAi modulation of viral replication and gene expression are highlighted.
QIAGEN provides solutions for miRNA purification, quantification, and functional analysis. This includes miRNA purification kits, miRNA expression profiling tools like miScript miRNA PCR Arrays, and products for studying miRNA biogenesis and regulation. The miScript PCR System allows sensitive quantification and profiling of miRNA expression using real-time PCR. miScript miRNA PCR Arrays enable rapid profiling of mature miRNAs in miRNome and pathway-focused panels.
Antisense RNA technology & its role in crop improvement ppt surendra singhDrSurendraSingh2
This document discusses antisense RNA technology and its role in crop improvement. It begins by introducing antisense RNA as a method for inhibiting gene expression through complementary base pairing. It then discusses various applications of antisense RNA technology in crop improvement, including delaying fruit ripening in tomato and flower senescence in carnation, producing male sterility in petunia, and reducing neurotoxins in crops like khesari. The document concludes by noting that antisense RNA technology is an efficient gene knockdown method that could be useful for genetic improvement in many plant species.
This document discusses developing anticancer compounds that target microRNAs (miRNAs).
It begins by explaining what miRNAs are and how their abnormal levels in tumors can contribute to cancer development. It then discusses how certain miRNAs like miR-21 are overexpressed in many cancer types and can act as oncogenes.
The document reviews several approaches to target miRNAs for cancer treatment, including MRX34 which is a miRNA-34a mimic drug. It also discusses developing new bi-functional inhibitors of the oncogenic miR-21 by linking a pre-miR-21 binding unit to a dicer inhibitor unit.
One such compound named Compound 12 is synthesized and shown to effectively inhibit miR-21 maturation in
This is a presentation slide about cellular RNA interference process and RNA interference technology. Contains basic information about biology of cellular RNA interference processes and its discovery, and RNA interference technology. Also gives you the history and development of in-vitro and in-vivo technologies for applicability of RNA interference technology.
siRNA synthesis, siRNA libraries, siRNA delivering techniques, Electroporation, viral transfection methods, Advantages and disadvantages of RNA interference technology.
details about the preliminary and pre-clinical experiments of RNA interference as well as clinical trials of RNA interference.
This document provides information about microRNAs (miRNAs) and their applications. It begins with an introduction to miRNAs, including that they are small noncoding RNA molecules that regulate genes. It then discusses the history of miRNA discovery, including the first two miRNAs discovered: lin-4 and let-7. The document proceeds to explain the biogenesis of miRNAs in detail through multiple steps from transcription to incorporation into the RNA-induced silencing complex. It also discusses applications of miRNAs as biomarkers for various diseases and their role in cancer and diabetes.
Non coding RNA as targets in drug discovery.pptxLijoMani
This document discusses non-coding RNAs (ncRNAs) as potential targets for drug discovery. It begins by defining ncRNAs and describing their types and functions. Several types of ncRNAs are involved in diseases like cancer. MicroRNAs (miRNAs) and long non-coding RNAs (lncRNAs) are discussed in more detail, including their biogenesis, mechanisms of action, and roles in various diseases. The role of ncRNA in regulating immune signaling pathways during Mycobacterium tuberculosis infection is also covered. Finally, the potential for using miRNAs as diagnostic and therapeutic markers is presented.
Similar to Oligoinformatics And Drug Development (20)
1. Therapeutic antagonism of microRNAs
Bioinformatics in the
development and
understanding of
oligonucleotide drugs
Morten Lindow
Group leader, Bioinformatics
Santaris Pharma A/S
Aalborg University November 2010
3. CGCUGUGAGGUG Chemically simple
GUA 1D
…GGGCGACACUCCACCAUGAAU……Fewer cellular compartments
|||||||||||||||
Easy to develop regulator
translation
Chemically diverse
3D
Many types of interactions with ligands
Diverse cellular compartments
Hard to develop regulator
5. Designing oligos as RNA regulators
Intelligent design Natural selection
(oligoinformatics)
ASOs siRNAs miRNAs
TargetSurveyor.pl Lindow et al.,
PLoS Comput Biol. 2007
Plant genomes have
7/10 have IC50<5nM
>2000 genomic pre-miR
Conserved across species
structures with
Minimal off-targets
complementarity to
…
mRNA. Just waiting for
the right niche to show up.
6. CGCUGUGAGGUGGUA
|||||||||||||||
CCCCCUGAUGGGGGCGACACUCCACCAUGAAUCACUC
• Vast compound libraries
• Combinatorial chemistry
TargetSurveyor.pl
~2 years
~2 months
• High through put screening on Automated oligosynthesis
primary target
• Specificity screen on related qPCR
receptors
• Tolerability screen
Lead optimization 23 optimized leads
2 in pre-clinical dev
2 in phase 1
1 in phase 2
Clinical development
10. Antagonism of miR-122 leads to
reduced plasma cholesterol
Single i.v. injection of Three i.v. injections of miravirsen
miravirsen in mice in African green monkeys
Elmen&Lindow et al, Nature 2008
Esau et al, Cell Metab 2006
11. miR-122 and hepatitis C virus
HCV is a single stranded RNA virus
HCV genome resembles an mRNA
170 million infected worldwide
Current treatment often ineffective and
with serious side effects
2x miR-122 binding
sites in 5‟NTR Viral replication
Jopling et al, Science 2005
Elmen&Lindow et al., Nature 2008
13. ? Can miravirsen reduce HCV-load in vivo?
? Can HCV mutate to escape miravirsen treatment?
? What is the physiological role of miR-122?
? Does miravirsen have any off-targets?
15. Can HCV mutate to escape
miravirsen treatment?
Direct-acting small molecule inhibitor LNA-antimiR targeting the host factor
of viral RNA polymerase miR-122
Rebound during Rebound 2 weeks after
treatment end of treatment
Period of treatment
Cooper et al, J Hepat, 2009 Lanford et al, Science 2010
16. Deep sequencing of virus from
treated animals
HCV specific primers to amplify miR-122 binding region
454 deep sequencing
73,000 to 214,000 reads at 4 time points
Does frequency of variants change?
18. Antagonism of miR-122:
Effects on gene expression
What is the physiological role of miR-122?
Are miR-122 targets upregulated after miravirsen
treatment? Can this be used as an efficacy
endpoint?
Is there a non-sequence specific effect of treatment
with LNA-oligos?
Is there a sequence specific effect of treatmentwith
miravirsen? (off-target effect on mRNAs?)
19. Distance between transcriptomes
5 fat mice treated with miravirsen
5 fat mice treated with 2 mismatch control
5 fat mice treated with saline
Data from Elmen & Lindow et al, Nature 2008
20. Are miR-122 targets upregulated
after miravirsen treatment?
miR-122
RISC
Inhibits expression
On the level of the individual gene only a few targets are significantly upregulated
(n=5) and only with about 25%
21. Sequence and expression analysis
combined yields a miR-signature
Expression analysis Sequence analysis
antimiR
mRNA changes
All ~20 000 genes
Control
predicted
miR-122 targets
for each gene:
log2(antimiR/control)
0 means no change
22. miR-signature is an efficacy endpoint
Null-hypothesis:
Are the distributions of
background and
14503 predicted targets
mRNAs with identical?
no site
Test:
Density
two-sided Kolmogorov-
Smirnov
879 mRNA
with
p=6.60E-27
miR-122 site
0 0
Response to miravirsen treatment
log2(miravirsen/saline)
23. Microarray data from four different experiments
Model Liver Northern Serum cholesterol levels
Monkey
Normal diet
Monkey
High-fat diet
Mouse
Normal diet
Mouse
High-fat diet
24. On gene level: only little consistency
between mice and primates
29. Off-target effects?
miR
RISC Yes, the antimiR binds and
derepress targets of the miR
antimiR
Direct effect on (partially)
complementary targets?
30. cells or animals
treated with oligo
or siRNA
1. Calculate fold
change in the
concentration of
each mRNA
Untreated or
mock treated
animals
2. Rank mRNAs by fold change
up in treated down in treated
3. Sequence analysis: Mark presence of all „words‟ of length k
4. Test if a word is over/under represented in one end of the ranked list
Sylamer, Enright lab, 2009
31. 6 nt words 7 nt words
Sites complementary
to miR-122
Noise level
Sites complementary
to oligo
Obad et al., Nature Genetics, in press
32. No evidence of direct regulation of
mRNAs by LNA-antimiRs!
33. miravirsen is in clinical trials
★Preclinical tox: “SPC3649 (miravirsen) was tolerated at doses that far
exceed those intended for human clinical use”
★Phase Ia study completed: Single dose, dose-escalationin healthy
volunteers
★Phase Ib completed: Multiple ascending doses in healthy volunteers
★Phase II ongoing: Hepatitis C patients
34. Phase 1a. Dose dependent reduction of plasma
cholesterol in humans
35. Summary
Bioinformatics: Sequence analysis facilitates
oligonucleotide drug development
Design of specific, potent and tolerable oligonucleotide drugs
Methods for expression data analysis on efficacy and specificity
Systems biology: miR-122 coordinates expression level of
cholesterol biosynthesis enzymes
HCV-treatment: Miravirsen appears to be a promising new
HCV treatment
First time a microRNA is a drug target
No escape mutants in treated chimpanzees
Awaiting phase II data
36. Acknowledgements
Santaris microRNA research group
Sakari Kauppinen
Susanna Obad
Joacim Elmen
Santaris Bioinformatics group
Andreas Petri
Lena Hansson (now Intomics)
Elfar Torarinson (sysadm consult)
Peter Hagedorn (post doc, now at LEOPharma)
Center for biological sequence analysis, DTU
Henrik Bjørn Nielsen
37. More…..
mirmaid.org microRNA information for computers, open
source API to miR data resources
bio-geeks.com, blog with other geeks about bioinformatics
RNA.dk – homepage for new big project about Enabling RNA
Therapeutics
oligoinformatics.org, New. Specialized blog on oligos and
informatics
Student project inquiries: mol@santaris.com
Editor's Notes
Thank you for the invitation to speak to you today. I am going to speak to you about “Bioinformatics in the development and understanding of oligonucleotide drugs”. As far as I know, not many of you work with drug development. However, I think most of you would agree that biology is becoming an information science and that you are working with bioinformatics in one way or another almost every day. Also the usefulness of oligonucleotides should be familiar to all the bioscientists. What I find especially fascinating and powerful is the combination of the three: bioinformatics, drug development and oligonucleotides
Working with dyes at the German chemical company IG Farben, Paul Ehrlich in 1872, introduced the concept of a chemoreceptor. A molecule that specifically binds to one of his chemicals.For more than 100 years, drug development – very primitive at first, now highly sophisticated – has focused on proteins as targets. Finding the right regulator of a protein has mainly been a process of trial and error. This picture show aspirin in its binding pocket of the dimeric cox-enzyme. Looking at that spaghetti, I don’t think it is strange that trial and error have been the main road forward for finding molecules that can bind and regulate proteins, Also computationally this is an extremely difficult problem.
However, there are alternatives. Proteins are translated from RNA. RNA is chemically and structurally simpler. Even a 1D representation of RNA is very useful for finding ligands.. Simply by basepairing. Moreover contrary to proteins, most RNA are present in the same subcellular compartments. Therefore regulation on RNA level is more generic approach. The same class of molecules can be used for most RNAs. I am of course talking about oligonucleotides
Some oligonucleotides are especially interesting…..miRNA….. siRNA….. ASOs…explain gapmers and RNAseH mechanism
There are many miOneoligo to find themOne oligo to bind themAnd in complex forever blind them
On their a one experiment/one gene basisonly 2 of these were significant with the number of replicates we got. However, by integrating pathway information and biological knowledge, suddenly it becomes clear – and statistically significant – that these many small changes work in a coordinated to downregulate cholesterol biosynthesis. Explain figure….