Objective The objective of project is to practice using Pythons GUI .pdf
•
0 likes•2 views
Objective The objective of project is to practice using Pythons GUI Tkinter. You must use Tkinter and no other GUI product. Description For this project, design a small (i.e. 2x3) GUI window which contains 4 items: 1) a text keyin field, 2) an Execute button, 3) an Exit Button and 4) a label. When the user clicks on the Execute button, the text located in the keyin field will be displayed on the label. If the keyin field contains no text, a message box should display saying No Text to Display. When the user clicks on the Exit button, the program should terminate. Therefore use the Tkinter destroy() method. Do not use sys.exit(). Your program must be thoroughly commented/documented as defined in the previous projects. Use beginner python..
Report
Share
Report
Share
Download to read offline
Recommended
On December 18, 2020, Stephanie Corporation acquired 100 percent of .pdf
On December 18, 2020, Stephanie Corporation acquired 100 percent of a Swiss company for
4.012 million Swiss francs (CHF), which is indicative of book and fair value. At the acquisition
date, the exchange rate was $1.00 = CHF 1. On December 18, 2020, the book and fair values of
the subsidiarys assets and liabilities were as follows:
Cash CHF 812,000
Inventory 1,312,000
Property, plant, and equipment 4,012,000
Notes payable (2,124,000 )
Stephanie prepares consolidated financial statements on December 31, 2020. By that date, the
Swiss franc has appreciated to $1.10 = CHF 1. Because of the year-end holidays, no transactions
took place prior to consolidation.
Determine the translation adjustment to be reported on Stephanies December 31, 2020,
consolidated balance sheet, assuming that the Swiss franc is the Swiss subsidiarys functional
currency. What is the economic relevance of this translation adjustment?
Determine the remeasurement gain or loss to be reported in Stephanies 2020 consolidated net
income, assuming that the U.S. dollar is the functional currency. What is the economic relevance
of this remeasurement gain or loss?
a) Translation adjustment :______ : $ ?
b) ____________ $_____?.
On February 1, 2024, a company lends cash and accepts a $20,000 note.pdf
On February 1, 2024, a company lends cash and accepts a $20,000 note receivable that offers
10% interest and is due in six months. What would the company record on August 1, 2024, when
the borrower pays the correct amount owed? Transaction Account Title Debit Credit A. Cash
20,000 A. Interest Revenue 1,000 A. Notes Receivable 21,000 B. Cash 21,000 B. Notes
Receivable 21,000 C. Cash 21,000 C. Interest Revenue 1,000 C. Notes Receivable 20,000 D.
Cash 22,000 D. Notes Receivable 22,000.
On August 1, 2024, Trico Technologies, an aeronautic electronics com.pdf
On August 1, 2024, Trico Technologies, an aeronautic electronics company, borrows $19.9
million cash to expand operations. The loan is made by FirstBanc Corporation under a short-term
line of credit arrangement. Trico signs a six-month, 9% promissory note. Interest is payable at
maturity. FirstBanc Corporations year-end is December 31. Required: 1. to 3. Record the
necessary entries in the Journal Entry Worksheet below for FirstBanc Corporation. (If no entry is
required for a particular transaction/event.
On a bank balance sheet, cash deposited by customers is classified h.pdf
On a bank balance sheet, cash deposited by customers is classified how?
Revenue
Equity
Liabilities
Assets
If a bank experiences a bank run, depositors are going to withdraw their funds. Banks will need
to sell assets. Which of these is an example of an asset for a bank? (Check all that apply)
Mortgages
Government Treasuries
Cash Deposits
The FDIC insurance limit
Loans.
Objetivos de aprendizaje Identifique las fuerzas que seguir�n afe.pdf
Objetivos de aprendizaje:
Identifique las fuerzas que seguirn afectando la evolucin de la publicidad y la promocin de
marca integrada. Ponga la historia a trabajar hoy.
Discusin:
Cul ser la prxima era en la publicidad?
Algunos expertos predicen que los telfonos inteligentes pronto sern ms importantes para los
anunciantes de lo que fue Internet durante la revolucin electrnica. Identifique las aplicaciones de
telfonos inteligentes ms populares de la actualidad y sugiera cmo los anunciantes podran usarlas
para publicitar productos y servicios para audiencias objetivo..
Objective Create a PHP connection string for a database.Direction.pdf
Objective: Create a PHP connection string for a database.
Directions: Given the credentials shown in Figure 1, write a modified version of the connection
string shown in Figure 2 so it will successfully connect to the albums database;
Note: The string must contain all syntax as in the example provided; i.e. @ $db, etc.
What to Submit: Submit your modified connection string within the textbox..
nstructions The input to this homework is a set of DNA reads ,You.pdf
nstructions:
The input to this homework is a set of DNA reads ,You can assume that if two reads have a
suffix-prefix overlap longer than 50bp,
they can be considered as being sampled from the same region of the genome and be reliably
connected. Also note that minor sequencing errors (e.g. mismatches or insertion/deletion) may
present in the overlapped region. Submit your reconstructed genomic sequence in FASTA
format.
File data :
>1
CCCTGTCTACCACCCAGACTATCGTGTAGTTCTGCCTGTTCCGTAAGTCGTAGATTGC
TATCCTGGAAATCATCGTGCTCAGGATGTTAATATCTAGCGT
>2
AGACTATCGTGTAGTTCTGCCTGTTCCGTAAGTCGTAGATTGCTATCCTGGAAATCAT
CGTGCTCAGGATGTTAATATCTAGCGTCCTACGTTACGAGTT
>3
TCTGCCTGTTCCGTAAGTCGTAGATTGCTATCCTGGAAATCATCGTGCTCAGGATGTT
AATATCTAGCGTCCTACGTTACGAGTTGGCAGATGACAGATC
>4
AGTCGTAGATTGCTATCCTGGAAATCATCGTGCTCAGGATGTTAATATCTAGCGTCC
TACGTTACGAGTTGGCAGATGACAGATCGTAGTCGTGGTAAGG
>5
TCCTGGAAATCATCGTGCTCAGGATGTTAATATCTAGCGTCCTACGTTACGAGTTGG
CAGATGACAGATCGTAGTCGTGGTAAGGGGCATTGCCGCTTGT
>6
TGCTCAGGATGTTAATATCTAGCGTCCTACGTTACGAGTTGGCAGATGACAGATCGT
AGTCGTGGTAAGGGGCATTGCCGCTTGTGACCCAGTTCGCGTG
>7
TATCTAGCGTCCTACGTTACGAGTTGGCAGATGACAGATCGTAGTCGTGGTAAGGGG
CATTGCCGCTTGTGACCCAGTTCGCGTGCCTAGCAGCACTCCA
>8
GTTACGAGTTGGCAGATGACAGATCGTAGTCGTGGTAAGGGGCATTGCCGCTTGTGA
CCCAGTTCGCGTGCCTAGCAGCACTCCAAAATAAAGTTTACAG
>9
ATGACAGATCGTAGTCGTGGTAAGGGGCATTGCCGCTTGTGACCCAGTTCGCGTGCC
TAGCAGCACTCCAAAATAAAGTTTACAGTACCGTCCGGACGGC
>10
CGTGGTAAGGGGCATTGCCGCTTGTGACCCAGTTCGCGTGCCTAGCAGCACTCCAAA
ATAAAGTTTACAGTACCGTCCGGACGGCAGAACTGTCCTCTAG
>11
TGCCGCTTGTGACCCAGTTCGCGTGCCTAGCAGCACTCCAAAATAAAGTTTACAGTA
CCGTCCGGACGGCAGAACTGTCCTCTAGATCGTCCTAACGCCT
>12
AGTTCGCGTGCCTAGCAGCACTCCAAAATAAAGTTTACAGTACCGTCCGGACGGCA
GAACTGTCCTCTAGATCGTCCTAACGCCTTAGTCGAATCCCTTG
>13
CAGCACTCCAAAATAAAGTTTACAGTACCGTCCGGACGGCAGAACTGTCCTCTAGAT
CGTCCTAACGCCTTAGTCGAATCCCTTGCCGTCGGTAACCACT
>14
AAGTTTACAGTACCGTCCGGACGGCAGAACTGTCCTCTAGATCGTCCTAACGCCTTA
GTCGAATCCCTTGCCGTCGGTAACCACTGAATAAACTACGCGT
>15
TCCGGACGGCAGAACTGTCCTCTAGATCGTCCTAACGCCTTAGTCGAATCCCTTGCC
GTCGGTAACCACTGAATAAACTACGCGTTAGGACTTTGTCAGA
>16
TGTCCTCTAGATCGTCCTAACGCCTTAGTCGAATCCCTTGCCGTCGGTAACCACTGA
ATAAACTACGCGTTAGGACTTTGTCAGACGCGAGGAGCTAGTA
>17
CCTAACGCCTTAGTCGAATCCCTTGCCGTCGGTAACCACTGAATAAACTACGCGTTA
GGACTTTGTCAGACGCGAGGAGCTAGTAGGAGGACAAATCAGC
>18
GAATCCCTTGCCGTCGGTAACCACTGAATAAACTACGCGTTAGGACTTTGTCAGACG
CGAGGAGCTAGTAGGAGGACAAATCAGCAAACGACCCTGAATT
>19
GGTAACCACTGAATAAACTACGCGTTAGGACTTTGTCAGACGCGAGGAGCTAGTAG
GAGGACAAATCAGCAAACGACCCTGAATTGAACAATGTGAGTAG
>20
AACTACGCGTTAGGACTTTGTCAGACGCGAGGAGCTAGTAGGAGGACAAATCAGCA
AACGACCCTGAATTGAACAATGTGAGTAGGTATAACTGTGCTTG
>21
CTTTGTCAGACGCGAGGAGCTAGTAGGAGGACAAATCAGCAAACGACCCTGAATTG
AACAATGTGAGTAGGTATAACTGTGCTTGTATGACGTCCCGTTC
>22
GGAGCTAGTAGGAGGACAAATCAGCAAACGACCCTGAATTGAACAATGTGAGTAGG
TATAACTGTGCTTGTATGACGTCCCGTTCGGTCGTTCTTGAGCA
>23
ACAAATCAGCAAACGACCCTGAATTGAACAATGTGAGTAGGTATAACTGTGCTTGT
ATGACGTCCCGTTCGGTCGTTCTTGAGCAACTTCGGCCAGTGCA
>24
ACCCTGAATTGAACAATGTGAGTAGGTATAACTGTGCTTGTATGACGTCCCGTTCGG
TCGTTCTTGAGCAACTTCGGCCAGTGCATGCTATGGGGGAAGC
>25
ATGTGAGTAGGTATAACTGTGCT.
Recommended
On December 18, 2020, Stephanie Corporation acquired 100 percent of .pdf
On December 18, 2020, Stephanie Corporation acquired 100 percent of a Swiss company for
4.012 million Swiss francs (CHF), which is indicative of book and fair value. At the acquisition
date, the exchange rate was $1.00 = CHF 1. On December 18, 2020, the book and fair values of
the subsidiarys assets and liabilities were as follows:
Cash CHF 812,000
Inventory 1,312,000
Property, plant, and equipment 4,012,000
Notes payable (2,124,000 )
Stephanie prepares consolidated financial statements on December 31, 2020. By that date, the
Swiss franc has appreciated to $1.10 = CHF 1. Because of the year-end holidays, no transactions
took place prior to consolidation.
Determine the translation adjustment to be reported on Stephanies December 31, 2020,
consolidated balance sheet, assuming that the Swiss franc is the Swiss subsidiarys functional
currency. What is the economic relevance of this translation adjustment?
Determine the remeasurement gain or loss to be reported in Stephanies 2020 consolidated net
income, assuming that the U.S. dollar is the functional currency. What is the economic relevance
of this remeasurement gain or loss?
a) Translation adjustment :______ : $ ?
b) ____________ $_____?.
On February 1, 2024, a company lends cash and accepts a $20,000 note.pdf
On February 1, 2024, a company lends cash and accepts a $20,000 note receivable that offers
10% interest and is due in six months. What would the company record on August 1, 2024, when
the borrower pays the correct amount owed? Transaction Account Title Debit Credit A. Cash
20,000 A. Interest Revenue 1,000 A. Notes Receivable 21,000 B. Cash 21,000 B. Notes
Receivable 21,000 C. Cash 21,000 C. Interest Revenue 1,000 C. Notes Receivable 20,000 D.
Cash 22,000 D. Notes Receivable 22,000.
On August 1, 2024, Trico Technologies, an aeronautic electronics com.pdf
On August 1, 2024, Trico Technologies, an aeronautic electronics company, borrows $19.9
million cash to expand operations. The loan is made by FirstBanc Corporation under a short-term
line of credit arrangement. Trico signs a six-month, 9% promissory note. Interest is payable at
maturity. FirstBanc Corporations year-end is December 31. Required: 1. to 3. Record the
necessary entries in the Journal Entry Worksheet below for FirstBanc Corporation. (If no entry is
required for a particular transaction/event.
On a bank balance sheet, cash deposited by customers is classified h.pdf
On a bank balance sheet, cash deposited by customers is classified how?
Revenue
Equity
Liabilities
Assets
If a bank experiences a bank run, depositors are going to withdraw their funds. Banks will need
to sell assets. Which of these is an example of an asset for a bank? (Check all that apply)
Mortgages
Government Treasuries
Cash Deposits
The FDIC insurance limit
Loans.
Objetivos de aprendizaje Identifique las fuerzas que seguir�n afe.pdf
Objetivos de aprendizaje:
Identifique las fuerzas que seguirn afectando la evolucin de la publicidad y la promocin de
marca integrada. Ponga la historia a trabajar hoy.
Discusin:
Cul ser la prxima era en la publicidad?
Algunos expertos predicen que los telfonos inteligentes pronto sern ms importantes para los
anunciantes de lo que fue Internet durante la revolucin electrnica. Identifique las aplicaciones de
telfonos inteligentes ms populares de la actualidad y sugiera cmo los anunciantes podran usarlas
para publicitar productos y servicios para audiencias objetivo..
Objective Create a PHP connection string for a database.Direction.pdf
Objective: Create a PHP connection string for a database.
Directions: Given the credentials shown in Figure 1, write a modified version of the connection
string shown in Figure 2 so it will successfully connect to the albums database;
Note: The string must contain all syntax as in the example provided; i.e. @ $db, etc.
What to Submit: Submit your modified connection string within the textbox..
nstructions The input to this homework is a set of DNA reads ,You.pdf
nstructions:
The input to this homework is a set of DNA reads ,You can assume that if two reads have a
suffix-prefix overlap longer than 50bp,
they can be considered as being sampled from the same region of the genome and be reliably
connected. Also note that minor sequencing errors (e.g. mismatches or insertion/deletion) may
present in the overlapped region. Submit your reconstructed genomic sequence in FASTA
format.
File data :
>1
CCCTGTCTACCACCCAGACTATCGTGTAGTTCTGCCTGTTCCGTAAGTCGTAGATTGC
TATCCTGGAAATCATCGTGCTCAGGATGTTAATATCTAGCGT
>2
AGACTATCGTGTAGTTCTGCCTGTTCCGTAAGTCGTAGATTGCTATCCTGGAAATCAT
CGTGCTCAGGATGTTAATATCTAGCGTCCTACGTTACGAGTT
>3
TCTGCCTGTTCCGTAAGTCGTAGATTGCTATCCTGGAAATCATCGTGCTCAGGATGTT
AATATCTAGCGTCCTACGTTACGAGTTGGCAGATGACAGATC
>4
AGTCGTAGATTGCTATCCTGGAAATCATCGTGCTCAGGATGTTAATATCTAGCGTCC
TACGTTACGAGTTGGCAGATGACAGATCGTAGTCGTGGTAAGG
>5
TCCTGGAAATCATCGTGCTCAGGATGTTAATATCTAGCGTCCTACGTTACGAGTTGG
CAGATGACAGATCGTAGTCGTGGTAAGGGGCATTGCCGCTTGT
>6
TGCTCAGGATGTTAATATCTAGCGTCCTACGTTACGAGTTGGCAGATGACAGATCGT
AGTCGTGGTAAGGGGCATTGCCGCTTGTGACCCAGTTCGCGTG
>7
TATCTAGCGTCCTACGTTACGAGTTGGCAGATGACAGATCGTAGTCGTGGTAAGGGG
CATTGCCGCTTGTGACCCAGTTCGCGTGCCTAGCAGCACTCCA
>8
GTTACGAGTTGGCAGATGACAGATCGTAGTCGTGGTAAGGGGCATTGCCGCTTGTGA
CCCAGTTCGCGTGCCTAGCAGCACTCCAAAATAAAGTTTACAG
>9
ATGACAGATCGTAGTCGTGGTAAGGGGCATTGCCGCTTGTGACCCAGTTCGCGTGCC
TAGCAGCACTCCAAAATAAAGTTTACAGTACCGTCCGGACGGC
>10
CGTGGTAAGGGGCATTGCCGCTTGTGACCCAGTTCGCGTGCCTAGCAGCACTCCAAA
ATAAAGTTTACAGTACCGTCCGGACGGCAGAACTGTCCTCTAG
>11
TGCCGCTTGTGACCCAGTTCGCGTGCCTAGCAGCACTCCAAAATAAAGTTTACAGTA
CCGTCCGGACGGCAGAACTGTCCTCTAGATCGTCCTAACGCCT
>12
AGTTCGCGTGCCTAGCAGCACTCCAAAATAAAGTTTACAGTACCGTCCGGACGGCA
GAACTGTCCTCTAGATCGTCCTAACGCCTTAGTCGAATCCCTTG
>13
CAGCACTCCAAAATAAAGTTTACAGTACCGTCCGGACGGCAGAACTGTCCTCTAGAT
CGTCCTAACGCCTTAGTCGAATCCCTTGCCGTCGGTAACCACT
>14
AAGTTTACAGTACCGTCCGGACGGCAGAACTGTCCTCTAGATCGTCCTAACGCCTTA
GTCGAATCCCTTGCCGTCGGTAACCACTGAATAAACTACGCGT
>15
TCCGGACGGCAGAACTGTCCTCTAGATCGTCCTAACGCCTTAGTCGAATCCCTTGCC
GTCGGTAACCACTGAATAAACTACGCGTTAGGACTTTGTCAGA
>16
TGTCCTCTAGATCGTCCTAACGCCTTAGTCGAATCCCTTGCCGTCGGTAACCACTGA
ATAAACTACGCGTTAGGACTTTGTCAGACGCGAGGAGCTAGTA
>17
CCTAACGCCTTAGTCGAATCCCTTGCCGTCGGTAACCACTGAATAAACTACGCGTTA
GGACTTTGTCAGACGCGAGGAGCTAGTAGGAGGACAAATCAGC
>18
GAATCCCTTGCCGTCGGTAACCACTGAATAAACTACGCGTTAGGACTTTGTCAGACG
CGAGGAGCTAGTAGGAGGACAAATCAGCAAACGACCCTGAATT
>19
GGTAACCACTGAATAAACTACGCGTTAGGACTTTGTCAGACGCGAGGAGCTAGTAG
GAGGACAAATCAGCAAACGACCCTGAATTGAACAATGTGAGTAG
>20
AACTACGCGTTAGGACTTTGTCAGACGCGAGGAGCTAGTAGGAGGACAAATCAGCA
AACGACCCTGAATTGAACAATGTGAGTAGGTATAACTGTGCTTG
>21
CTTTGTCAGACGCGAGGAGCTAGTAGGAGGACAAATCAGCAAACGACCCTGAATTG
AACAATGTGAGTAGGTATAACTGTGCTTGTATGACGTCCCGTTC
>22
GGAGCTAGTAGGAGGACAAATCAGCAAACGACCCTGAATTGAACAATGTGAGTAGG
TATAACTGTGCTTGTATGACGTCCCGTTCGGTCGTTCTTGAGCA
>23
ACAAATCAGCAAACGACCCTGAATTGAACAATGTGAGTAGGTATAACTGTGCTTGT
ATGACGTCCCGTTCGGTCGTTCTTGAGCAACTTCGGCCAGTGCA
>24
ACCCTGAATTGAACAATGTGAGTAGGTATAACTGTGCTTGTATGACGTCCCGTTCGG
TCGTTCTTGAGCAACTTCGGCCAGTGCATGCTATGGGGGAAGC
>25
ATGTGAGTAGGTATAACTGTGCT.
Nursing 131Nursing 131 28. The 72 year old client has experi.pdf
Nursing 131
Nursing 131 28. The 72 year old client has experienced unexplained 5 -pound weight lost in two
weeks and has reported "more dizziness than usual" he is taking multiple medication for
hypertension and arthritis. The nurse identifies which of the following factors as a possible
reason for these clinical manifestations. a. Lack of health promotion activities b. inadequate
nutrition c. polypharmacy d. lack of supervision.
Noye The distance of the moon from Earths surface is 3.84 10^8 m. .pdf
Noye: The distance of the moon from Earth's surface is 3.84 10^8 m. The radius of Earth is 6.38
10^6 m).
Number of cells log lable the phases below help All the people li.pdf
Number of cells log lable the phases below help All the people living at the same time usually 5.
Define Generation: 6. What is the name of the instrument used to measure turbidity? 7. Melted
agar deeps are generally held at what temperature? 8. At what temperature will agar melt? 9.
What part of the petri dish do we label? 10. What organism did we use in this lab?.
O A.termite B.lead paintC. radonD. well and drinki.pdf
O A.
termite
B.
lead paint
C. radon
D. well and drinking water.
number cube with the numbers 1 through 6 is rolled nine times. If th.pdf
number cube with the numbers 1 through 6 is rolled nine times. If the number cube is rolled a
tenth time, what is the probability that the result will be either a 5 or a 6 given a 5 or 6 had
already been rolled four times already?.
numanalysis.py (30 points)A) Write a program that asks user to.pdf
numanalysis.py (30 points)
A) Write a program that asks user to enter a series of 8 different numbers. The program should
store the numbers in a list, then display the following data.
1. The list contents
2. The lowest number in the list
3. The highest number in the list
4. The total of the numbers in the list
5. The average of the numbers in the list
Hints:
Define main ():
Declare variables and initialize them
Create an empty list
Use the for loop with the range function to loop 8 times.
Prompt the User to enter the numbers from 1- 8.
Ex: Enter number 1 of 8:
Use append() function to populate the list
Use min, max, sum, functions to find the low , high and total number of the list.
Ex: low = min(number_list)
Print the list contents
Print Low, high , total and average numbers of the list.
B) Convert the list created above to a tuple. Print the contents of the tuple in reverse order - each
element of the tuple on a separate line.
Hints:
Use tuple() function on the list to covert it to a tuple. Use slicing expression on the tuple with a
step value of -1 to read the contents in reverse order in a 'for' loop and print each item.
Expected output :
List: [#, #, #, #, #, #, #, #]
Low: #.##
High: #.##
Total: #.##
Average: #.##
Tuple: (#, #, #, #, #, #, #, #)
Tuple contents printed in reverse order:
#
#
...... (8 items printed one after anther)
A) Write a program that asks user to enter a series of 8 different numbers. The program should
store the numbers in a list, then display the following data. 1. The list contents 2. The lowest
number in the list 3. The highest number in the list 4. The total of the numbers in the list 5. The
average of the numbers in the list B) Convert the list created above to a tuple. Print the contents
of the tuple in reverse order - each clement of the tuple on a separate line. Hints:
A) Define main (): Declare variables and initialize them Create an empty list Use the for loop
with the range function to loop 8 times. Prompt the User to enter the numbers from 1- 8. Ex:
Enter number 1 of 8 : Use append() function to populate the list Use min, max, sum, functions to
find the low, high and total number of the list. Ex: low =min( number_list) Print the list contents
Print Low, high, total and average numbers of the list.
B) Use tuple! function on the list to covert it to a tuple. Use slicing expression on the tuple with a
step value of - 1 to read the contents in reverse order in a 'for' loop and print each item. List: [\#,
\#, \#, \#, H,\#, \#, \#] LoW: H. \#\# \# High: A, Total: \#,\#\# \# Average: \#.\#\# H\# Tuple: (\#,
\#, \#, \#,\#, \#,\#,\#) Tuple contents printed in reverse order: \# \# (8 items printed one after
anther).
Olaf and Elsa, husband and wife filing a joint return, operate a s.pdf
Olaf and Elsa, husband and wife filing a joint return, operate a sole proprietorship. They expect
their taxable income next year to be $75,000, of which $70,000 is attributed to the sole
proprietorship. Olaf and Elsa are contemplating incorporating their sole proprietorship. From a
Federal income tax perspective (ignoring any QBI or self-employment taxes), which business
structure is the most advantageous and why?
Multiple Choice
A corporation because their total tax liability is smaller
A sole proprietorship because it is not subject to double taxation
A corporation because it is a separate legal entity
A sole proprietorship because their total tax liability is smaller.
Operating SystemGiven the following informationDraw a timelin.pdf
Operating System
Given the following information:
Draw a timeline analysis for each of the following scheduling algorithms. (It might be helpful to
first compare a start and finish time for each job). Calculate the average turnaround time and
average waiting time for execution of the processes.
a) FCFS
b) SJN
c) SRT
d) Round Robin (using a time quantum of 2, and ignoring context switching)
Operating SystemProcessArrival TimeCPU CycleP104P217P3210P435.
Offer your opinions on the transition of money from hard currency to.pdf
Offer your opinions on the transition of money from hard currency to checking accounts to credit
cards and now to virtual currency like Bitcoin.
Do you think this is or has been an easy transition? Offer some examples of the challenges we
face as a society as currency takes on different forms.
Is it positive or negative? Are there different demographics that see the change positive or
negative?
Thanks.
OPCI�N M�LTIPLE Seleccione todas las respuestas correctas. Puede ha.pdf
OPCIN MLTIPLE: Seleccione todas las respuestas correctas. Puede haber ms de una respuesta
correcta o ninguna respuesta puede ser correcta .
22. Qu seccin transversal tiene una mdula?
a. hoja de dicotilednea
b. raz de dicotilednea
C. tallo de dicotilednea herbcea
d. hoja monocotilednea
mi. raz monocotilednea
F. tallo de monocotilednea
gramo. tallo de dicotilednea leosa
6. Cul es el principal mecanismo de transporte en las plantas no vasculares?
a. difusin
b. translocacin en el floema
C. transpiracin-adhesin-cohesin-smosis en el xilema
7. Qu esperaras que le sucediera a un rbol si un insecto se comiera los meristemas laterales sin
daar ninguna otra parte del rbol?
a. El rbol no sera capaz de realizar la fotosntesis.
b. El rbol no perdera agua por transpiracin.
C. El rbol no sera capaz de absorber agua y minerales.
d. El rbol no podra producir madera ni corteza.
8. La mayor parte del agua absorbida por las races es
a. utilizado para producir glucosa durante la fotosntesis
b almacenado en la vacuola central de las clulas de la raz para que nunca llegue a las hojas
C. perdido en la transpiracin de las hojas
d. transportado a frutas
10. Qu es un reactivo en las reacciones independientes de la luz de la fotosntesis?
a. dixido de carbono
b. glucosa
C. oxgeno
d. agua
19. Qu proceso ocurre en el meristema apical de la punta de una raz?
a. divisin celular
b. alargamiento celular
C. maduracin celular.
ONLY THE LAST QUESTION IS THE POINT OF POST. THE OTHER PAGES ARE BAC.pdf
ONLY THE LAST QUESTION IS THE POINT OF POST. THE OTHER PAGES ARE
BACKGROUND CONTEXT Lab: Differential Expression Differential gene expression provides
the ability for a cell or organism to respond to a constantly changing external environment. The
specific constellation of proteins required for optimal function and growth varies with cellular
age and environmental context. Thus, protein production is carefully regulated by multiple
mechanisms that modulate both transcriptional and translational pathways. Control of
transcription initiation by RNA polymerase is a predominant mechanism for regulating
expression of specific proteins, presumably because it provides maximal conservation of energy
for the cell. We can often observe the consequence of differential transcription due to the
presence or absence of particular proteins or the growth in particular environments. Control can
also occur at translation; the mRNA is synthesized, but only in certain circumstances is it
translated. Control can also occur at the level of protein function; the protein is inactive, or
activity is not observed due to the lack of the substrate. In this lab we will observe differential
expression of two different genes encoded on plasmids. We will analyze transcriptional activity,
translational activity, and protein function. Plasmids are extra-chromosomal DNA. Bacteria often
have plasmids and will replicate the plasmid and pass it to daughter cells (vertical transmission)
and to neighboring cells (horizontal). Plasmids are a mechanism of gene diversity. In order to
stably retain the plasmid, there needs to be some type of metabolic reason for the bacteria to
maintain the plasmid. In other words, the plasmid confers an advantage. Plasmids contain: 1. Ori:
the plasmid may present is low or high copy number. 2. Lab generated plasmids typically also
contain a selectable marker (antibiotic resistance), 3. Additional gene for ease of visual screening
4. Multiple cloning site
pUC19 is one of a series of plasmid cloning vectors created by Joachim Messing and co-workers.
The designation "pUC" is derived from the classical "p" prefix (denoting "plasmid") and the
abbreviation for the University of California, where early work on the plasmid series had been
conducted. It is a circular double stranded DNA and has 2686 base pairs. pUC19 is one of the
most widely used vector molecules as the recombinants, or the cells into which foreign DNA has
been introduced, can be easily distinguished from the non-recombinants based on color
differences of colonies on growth media. pUC18 is similar to pUC19, but the MCS region is
reversed. - pUC 19 has an origin of replication and is maintained at a high copy number. -
pUC19 encodes for an ampicillin resistance gene (amopR), via a -lactamase enzyme that
functions by degrading ampicillin and reducing its toxicity to the host. - It has an N-terminal
fragment of -galactosidase (lacZ) gene of E. coli which allows for visual screening of
recombinant.
Ontario Resources, a natural energy supplier, borrowed $80.7 million.pdf
Ontario Resources, a natural energy supplier, borrowed $80.7 million cash on November 1,
2021, to fund a geological survey. The loan was made by Quebec Banque under a short-term
financing arrangement. Ontario Resources issued a 12-month, 12% promissory note with interest
payable at maturity. Ontario Resources' fiscal period is the calendar year.
Required:
1. Prepare the journal entry for the issuance of the note by Ontario Resources.
2. & 3. Prepare the appropriate adjusting entry for the note by Ontario Resources on December
31, 2021 and journal entry for the payment of the note at maturity..
ONLY THE LAST QUESTION IS THE POINT OF POST. THE OTHER PAGES ARE B.pdf
ONLY THE LAST QUESTION IS THE POINT OF POST. THE OTHER PAGES ARE
BACKGROUND CONTEXT Lab: Differential Expression Differential gene expression provides
the ability for a cell or organism to respond to a constantly changing external environment. The
specific constellation of proteins required for optimal function and growth varies with cellular
age and environmental context. Thus, protein production is carefully regulated by multiple
mechanisms that modulate both transcriptional and translational pathways. Control of
transcription initiation by RNA polymerase is a predominant mechanism for regulating
expression of specific proteins, presumably because it provides maximal conservation of energy
for the cell. We can often observe the consequence of differential transcription due to the
presence or absence of particular proteins or the growth in particular environments. Control can
also occur at translation; the mRNA is synthesized, but only in certain circumstances is it
translated. Control can also occur at the level of protein function; the protein is inactive, or
activity is not observed due to the lack of the substrate. In this lab we will observe differential
expression of two different genes encoded on plasmids. We will analyze transcriptional activity,
translational activity, and protein function. Plasmids are extra-chromosomal DNA. Bacteria often
have plasmids and will replicate the plasmid and pass it to daughter cells (vertical transmission)
and to neighboring cells (horizontal). Plasmids are a mechanism of gene diversity. In order to
stably retain the plasmid, there needs to be some type of metabolic reason for the bacteria to
maintain the plasmid. In other words, the plasmid confers an advantage. Plasmids contain: 1. Ori:
the plasmid may present is low or high copy number. 2. Lab generated plasmids typically also
contain a selectable marker (antibiotic resistance), 3. Additional gene for ease of visual screening
4. Multiple cloning site
pUC19 is one of a series of plasmid cloning vectors created by Joachim Messing and co-workers.
The designation "pUC" is derived from the classical "p" prefix (denoting "plasmid") and the
abbreviation for the University of California, where early work on the plasmid series had been
conducted. It is a circular double stranded DNA and has 2686 base pairs. pUC19 is one of the
most widely used vector molecules as the recombinants, or the cells into which foreign DNA has
been introduced, can be easily distinguished from the non-recombinants based on color
differences of colonies on growth media. pUC18 is similar to pUC19, but the MCS region is
reversed. - pUC 19 has an origin of replication and is maintained at a high copy number. -
pUC19 encodes for an ampicillin resistance gene (amopR), via a -lactamase enzyme that
functions by degrading ampicillin and reducing its toxicity to the host. - It has an N-terminal
fragment of -galactosidase (lacZ) gene of E. coli which allows for visual screening of
recombinant.
only answer Let X1,X2,X3,� be independent identically distributed.pdf
only answer Let X1,X2,X3, be independent identically distributed random variables, with
E(Xi)=,Var(Xi)=20. Let Sn=X1+X2+X3++Xn Let Mn=Snn. Then Mn is a martingale with
respect to Xn for = to: i) ii) 2 iii) n iv) v) vi) none of the above.
only answer Let (Bt,t0) be the standard Brownian motion. Consider.pdf
only answer Let (Bt,t0) be the standard Brownian motion. Consider the following processes:
Xt=0t(12s)dBs,Yt=0t(1+2s)dBs Let t>0. The Xt,Yt are uncorrelated for t= i) 3/4 ii) 5/2 iii) 6/2
iv) 3/2 v) 7/4 vi) none of the above.
One way that threat actors can cause DNS poisoning is by putting fal.pdf
One way that threat actors can cause DNS poisoning is by putting false information in the host
file on a PC (30 points)
Demonstrate that you can find the actual address for mga.edu.
Then create an entry in the host file on your Windows VM mapping mga.edu to 172.16.1.1
Demonstrate the misdirection from the command line by pinging mga.edu.
Then create an entry in the host file on your Linux VM mapping mga.edu to 172.16.1.2
Demonstrate the misdirection from the command line by pinging mga.edu..
One of the following is not consistent with the modern view of quali.pdf
One of the following is not consistent with the modern view of quality: Group of answer choices
Production systems should evolve continuously; improving quality leads to learning.
Achieving quality is a shared responsibility of everyone in the organization
Zero defects is an appropriate goal because it forces continuous learning
When something goes wrong, it is the fault of the worker at the failure point..
Notesi.Carson inc. does not have any short-term investmentii. P.pdf
Notes:
i.Carson inc. does not have any short-term investment
ii. Property & Equipment here is reported as Net term
iii. Debt reported here is long-term debt and the firm does not have any short-term debt.
iv. Carson inc. is not a dividend paying firm
What is the Net Cash Flow for the year 2017?.
One of the following is NOT an appraisal cost Group of answer choic.pdf
One of the following is NOT an appraisal cost: Group of answer choices
Retailer hires secret shoppers to test customer-facing retail services
Paying for supervisors to get trained in the use statistical process control tools
Paying for more inspectors to test product during the production process
Paying more for software programmers with a masters degree.
one i tried but it was wrong An investigatof briefly incubates a li.pdf
one i tried but it was wrong An investigatof briefly incubates a liver extract capable of carrying
out all the normal metalolic reactions of the liver in separa esperiments with two different 14 C-
labelod precursors: [14 C]bearbonate abd [1-14 C]pyruvase. Trace the pathway of 14
Clboserbonate through glucotsoogenesis. Use an asterisk to indicane the location of 14C in all
incermediates and in the final glaocacogenesis pooduce, glucose.
trermedares and in the tiral placorocpeadin prothct, p leses..
The French Revolution Class 9 Study Material pdf free download
The French Revolution, which began in 1789, was a period of radical social and political upheaval in France. It marked the decline of absolute monarchies, the rise of secular and democratic republics, and the eventual rise of Napoleon Bonaparte. This revolutionary period is crucial in understanding the transition from feudalism to modernity in Europe.
For more information, visit-www.vavaclasses.com
Unit 8 - Information and Communication Technology (Paper I).pdf
This slides describes the basic concepts of ICT, basics of Email, Emerging Technology and Digital Initiatives in Education. This presentations aligns with the UGC Paper I syllabus.
More Related Content
More from amzonknr
Nursing 131Nursing 131 28. The 72 year old client has experi.pdf
Nursing 131
Nursing 131 28. The 72 year old client has experienced unexplained 5 -pound weight lost in two
weeks and has reported "more dizziness than usual" he is taking multiple medication for
hypertension and arthritis. The nurse identifies which of the following factors as a possible
reason for these clinical manifestations. a. Lack of health promotion activities b. inadequate
nutrition c. polypharmacy d. lack of supervision.
Noye The distance of the moon from Earths surface is 3.84 10^8 m. .pdf
Noye: The distance of the moon from Earth's surface is 3.84 10^8 m. The radius of Earth is 6.38
10^6 m).
Number of cells log lable the phases below help All the people li.pdf
Number of cells log lable the phases below help All the people living at the same time usually 5.
Define Generation: 6. What is the name of the instrument used to measure turbidity? 7. Melted
agar deeps are generally held at what temperature? 8. At what temperature will agar melt? 9.
What part of the petri dish do we label? 10. What organism did we use in this lab?.
O A.termite B.lead paintC. radonD. well and drinki.pdf
O A.
termite
B.
lead paint
C. radon
D. well and drinking water.
number cube with the numbers 1 through 6 is rolled nine times. If th.pdf
number cube with the numbers 1 through 6 is rolled nine times. If the number cube is rolled a
tenth time, what is the probability that the result will be either a 5 or a 6 given a 5 or 6 had
already been rolled four times already?.
numanalysis.py (30 points)A) Write a program that asks user to.pdf
numanalysis.py (30 points)
A) Write a program that asks user to enter a series of 8 different numbers. The program should
store the numbers in a list, then display the following data.
1. The list contents
2. The lowest number in the list
3. The highest number in the list
4. The total of the numbers in the list
5. The average of the numbers in the list
Hints:
Define main ():
Declare variables and initialize them
Create an empty list
Use the for loop with the range function to loop 8 times.
Prompt the User to enter the numbers from 1- 8.
Ex: Enter number 1 of 8:
Use append() function to populate the list
Use min, max, sum, functions to find the low , high and total number of the list.
Ex: low = min(number_list)
Print the list contents
Print Low, high , total and average numbers of the list.
B) Convert the list created above to a tuple. Print the contents of the tuple in reverse order - each
element of the tuple on a separate line.
Hints:
Use tuple() function on the list to covert it to a tuple. Use slicing expression on the tuple with a
step value of -1 to read the contents in reverse order in a 'for' loop and print each item.
Expected output :
List: [#, #, #, #, #, #, #, #]
Low: #.##
High: #.##
Total: #.##
Average: #.##
Tuple: (#, #, #, #, #, #, #, #)
Tuple contents printed in reverse order:
#
#
...... (8 items printed one after anther)
A) Write a program that asks user to enter a series of 8 different numbers. The program should
store the numbers in a list, then display the following data. 1. The list contents 2. The lowest
number in the list 3. The highest number in the list 4. The total of the numbers in the list 5. The
average of the numbers in the list B) Convert the list created above to a tuple. Print the contents
of the tuple in reverse order - each clement of the tuple on a separate line. Hints:
A) Define main (): Declare variables and initialize them Create an empty list Use the for loop
with the range function to loop 8 times. Prompt the User to enter the numbers from 1- 8. Ex:
Enter number 1 of 8 : Use append() function to populate the list Use min, max, sum, functions to
find the low, high and total number of the list. Ex: low =min( number_list) Print the list contents
Print Low, high, total and average numbers of the list.
B) Use tuple! function on the list to covert it to a tuple. Use slicing expression on the tuple with a
step value of - 1 to read the contents in reverse order in a 'for' loop and print each item. List: [\#,
\#, \#, \#, H,\#, \#, \#] LoW: H. \#\# \# High: A, Total: \#,\#\# \# Average: \#.\#\# H\# Tuple: (\#,
\#, \#, \#,\#, \#,\#,\#) Tuple contents printed in reverse order: \# \# (8 items printed one after
anther).
Olaf and Elsa, husband and wife filing a joint return, operate a s.pdf
Olaf and Elsa, husband and wife filing a joint return, operate a sole proprietorship. They expect
their taxable income next year to be $75,000, of which $70,000 is attributed to the sole
proprietorship. Olaf and Elsa are contemplating incorporating their sole proprietorship. From a
Federal income tax perspective (ignoring any QBI or self-employment taxes), which business
structure is the most advantageous and why?
Multiple Choice
A corporation because their total tax liability is smaller
A sole proprietorship because it is not subject to double taxation
A corporation because it is a separate legal entity
A sole proprietorship because their total tax liability is smaller.
Operating SystemGiven the following informationDraw a timelin.pdf
Operating System
Given the following information:
Draw a timeline analysis for each of the following scheduling algorithms. (It might be helpful to
first compare a start and finish time for each job). Calculate the average turnaround time and
average waiting time for execution of the processes.
a) FCFS
b) SJN
c) SRT
d) Round Robin (using a time quantum of 2, and ignoring context switching)
Operating SystemProcessArrival TimeCPU CycleP104P217P3210P435.
Offer your opinions on the transition of money from hard currency to.pdf
Offer your opinions on the transition of money from hard currency to checking accounts to credit
cards and now to virtual currency like Bitcoin.
Do you think this is or has been an easy transition? Offer some examples of the challenges we
face as a society as currency takes on different forms.
Is it positive or negative? Are there different demographics that see the change positive or
negative?
Thanks.
OPCI�N M�LTIPLE Seleccione todas las respuestas correctas. Puede ha.pdf
OPCIN MLTIPLE: Seleccione todas las respuestas correctas. Puede haber ms de una respuesta
correcta o ninguna respuesta puede ser correcta .
22. Qu seccin transversal tiene una mdula?
a. hoja de dicotilednea
b. raz de dicotilednea
C. tallo de dicotilednea herbcea
d. hoja monocotilednea
mi. raz monocotilednea
F. tallo de monocotilednea
gramo. tallo de dicotilednea leosa
6. Cul es el principal mecanismo de transporte en las plantas no vasculares?
a. difusin
b. translocacin en el floema
C. transpiracin-adhesin-cohesin-smosis en el xilema
7. Qu esperaras que le sucediera a un rbol si un insecto se comiera los meristemas laterales sin
daar ninguna otra parte del rbol?
a. El rbol no sera capaz de realizar la fotosntesis.
b. El rbol no perdera agua por transpiracin.
C. El rbol no sera capaz de absorber agua y minerales.
d. El rbol no podra producir madera ni corteza.
8. La mayor parte del agua absorbida por las races es
a. utilizado para producir glucosa durante la fotosntesis
b almacenado en la vacuola central de las clulas de la raz para que nunca llegue a las hojas
C. perdido en la transpiracin de las hojas
d. transportado a frutas
10. Qu es un reactivo en las reacciones independientes de la luz de la fotosntesis?
a. dixido de carbono
b. glucosa
C. oxgeno
d. agua
19. Qu proceso ocurre en el meristema apical de la punta de una raz?
a. divisin celular
b. alargamiento celular
C. maduracin celular.
ONLY THE LAST QUESTION IS THE POINT OF POST. THE OTHER PAGES ARE BAC.pdf
ONLY THE LAST QUESTION IS THE POINT OF POST. THE OTHER PAGES ARE
BACKGROUND CONTEXT Lab: Differential Expression Differential gene expression provides
the ability for a cell or organism to respond to a constantly changing external environment. The
specific constellation of proteins required for optimal function and growth varies with cellular
age and environmental context. Thus, protein production is carefully regulated by multiple
mechanisms that modulate both transcriptional and translational pathways. Control of
transcription initiation by RNA polymerase is a predominant mechanism for regulating
expression of specific proteins, presumably because it provides maximal conservation of energy
for the cell. We can often observe the consequence of differential transcription due to the
presence or absence of particular proteins or the growth in particular environments. Control can
also occur at translation; the mRNA is synthesized, but only in certain circumstances is it
translated. Control can also occur at the level of protein function; the protein is inactive, or
activity is not observed due to the lack of the substrate. In this lab we will observe differential
expression of two different genes encoded on plasmids. We will analyze transcriptional activity,
translational activity, and protein function. Plasmids are extra-chromosomal DNA. Bacteria often
have plasmids and will replicate the plasmid and pass it to daughter cells (vertical transmission)
and to neighboring cells (horizontal). Plasmids are a mechanism of gene diversity. In order to
stably retain the plasmid, there needs to be some type of metabolic reason for the bacteria to
maintain the plasmid. In other words, the plasmid confers an advantage. Plasmids contain: 1. Ori:
the plasmid may present is low or high copy number. 2. Lab generated plasmids typically also
contain a selectable marker (antibiotic resistance), 3. Additional gene for ease of visual screening
4. Multiple cloning site
pUC19 is one of a series of plasmid cloning vectors created by Joachim Messing and co-workers.
The designation "pUC" is derived from the classical "p" prefix (denoting "plasmid") and the
abbreviation for the University of California, where early work on the plasmid series had been
conducted. It is a circular double stranded DNA and has 2686 base pairs. pUC19 is one of the
most widely used vector molecules as the recombinants, or the cells into which foreign DNA has
been introduced, can be easily distinguished from the non-recombinants based on color
differences of colonies on growth media. pUC18 is similar to pUC19, but the MCS region is
reversed. - pUC 19 has an origin of replication and is maintained at a high copy number. -
pUC19 encodes for an ampicillin resistance gene (amopR), via a -lactamase enzyme that
functions by degrading ampicillin and reducing its toxicity to the host. - It has an N-terminal
fragment of -galactosidase (lacZ) gene of E. coli which allows for visual screening of
recombinant.
Ontario Resources, a natural energy supplier, borrowed $80.7 million.pdf
Ontario Resources, a natural energy supplier, borrowed $80.7 million cash on November 1,
2021, to fund a geological survey. The loan was made by Quebec Banque under a short-term
financing arrangement. Ontario Resources issued a 12-month, 12% promissory note with interest
payable at maturity. Ontario Resources' fiscal period is the calendar year.
Required:
1. Prepare the journal entry for the issuance of the note by Ontario Resources.
2. & 3. Prepare the appropriate adjusting entry for the note by Ontario Resources on December
31, 2021 and journal entry for the payment of the note at maturity..
ONLY THE LAST QUESTION IS THE POINT OF POST. THE OTHER PAGES ARE B.pdf
ONLY THE LAST QUESTION IS THE POINT OF POST. THE OTHER PAGES ARE
BACKGROUND CONTEXT Lab: Differential Expression Differential gene expression provides
the ability for a cell or organism to respond to a constantly changing external environment. The
specific constellation of proteins required for optimal function and growth varies with cellular
age and environmental context. Thus, protein production is carefully regulated by multiple
mechanisms that modulate both transcriptional and translational pathways. Control of
transcription initiation by RNA polymerase is a predominant mechanism for regulating
expression of specific proteins, presumably because it provides maximal conservation of energy
for the cell. We can often observe the consequence of differential transcription due to the
presence or absence of particular proteins or the growth in particular environments. Control can
also occur at translation; the mRNA is synthesized, but only in certain circumstances is it
translated. Control can also occur at the level of protein function; the protein is inactive, or
activity is not observed due to the lack of the substrate. In this lab we will observe differential
expression of two different genes encoded on plasmids. We will analyze transcriptional activity,
translational activity, and protein function. Plasmids are extra-chromosomal DNA. Bacteria often
have plasmids and will replicate the plasmid and pass it to daughter cells (vertical transmission)
and to neighboring cells (horizontal). Plasmids are a mechanism of gene diversity. In order to
stably retain the plasmid, there needs to be some type of metabolic reason for the bacteria to
maintain the plasmid. In other words, the plasmid confers an advantage. Plasmids contain: 1. Ori:
the plasmid may present is low or high copy number. 2. Lab generated plasmids typically also
contain a selectable marker (antibiotic resistance), 3. Additional gene for ease of visual screening
4. Multiple cloning site
pUC19 is one of a series of plasmid cloning vectors created by Joachim Messing and co-workers.
The designation "pUC" is derived from the classical "p" prefix (denoting "plasmid") and the
abbreviation for the University of California, where early work on the plasmid series had been
conducted. It is a circular double stranded DNA and has 2686 base pairs. pUC19 is one of the
most widely used vector molecules as the recombinants, or the cells into which foreign DNA has
been introduced, can be easily distinguished from the non-recombinants based on color
differences of colonies on growth media. pUC18 is similar to pUC19, but the MCS region is
reversed. - pUC 19 has an origin of replication and is maintained at a high copy number. -
pUC19 encodes for an ampicillin resistance gene (amopR), via a -lactamase enzyme that
functions by degrading ampicillin and reducing its toxicity to the host. - It has an N-terminal
fragment of -galactosidase (lacZ) gene of E. coli which allows for visual screening of
recombinant.
only answer Let X1,X2,X3,� be independent identically distributed.pdf
only answer Let X1,X2,X3, be independent identically distributed random variables, with
E(Xi)=,Var(Xi)=20. Let Sn=X1+X2+X3++Xn Let Mn=Snn. Then Mn is a martingale with
respect to Xn for = to: i) ii) 2 iii) n iv) v) vi) none of the above.
only answer Let (Bt,t0) be the standard Brownian motion. Consider.pdf
only answer Let (Bt,t0) be the standard Brownian motion. Consider the following processes:
Xt=0t(12s)dBs,Yt=0t(1+2s)dBs Let t>0. The Xt,Yt are uncorrelated for t= i) 3/4 ii) 5/2 iii) 6/2
iv) 3/2 v) 7/4 vi) none of the above.
One way that threat actors can cause DNS poisoning is by putting fal.pdf
One way that threat actors can cause DNS poisoning is by putting false information in the host
file on a PC (30 points)
Demonstrate that you can find the actual address for mga.edu.
Then create an entry in the host file on your Windows VM mapping mga.edu to 172.16.1.1
Demonstrate the misdirection from the command line by pinging mga.edu.
Then create an entry in the host file on your Linux VM mapping mga.edu to 172.16.1.2
Demonstrate the misdirection from the command line by pinging mga.edu..
One of the following is not consistent with the modern view of quali.pdf
One of the following is not consistent with the modern view of quality: Group of answer choices
Production systems should evolve continuously; improving quality leads to learning.
Achieving quality is a shared responsibility of everyone in the organization
Zero defects is an appropriate goal because it forces continuous learning
When something goes wrong, it is the fault of the worker at the failure point..
Notesi.Carson inc. does not have any short-term investmentii. P.pdf
Notes:
i.Carson inc. does not have any short-term investment
ii. Property & Equipment here is reported as Net term
iii. Debt reported here is long-term debt and the firm does not have any short-term debt.
iv. Carson inc. is not a dividend paying firm
What is the Net Cash Flow for the year 2017?.
One of the following is NOT an appraisal cost Group of answer choic.pdf
One of the following is NOT an appraisal cost: Group of answer choices
Retailer hires secret shoppers to test customer-facing retail services
Paying for supervisors to get trained in the use statistical process control tools
Paying for more inspectors to test product during the production process
Paying more for software programmers with a masters degree.
one i tried but it was wrong An investigatof briefly incubates a li.pdf
one i tried but it was wrong An investigatof briefly incubates a liver extract capable of carrying
out all the normal metalolic reactions of the liver in separa esperiments with two different 14 C-
labelod precursors: [14 C]bearbonate abd [1-14 C]pyruvase. Trace the pathway of 14
Clboserbonate through glucotsoogenesis. Use an asterisk to indicane the location of 14C in all
incermediates and in the final glaocacogenesis pooduce, glucose.
trermedares and in the tiral placorocpeadin prothct, p leses..
More from amzonknr (20)
Nursing 131Nursing 131 28. The 72 year old client has experi.pdf
Nursing 131Nursing 131 28. The 72 year old client has experi.pdf
Noye The distance of the moon from Earths surface is 3.84 10^8 m. .pdf
Noye The distance of the moon from Earths surface is 3.84 10^8 m. .pdf
Number of cells log lable the phases below help All the people li.pdf
Number of cells log lable the phases below help All the people li.pdf
O A.termite B.lead paintC. radonD. well and drinki.pdf
O A.termite B.lead paintC. radonD. well and drinki.pdf
number cube with the numbers 1 through 6 is rolled nine times. If th.pdf
number cube with the numbers 1 through 6 is rolled nine times. If th.pdf
numanalysis.py (30 points)A) Write a program that asks user to.pdf
numanalysis.py (30 points)A) Write a program that asks user to.pdf
Olaf and Elsa, husband and wife filing a joint return, operate a s.pdf
Olaf and Elsa, husband and wife filing a joint return, operate a s.pdf
Operating SystemGiven the following informationDraw a timelin.pdf
Operating SystemGiven the following informationDraw a timelin.pdf
Offer your opinions on the transition of money from hard currency to.pdf
Offer your opinions on the transition of money from hard currency to.pdf
OPCI�N M�LTIPLE Seleccione todas las respuestas correctas. Puede ha.pdf
OPCI�N M�LTIPLE Seleccione todas las respuestas correctas. Puede ha.pdf
ONLY THE LAST QUESTION IS THE POINT OF POST. THE OTHER PAGES ARE BAC.pdf
ONLY THE LAST QUESTION IS THE POINT OF POST. THE OTHER PAGES ARE BAC.pdf
Ontario Resources, a natural energy supplier, borrowed $80.7 million.pdf
Ontario Resources, a natural energy supplier, borrowed $80.7 million.pdf
ONLY THE LAST QUESTION IS THE POINT OF POST. THE OTHER PAGES ARE B.pdf
ONLY THE LAST QUESTION IS THE POINT OF POST. THE OTHER PAGES ARE B.pdf
only answer Let X1,X2,X3,� be independent identically distributed.pdf
only answer Let X1,X2,X3,� be independent identically distributed.pdf
only answer Let (Bt,t0) be the standard Brownian motion. Consider.pdf
only answer Let (Bt,t0) be the standard Brownian motion. Consider.pdf
One way that threat actors can cause DNS poisoning is by putting fal.pdf
One way that threat actors can cause DNS poisoning is by putting fal.pdf
One of the following is not consistent with the modern view of quali.pdf
One of the following is not consistent with the modern view of quali.pdf
Notesi.Carson inc. does not have any short-term investmentii. P.pdf
Notesi.Carson inc. does not have any short-term investmentii. P.pdf
One of the following is NOT an appraisal cost Group of answer choic.pdf
One of the following is NOT an appraisal cost Group of answer choic.pdf
one i tried but it was wrong An investigatof briefly incubates a li.pdf
one i tried but it was wrong An investigatof briefly incubates a li.pdf
Recently uploaded
The French Revolution Class 9 Study Material pdf free download
The French Revolution, which began in 1789, was a period of radical social and political upheaval in France. It marked the decline of absolute monarchies, the rise of secular and democratic republics, and the eventual rise of Napoleon Bonaparte. This revolutionary period is crucial in understanding the transition from feudalism to modernity in Europe.
For more information, visit-www.vavaclasses.com
Unit 8 - Information and Communication Technology (Paper I).pdf
This slides describes the basic concepts of ICT, basics of Email, Emerging Technology and Digital Initiatives in Education. This presentations aligns with the UGC Paper I syllabus.
Biological Screening of Herbal Drugs in detailed.
Biological screening of herbal drugs: Introduction and Need for
Phyto-Pharmacological Screening, New Strategies for evaluating
Natural Products, In vitro evaluation techniques for Antioxidants, Antimicrobial and Anticancer drugs. In vivo evaluation techniques
for Anti-inflammatory, Antiulcer, Anticancer, Wound healing, Antidiabetic, Hepatoprotective, Cardio protective, Diuretics and
Antifertility, Toxicity studies as per OECD guidelines
Advantages and Disadvantages of CMS from an SEO Perspective
Advantages and Disadvantages of CMS from an SEO Perspective
Mule 4.6 & Java 17 Upgrade | MuleSoft Mysore Meetup #46
Mule 4.6 & Java 17 Upgrade | MuleSoft Mysore Meetup #46
Event Link:-
https://meetups.mulesoft.com/events/details/mulesoft-mysore-presents-exploring-gemini-ai-and-integration-with-mulesoft/
Agenda
● Java 17 Upgrade Overview
● Why and by when do customers need to upgrade to Java 17?
● Is there any immediate impact to upgrading to Mule Runtime 4.6 and beyond?
● Which MuleSoft products are in scope?
For Upcoming Meetups Join Mysore Meetup Group - https://meetups.mulesoft.com/mysore/
YouTube:- youtube.com/@mulesoftmysore
Mysore WhatsApp group:- https://chat.whatsapp.com/EhqtHtCC75vCAX7gaO842N
Speaker:-
Shubham Chaurasia - https://www.linkedin.com/in/shubhamchaurasia1/
Priya Shaw - https://www.linkedin.com/in/priya-shaw
Organizers:-
Shubham Chaurasia - https://www.linkedin.com/in/shubhamchaurasia1/
Giridhar Meka - https://www.linkedin.com/in/giridharmeka
Priya Shaw - https://www.linkedin.com/in/priya-shaw
Shyam Raj Prasad-
https://www.linkedin.com/in/shyam-raj-prasad/
MASS MEDIA STUDIES-835-CLASS XI Resource Material.pdf
mass media studies
CBSE
Full Book
for class 11th
special B.ed 2nd year old paper_20240531.pdf
Instagram:-
https://instagram.com/special_education_needs_01?igshid=YmMyMTA2M2Y=
WhatsApp:-
https://chat.whatsapp.com/JVakNIYlSV94x7bwunO3Dc
YouTube:-
https://youtube.com/@special_education_needs
Teligram :- https://t.me/special_education_needs
Slide Shere :-
https://www.slideshare.net/shabnambano20?utm_campaign=profiletracking&utm_medium=sssite&utm_source=ssslideview
Unit 2- Research Aptitude (UGC NET Paper I).pdf
This slide describes the research aptitude of unit 2 in the UGC NET paper I.
The approach at University of Liverpool.pptx
How libraries can support authors with open access requirements for UKRI funded books
Wednesday 22 May 2024, 14:00-15:00.
Model Attribute Check Company Auto Property
In Odoo, the multi-company feature allows you to manage multiple companies within a single Odoo database instance. Each company can have its own configurations while still sharing common resources such as products, customers, and suppliers.
CACJapan - GROUP Presentation 1- Wk 4.pdf
Macroeconomics- Movie Location
This will be used as part of your Personal Professional Portfolio once graded.
Objective:
Prepare a presentation or a paper using research, basic comparative analysis, data organization and application of economic information. You will make an informed assessment of an economic climate outside of the United States to accomplish an entertainment industry objective.
How to Make a Field invisible in Odoo 17
It is possible to hide or invisible some fields in odoo. Commonly using “invisible” attribute in the field definition to invisible the fields. This slide will show how to make a field invisible in odoo 17.
Thesis Statement for students diagnonsed withADHD.ppt
Presentation required for the master in Education.
Chapter -12, Antibiotics (One Page Notes).pdf
This is a notes for the D.Pharm students and related to the antibiotic drugs.
Synthetic Fiber Construction in lab .pptx
Synthetic fiber production is a fascinating and complex field that blends chemistry, engineering, and environmental science. By understanding these aspects, students can gain a comprehensive view of synthetic fiber production, its impact on society and the environment, and the potential for future innovations. Synthetic fibers play a crucial role in modern society, impacting various aspects of daily life, industry, and the environment. ynthetic fibers are integral to modern life, offering a range of benefits from cost-effectiveness and versatility to innovative applications and performance characteristics. While they pose environmental challenges, ongoing research and development aim to create more sustainable and eco-friendly alternatives. Understanding the importance of synthetic fibers helps in appreciating their role in the economy, industry, and daily life, while also emphasizing the need for sustainable practices and innovation.
Recently uploaded (20)
The French Revolution Class 9 Study Material pdf free download
The French Revolution Class 9 Study Material pdf free download
Unit 8 - Information and Communication Technology (Paper I).pdf
Unit 8 - Information and Communication Technology (Paper I).pdf
Advantages and Disadvantages of CMS from an SEO Perspective
Advantages and Disadvantages of CMS from an SEO Perspective
Mule 4.6 & Java 17 Upgrade | MuleSoft Mysore Meetup #46
Mule 4.6 & Java 17 Upgrade | MuleSoft Mysore Meetup #46
MASS MEDIA STUDIES-835-CLASS XI Resource Material.pdf
MASS MEDIA STUDIES-835-CLASS XI Resource Material.pdf
Pride Month Slides 2024 David Douglas School District
Pride Month Slides 2024 David Douglas School District
Multithreading_in_C++ - std::thread, race condition
Multithreading_in_C++ - std::thread, race condition
Thesis Statement for students diagnonsed withADHD.ppt
Thesis Statement for students diagnonsed withADHD.ppt
Objective The objective of project is to practice using Pythons GUI .pdf
- 1. Objective The objective of project is to practice using Pythons GUI Tkinter. You must use Tkinter and no other GUI product. Description For this project, design a small (i.e. 2x3) GUI window which contains 4 items: 1) a text keyin field, 2) an Execute button, 3) an Exit Button and 4) a label. When the user clicks on the Execute button, the text located in the keyin field will be displayed on the label. If the keyin field contains no text, a message box should display saying No Text to Display. When the user clicks on the Exit button, the program should terminate. Therefore use the Tkinter destroy() method. Do not use sys.exit(). Your program must be thoroughly commented/documented as defined in the previous projects. Use beginner python.