The document provides equations and definitions relating to mass, ionic strength, extinction coefficients, thermodynamics, kinetics, and empirical rate constants for nucleic acid hybridization and structure. Specifically, it defines equations for mass, ionic strength, linear and circular dichroism extinction coefficients, Gibbs free energy, equilibrium distributions for single and multiple equilibria, first and second order reaction kinetics, melting temperatures, and provides sample empirical association rate constants for RNA and DNA self-hybridization.
1. The document contains 40 multiple choice questions from a physics exam.
2. The questions cover topics in physics including optics, electromagnetism, mechanics, thermodynamics, and modern physics.
3. For each question, 4 possible answers are provided and the test taker must select the correct answer.
This 3 sentence summary provides the high level information about the document:
The document is an unsolved physics paper from 2007 that contains 29 multiple choice questions about various physics concepts. The questions cover topics like mechanics, electromagnetism, optics, modern physics, and thermodynamics. Each question has 4 possible answer choices, with only one being correct. The document tests conceptual understanding of fundamental physics principles through multiple choice problem solving.
Resolving the dissociation catastrophe in fluctuating-charge modelsJiahao Chen
The document discusses issues that arise when using fluctuating charge models to describe chemical systems. It summarizes the concept of fluctuating charges based on electronegativity equalization. However, this leads to an unphysical "dissociation catastrophe" where charges do not decay to zero at infinite separation. The document proposes fixing this by introducing distance-dependent electronegativity or charge transfer variables between atoms to attenuate long-range charge transfer. It also discusses the topological relationship between charge transfer variables and atomic charges to convert between representations.
This document defines key terms and concepts related to arcs of circles such as central angle, minor arc, major arc, semicircle, and how to calculate arc measures. It introduces the arc addition postulate which states the measure of an arc is equal to the sum of the measures of its interior arcs. Finally, it notes that congruent circles have congruent arcs of the same measure.
MSEASUSlides: Muddiest Point: Phase Diagrams I Eutectic Calculations and…mseasuslides
This slide set corresponds to the MaterialsConcepts YouTube video "Muddiest Point- Phase Diagrams I: Eutectic Calculations and Lever Rule ". Here is the link:
http://www.youtube.com/watch?v=h5dwpTqacqc
To study the vocab used in this video, visit this site:
http://quizlet.com/20699402/51-phase-diagram-concepts-and-terms-flash-cards/
This work was supported by NSF Grants #0836041 and #1226325.
1) The document defines key terms related to arcs and angles in circles such as central angle, minor arc, major arc, semicircle, and explains how to calculate the measure of minor and major arcs.
2) It introduces the arc addition postulate which states that the measure of an arc is equal to the sum of the measures of its interior arcs.
3) Finally, it notes that congruent arcs have the same measure and are found in congruent circles with the same radius.
At Apex Institute, we endeavour to amalgamate the ancient values of uttermost dedication and responsibility that gave teaching a very pious and sacred status, with latest teaching methodologies so as to make the act of learning, a delectable experience. The arduous task is accomplished by a team of diligent academicians and entrepreneurs, who with the years of experience have mastered the techniques to transform even the most abstruse topics easy to comprehend.
Great emphasis is laid on the concepts and fundamentals with a smooth and systematic transition to the advanced levels of teaching. The interaction between students and teachers is always encouraged so as to provide a very healthy environment for growth and learning. During the process of training the students for IIT-JEE/Engg./Medical entrance examinations, great emphasis is laid on the fundamentals so as to excel in the CBSE examination also.
Illustrious faculty and excellent teaching techniques provide you will an infallible approach to success only at Apex Institute.
Our Mission
Generating excellence both in academic and competitive aspects thereby training the youth for most gruelling entrance level exams viz. IIT-JEE/Engg.& Medical entrance.
Our Vision
Generating excellence in academic, exploring creative areas of the dormant self, nurturing talent & aptitude & including perseverance among the students to keep themselves abreast of the latest developments in the field of competitive examinations.
Our Objectives
1. Striving for the best possible education to ambitious students aspiring to join corporate world as medical professionals.
2. Creating a comprehensive understanding of the subjects & help developing strategies to meet arduous competitions among the students to match, excel & ameliorate the competition oriented education.
1. The document provides 30 multiple choice questions related to chemistry.
2. The questions cover topics such as bond energies, organic reactions, IUPAC names, properties of gases, acid-base chemistry, and more.
3. Multiple choice options with a single correct answer are provided for each question.
1. The document contains 40 multiple choice questions from a physics exam.
2. The questions cover topics in physics including optics, electromagnetism, mechanics, thermodynamics, and modern physics.
3. For each question, 4 possible answers are provided and the test taker must select the correct answer.
This 3 sentence summary provides the high level information about the document:
The document is an unsolved physics paper from 2007 that contains 29 multiple choice questions about various physics concepts. The questions cover topics like mechanics, electromagnetism, optics, modern physics, and thermodynamics. Each question has 4 possible answer choices, with only one being correct. The document tests conceptual understanding of fundamental physics principles through multiple choice problem solving.
Resolving the dissociation catastrophe in fluctuating-charge modelsJiahao Chen
The document discusses issues that arise when using fluctuating charge models to describe chemical systems. It summarizes the concept of fluctuating charges based on electronegativity equalization. However, this leads to an unphysical "dissociation catastrophe" where charges do not decay to zero at infinite separation. The document proposes fixing this by introducing distance-dependent electronegativity or charge transfer variables between atoms to attenuate long-range charge transfer. It also discusses the topological relationship between charge transfer variables and atomic charges to convert between representations.
This document defines key terms and concepts related to arcs of circles such as central angle, minor arc, major arc, semicircle, and how to calculate arc measures. It introduces the arc addition postulate which states the measure of an arc is equal to the sum of the measures of its interior arcs. Finally, it notes that congruent circles have congruent arcs of the same measure.
MSEASUSlides: Muddiest Point: Phase Diagrams I Eutectic Calculations and…mseasuslides
This slide set corresponds to the MaterialsConcepts YouTube video "Muddiest Point- Phase Diagrams I: Eutectic Calculations and Lever Rule ". Here is the link:
http://www.youtube.com/watch?v=h5dwpTqacqc
To study the vocab used in this video, visit this site:
http://quizlet.com/20699402/51-phase-diagram-concepts-and-terms-flash-cards/
This work was supported by NSF Grants #0836041 and #1226325.
1) The document defines key terms related to arcs and angles in circles such as central angle, minor arc, major arc, semicircle, and explains how to calculate the measure of minor and major arcs.
2) It introduces the arc addition postulate which states that the measure of an arc is equal to the sum of the measures of its interior arcs.
3) Finally, it notes that congruent arcs have the same measure and are found in congruent circles with the same radius.
At Apex Institute, we endeavour to amalgamate the ancient values of uttermost dedication and responsibility that gave teaching a very pious and sacred status, with latest teaching methodologies so as to make the act of learning, a delectable experience. The arduous task is accomplished by a team of diligent academicians and entrepreneurs, who with the years of experience have mastered the techniques to transform even the most abstruse topics easy to comprehend.
Great emphasis is laid on the concepts and fundamentals with a smooth and systematic transition to the advanced levels of teaching. The interaction between students and teachers is always encouraged so as to provide a very healthy environment for growth and learning. During the process of training the students for IIT-JEE/Engg./Medical entrance examinations, great emphasis is laid on the fundamentals so as to excel in the CBSE examination also.
Illustrious faculty and excellent teaching techniques provide you will an infallible approach to success only at Apex Institute.
Our Mission
Generating excellence both in academic and competitive aspects thereby training the youth for most gruelling entrance level exams viz. IIT-JEE/Engg.& Medical entrance.
Our Vision
Generating excellence in academic, exploring creative areas of the dormant self, nurturing talent & aptitude & including perseverance among the students to keep themselves abreast of the latest developments in the field of competitive examinations.
Our Objectives
1. Striving for the best possible education to ambitious students aspiring to join corporate world as medical professionals.
2. Creating a comprehensive understanding of the subjects & help developing strategies to meet arduous competitions among the students to match, excel & ameliorate the competition oriented education.
1. The document provides 30 multiple choice questions related to chemistry.
2. The questions cover topics such as bond energies, organic reactions, IUPAC names, properties of gases, acid-base chemistry, and more.
3. Multiple choice options with a single correct answer are provided for each question.
Este documento presenta una guía de estudio sobre química orgánica heterocíclica y polímeros. Incluye preguntas sobre cómo sintetizar diversas moléculas orgánicas como el ibuprofeno, ácido p-aminobenzoico y aspirina a partir de compuestos como el isobutilbenceno, tolueno y benceno utilizando reacciones como alquilaciones, reducciones, oxidaciones y sustituciones nucleofílicas. También incluye preguntas sobre mecanismos de reacción como la degradación
This document discusses different types of parasitic worms (helminths) that can infect humans, including roundworms, whipworms, and flatworms. It provides details on common roundworm infections like ascariasis and trichuriasis. Flatworms discussed are tapeworms like Taenia solium and Taenia saginata transmitted via undercooked pork and beef. The document also briefly mentions trematodes or flukes, like Schistosoma japonicum, which is a zoonotic parasite with a wide host range.
The Book of Soyga, also titled Aldaraia, is a 16th-century Latin treatise on magic, one copy of which is known to have been possessed by the Elizabethan scholar John Dee.
This document provides an introduction to using Adobe Photoshop CS6. It discusses getting started with Photoshop and setting up documents. It describes the interface layout including the menu bar, toolbar, image window, and main palettes. It explains the basic selection, alteration, drawing and selection tools. It covers using color boxes and modes and provides an overview of basic image editing techniques like cropping, resizing, correcting and saving images.
Son algunos ejercicios de mecanismos de reacción para moleculas orgánicas aplicando los principios de aromaticidad, química de éteres, de alcoholes y de sustituciones SNA y SN2
Apuntes de ecuaciones exponenciales cuyos conceptos son una guía en la resolución de este tipo de ecuaciones vistas en los cursos de álgebra lineal y/o superior
Determinación de la segunda ley de newton a partir del momentum(ingeniería qu...Eder Yair Nolasco Terrón
Este documento demuestra la segunda ley de Newton (aceleración) a partir de la definición de momento o impulso. Aplica la regla de la cadena a la definición de momento con respecto al tiempo para obtener que la derivada del momento con respecto al tiempo es igual a la suma de las fuerzas. Luego, al sustituir la derivada de la velocidad con respecto al tiempo por la aceleración, se obtiene la ecuación fundamental de la segunda ley de Newton: la suma de las fuerzas es igual a la masa por la aceleración.
Se habla en este texto de la cinética de crecimiento para un cultivo puro y del coeficiente de transferencia de oxígeno Kla en un biorreactor y los pasos para la transferencia de masa del seno del gas hasta la célula
La oxidación de Jones es un método químico utilizado para convertir alcoholes primarios en aldehídos. Un estudiante llamado Nolasco Terrón Eder Yair del grupo 35 presentó un trabajo sobre la oxidación de Jones como parte de su curso de química orgánica en la Universidad Autónoma del Estado de México.
This document outlines the organizational structure and roles of a hospital infection control committee. It includes descriptions of committee members such as the infection control nurse, medical technologist, and representatives from various clinical departments. It also discusses the hospital's infection control strategies, including post-culture cleaning, liquid soap/handwashing, infectious waste segregation, and patient education. Needlestick injury protocols are also mentioned for two example hospitals.
Self-replicating Molecules: An introductionBrian Frezza
The document discusses various methods of chemical self-replication, including ligation-based systems using hexadeoxynucleotides, RNA ligase, and peptides that have demonstrated exponential or near-exponential amplification. It also describes cleavage-based self-replication by ribozymes, compartmentalization-based systems using reverse micelles and encapsulated reagents, and conformation-based systems like hybridization chain reactions and prion-like protein aggregation. The document concludes that while examples of classic template-directed ligation self-replication have been achieved, more work is still needed to improve catalytic efficiencies and explore new forms and applications of chemical self-replication.
The document is a 42 page document titled "Clinical parasitology" by Janela Fe P. Badival. It discusses various topics related to clinical parasitology over its 42 pages but provides no other contextual information about the content or purpose of the document.
The Ape, the Adman, and the Astronaut: Rediscovering the power of storytellin...Ogilvy
This document discusses the power of storytelling and its importance in persuasion and communication. It begins by summarizing David Ogilvy's use of storytelling to successfully sell cookers as a door-to-door salesman. It then discusses how storytelling is hardwired into human brains based on neurological research. Several examples are provided, including how children instinctively assign human characteristics like goals and emotions to abstract things. The document advocates that stories are more effective than facts or logic at generating emotion and persuading people.
An Introduction To Doing Business in VietnamQuynh LE
The document provides an overview of establishing and conducting business in Vietnam. It discusses the main options for foreign investment including 100% foreign-owned enterprises and joint ventures. When establishing a company, the first step is to acquire an Investment Certificate which takes 15-37 working days depending on the industry and approval required. Key positions in companies include the Member's Council, General Director, and Board of Supervision. Major taxes in Vietnam include business license tax, corporate income tax, value-added tax, special consumption tax, and foreign contractor tax. Compliance requirements include tax registration, accounting practices, and audit requirements.
Codex Seraphinianus, originally published in 1981, is an illustrated encyclopedia of an imaginary world, created by the Italian artist, architect, and industrial designer Luigi Serafini during thirty months, from 1976 to 1978.
The Material Balance for Chemical ReactorsMagnusMG
This document discusses material balances for chemical reactors. It begins by presenting the general mole balance equation, which states that the rate of accumulation of a chemical component in a reactor volume equals the rate of inflow minus the rate of outflow, plus any generation of that component via chemical reactions.
The document then examines several examples of applying this general balance to specific reaction kinetics, including first-order irreversible and reversible reactions, second-order reactions, and nth-order reactions. It also discusses reactions that exhibit inhibition and series reactions involving multiple steps. Analytical solutions are derived for the concentration profiles of chemical components in batch reactors under these different kinetic models.
This document discusses various datapath subsystems used in VLSI systems, including adders, multipliers, comparators, counters, and shifters. It focuses on adders, describing how a basic N-bit carry-ripple adder works and its drawbacks. Optimized adder designs are then presented, including a mirror adder that reduces area and propagation delay by exploiting the self-dual property of full adders. Faster ripple carry adders can also be created by minimizing the critical carry path using modified full adder cells without inverters in the carry path.
Este documento presenta una guía de estudio sobre química orgánica heterocíclica y polímeros. Incluye preguntas sobre cómo sintetizar diversas moléculas orgánicas como el ibuprofeno, ácido p-aminobenzoico y aspirina a partir de compuestos como el isobutilbenceno, tolueno y benceno utilizando reacciones como alquilaciones, reducciones, oxidaciones y sustituciones nucleofílicas. También incluye preguntas sobre mecanismos de reacción como la degradación
This document discusses different types of parasitic worms (helminths) that can infect humans, including roundworms, whipworms, and flatworms. It provides details on common roundworm infections like ascariasis and trichuriasis. Flatworms discussed are tapeworms like Taenia solium and Taenia saginata transmitted via undercooked pork and beef. The document also briefly mentions trematodes or flukes, like Schistosoma japonicum, which is a zoonotic parasite with a wide host range.
The Book of Soyga, also titled Aldaraia, is a 16th-century Latin treatise on magic, one copy of which is known to have been possessed by the Elizabethan scholar John Dee.
This document provides an introduction to using Adobe Photoshop CS6. It discusses getting started with Photoshop and setting up documents. It describes the interface layout including the menu bar, toolbar, image window, and main palettes. It explains the basic selection, alteration, drawing and selection tools. It covers using color boxes and modes and provides an overview of basic image editing techniques like cropping, resizing, correcting and saving images.
Son algunos ejercicios de mecanismos de reacción para moleculas orgánicas aplicando los principios de aromaticidad, química de éteres, de alcoholes y de sustituciones SNA y SN2
Apuntes de ecuaciones exponenciales cuyos conceptos son una guía en la resolución de este tipo de ecuaciones vistas en los cursos de álgebra lineal y/o superior
Determinación de la segunda ley de newton a partir del momentum(ingeniería qu...Eder Yair Nolasco Terrón
Este documento demuestra la segunda ley de Newton (aceleración) a partir de la definición de momento o impulso. Aplica la regla de la cadena a la definición de momento con respecto al tiempo para obtener que la derivada del momento con respecto al tiempo es igual a la suma de las fuerzas. Luego, al sustituir la derivada de la velocidad con respecto al tiempo por la aceleración, se obtiene la ecuación fundamental de la segunda ley de Newton: la suma de las fuerzas es igual a la masa por la aceleración.
Se habla en este texto de la cinética de crecimiento para un cultivo puro y del coeficiente de transferencia de oxígeno Kla en un biorreactor y los pasos para la transferencia de masa del seno del gas hasta la célula
La oxidación de Jones es un método químico utilizado para convertir alcoholes primarios en aldehídos. Un estudiante llamado Nolasco Terrón Eder Yair del grupo 35 presentó un trabajo sobre la oxidación de Jones como parte de su curso de química orgánica en la Universidad Autónoma del Estado de México.
This document outlines the organizational structure and roles of a hospital infection control committee. It includes descriptions of committee members such as the infection control nurse, medical technologist, and representatives from various clinical departments. It also discusses the hospital's infection control strategies, including post-culture cleaning, liquid soap/handwashing, infectious waste segregation, and patient education. Needlestick injury protocols are also mentioned for two example hospitals.
Self-replicating Molecules: An introductionBrian Frezza
The document discusses various methods of chemical self-replication, including ligation-based systems using hexadeoxynucleotides, RNA ligase, and peptides that have demonstrated exponential or near-exponential amplification. It also describes cleavage-based self-replication by ribozymes, compartmentalization-based systems using reverse micelles and encapsulated reagents, and conformation-based systems like hybridization chain reactions and prion-like protein aggregation. The document concludes that while examples of classic template-directed ligation self-replication have been achieved, more work is still needed to improve catalytic efficiencies and explore new forms and applications of chemical self-replication.
The document is a 42 page document titled "Clinical parasitology" by Janela Fe P. Badival. It discusses various topics related to clinical parasitology over its 42 pages but provides no other contextual information about the content or purpose of the document.
The Ape, the Adman, and the Astronaut: Rediscovering the power of storytellin...Ogilvy
This document discusses the power of storytelling and its importance in persuasion and communication. It begins by summarizing David Ogilvy's use of storytelling to successfully sell cookers as a door-to-door salesman. It then discusses how storytelling is hardwired into human brains based on neurological research. Several examples are provided, including how children instinctively assign human characteristics like goals and emotions to abstract things. The document advocates that stories are more effective than facts or logic at generating emotion and persuading people.
An Introduction To Doing Business in VietnamQuynh LE
The document provides an overview of establishing and conducting business in Vietnam. It discusses the main options for foreign investment including 100% foreign-owned enterprises and joint ventures. When establishing a company, the first step is to acquire an Investment Certificate which takes 15-37 working days depending on the industry and approval required. Key positions in companies include the Member's Council, General Director, and Board of Supervision. Major taxes in Vietnam include business license tax, corporate income tax, value-added tax, special consumption tax, and foreign contractor tax. Compliance requirements include tax registration, accounting practices, and audit requirements.
Codex Seraphinianus, originally published in 1981, is an illustrated encyclopedia of an imaginary world, created by the Italian artist, architect, and industrial designer Luigi Serafini during thirty months, from 1976 to 1978.
The Material Balance for Chemical ReactorsMagnusMG
This document discusses material balances for chemical reactors. It begins by presenting the general mole balance equation, which states that the rate of accumulation of a chemical component in a reactor volume equals the rate of inflow minus the rate of outflow, plus any generation of that component via chemical reactions.
The document then examines several examples of applying this general balance to specific reaction kinetics, including first-order irreversible and reversible reactions, second-order reactions, and nth-order reactions. It also discusses reactions that exhibit inhibition and series reactions involving multiple steps. Analytical solutions are derived for the concentration profiles of chemical components in batch reactors under these different kinetic models.
This document discusses various datapath subsystems used in VLSI systems, including adders, multipliers, comparators, counters, and shifters. It focuses on adders, describing how a basic N-bit carry-ripple adder works and its drawbacks. Optimized adder designs are then presented, including a mirror adder that reduces area and propagation delay by exploiting the self-dual property of full adders. Faster ripple carry adders can also be created by minimizing the critical carry path using modified full adder cells without inverters in the carry path.
The document reviews concepts of uniaxial loading, stress, strain, stress-strain relationships, force-displacement relationships, and deformation and displacement in mechanical structures. It provides an example of calculating forces and displacements in a statically determinate truss. The document outlines an algorithm to determine displacements at point B by considering compatibility of displacements for given forces.
NEW LORENTZ TRANSFORMATION/NUEVAS TRANSFORMACIONES DE LORENTZXavier Terri
The document presents new relational transformations called the Lorentz's Transformations which directly transform spacetime coordinates from one reference frame to another. The transformations relate the time and spatial coordinates between two reference frames in motion relative to each other, and include terms for the relative velocity between the frames. A local relational metric is also defined which depends on the relative velocity between reference frames.
This document contains summaries of several chapters that describe chemical engineering processes and calculations. Key details include:
1) Material balances for continuous, transient and steady-state systems.
2) Rate equations and calculations for steady-state reactor systems.
3) Multiple examples of setting up and solving material balances and rate equations to determine flow rates and compositions.
4) Process flow diagrams and descriptions for several chemical processes including distillation columns.
This document discusses material balances for chemical reactors. It begins by introducing the general mole balance equation that applies a conservation of mass principle to chemical components in a reactor system. It then provides analytical solutions to the mole balance equation for some common reaction rate expressions including first-order reversible and irreversible reactions, second-order reactions, and reactions with general nth-order kinetics. It also discusses solutions for series reactions and reactions exhibiting inhibition. The document aims to develop fundamental equations for modeling different reactor systems based on reaction kinetics and component material balances.
L7b Pressure drop, CSTR start up and semibatch reactors examples.pptxPatelkevinJayeshkuma
- The document describes the start-up of a continuous stirred tank reactor (CSTR) operating under isothermal conditions for a first-order irreversible reaction.
- Mathematical models are developed to determine the concentration of the reactant A (CA) as a function of time during the transient period before reaching steady-state.
- It is shown that CA will reach 99% of its steady-state value when t = 4.6τ, where τ is the characteristic time for the reactor.
- Methods for analyzing semi-batch reactors are also presented, including mole balances to determine how CA and CB change over time for a reversible reaction.
- The trigonometric ratios of sine, cosine, and tangent can be used to find the measures of angles in right triangles.
- For a given angle, the trig ratios are defined as the ratio of the length of the side opposite to the angle over the length of the hypotenuse (sine), the ratio of the length of the side adjacent to the angle over the hypotenuse (cosine), and the ratio of the opposite side over the adjacent side (tangent).
- The inverse trig functions (cotangent, secant, cosecant) are defined in terms of the tangent, cosine, and sine ratios respectively.
1. The document contains trigonometric ratios (sine, cosine, tangent) for various angles from 21 degrees to 69 degrees.
2. It also shows calculations using trigonometric identities to find values of trig functions for angles between the degrees listed, such as finding sin(22.5) using sin(22) and sin(23).
3. The relationships between trig functions are demonstrated, such as tan(A) = cot(90-A) and sin(A) = cos(90-A).
The document provides an overview of the bipolar junction transistor (BJT) including:
1) It describes the basic structure and operation of npn and pnp BJTs.
2) It explains the relationships between different BJT parameters such as beta, alpha, collector current, base current, and emitter current.
3) It covers the three main modes of BJT operation - active, saturation, and cutoff - and discusses common base, common emitter, and common collector biasing configurations.
4) It introduces the Eber-Moll model and small signal equivalent circuit used to analyze BJTs.
5) It discusses concepts like the early effect and breakdown voltages that
A Novel Solution Of Linear CongruencesJeffrey Gold
This document presents a novel method for solving linear congruences of the form cx ≡ a (mod b) using remodulization. The key steps are:
1) Remodulize the congruence by factor c to obtain an equivalent congruence with modulus that is a multiple of c.
2) One of the residues in the remodulized form will be divisible by c and yield the solution.
3) The solution space consists of d distinct solutions if gcd(c,b)=d and d divides a.
4) The general solution is given by x ≡ (1 - φ(c)/b)−1a (mod b) where φ is the Euler
Slides from a talk called "Projective Geometric Computing given at SIGGRAPH 2000 in New Orleans, 25 July 2000 by Ambjörn Naeve in connection with an advanced course on Geometric Algebra (See http://www.siggraph.org/s2000/conference/courses/crs31.html)
EQUIVALENCE PRINCIPLE OR NEW PRINCIPLE OF INERTIA?/¿PRINCIPIO DE EQUIVALENCIA...Xavier Terri
The document discusses a new generalized principle of inertia proposed by Connected Theory that eliminates absolute space and inertial reference frames. It presents a relational metric that eliminates absolute rotational movements. The key points are:
1) Connected Theory's fundamental equation leads to a new generalized principle of inertia that admits non-trivial solutions for the movement of free bodies, unlike Newton's law of inertia.
2) A relational metric is introduced that depends on the relative motion between reference frames and eliminates the concept of absolute rotation.
3) For any reference frame in relative rotation, the relational metric and physical laws are symmetric - neither frame is privileged as inertial or non-inertial. This establishes the
Bipolar junction transistors (BJTs) are composed of three sections of semiconductors with different dopings. The middle section is the base, which is narrow. BJTs come in NPN and PNP variants. NPN transistors are more common as electrons move faster. A BJT acts as a valve, controlling current flow between the collector and emitter terminals based on the base current. To analyze BJT circuits, one must determine if the transistor is in cutoff, active-linear, or saturation mode by checking voltages and currents against the transistor's characteristics.
Algebra review-olga lednichenko math turtoring, math,Olga Lednichenko
This document reviews basic algebra rules and procedures including arithmetic operations, fractions, factoring, the quadratic formula, the binomial theorem, and working with radicals. It covers topics like the distributive, commutative, and associative laws, factoring quadratics, completing the square to derive the quadratic formula, and expanding binomial expressions using the binomial theorem. Examples are provided to illustrate each concept and rule.
1. The histogram shows the distribution of heights of seedlings in a sample. It has frequencies on the y-axis and height ranges from -30 to 60 cm on the x-axis.
2. Most of the seedlings have heights between 10-30 cm as this has the highest frequencies.
3. There are no seedlings with heights below 0 cm or above 50 cm as those parts of the x-axis have a frequency of 0.
This document discusses phase diagrams and microstructures in binary alloy systems. It begins by outlining key questions that can be addressed using phase diagrams, such as the phases present at a given temperature and composition. It then provides examples of using a Cu-Ni phase diagram to determine phase compositions and fractions. The document discusses eutectic systems and uses a Pb-Sn phase diagram to solve examples determining phase properties. It concludes by describing microstructures that form in the Pb-Sn system depending on alloy composition.
1) The concrete beam design is adequate with 3 #7 bars on top, 7 #7 bars on bottom, and #4 stirrups spaced at 10 inches.
2) Shear, torsion, and flexural analyses were performed based on ACI 318-99. Requirements for minimum reinforcement area, spacing, and diameter were satisfied.
3) The design satisfies strength, serviceability, and development requirements for shear, torsion, and flexure.
This document provides an overview of advanced power system protection topics including definitions, objectives of power system protection, relay characteristics, methods of discrimination, distance protection, current balance protection, phase comparison protection, fault detection techniques using zero sequence systems, sequence filters, general relay equations, fuses, and time-current characteristics. It discusses concepts such as discrimination, stability, sensitivity, repeatability and provides examples to illustrate relay equations and characteristics.
This document is the introduction and instructions for a physics exam on multiple choice questions. It provides the exam format, which is 40 multiple choice questions to be answered on an answer sheet. It also lists various physics formulas and constants that may be useful for answering the questions. The exam covers topics in mechanics, waves, electricity, quantum physics and other areas of physics.
हिंदी वर्णमाला पीपीटी, hindi alphabet PPT presentation, hindi varnamala PPT, Hindi Varnamala pdf, हिंदी स्वर, हिंदी व्यंजन, sikhiye hindi varnmala, dr. mulla adam ali, hindi language and literature, hindi alphabet with drawing, hindi alphabet pdf, hindi varnamala for childrens, hindi language, hindi varnamala practice for kids, https://www.drmullaadamali.com
This document provides an overview of wound healing, its functions, stages, mechanisms, factors affecting it, and complications.
A wound is a break in the integrity of the skin or tissues, which may be associated with disruption of the structure and function.
Healing is the body’s response to injury in an attempt to restore normal structure and functions.
Healing can occur in two ways: Regeneration and Repair
There are 4 phases of wound healing: hemostasis, inflammation, proliferation, and remodeling. This document also describes the mechanism of wound healing. Factors that affect healing include infection, uncontrolled diabetes, poor nutrition, age, anemia, the presence of foreign bodies, etc.
Complications of wound healing like infection, hyperpigmentation of scar, contractures, and keloid formation.
it describes the bony anatomy including the femoral head , acetabulum, labrum . also discusses the capsule , ligaments . muscle that act on the hip joint and the range of motion are outlined. factors affecting hip joint stability and weight transmission through the joint are summarized.
How to Manage Your Lost Opportunities in Odoo 17 CRMCeline George
Odoo 17 CRM allows us to track why we lose sales opportunities with "Lost Reasons." This helps analyze our sales process and identify areas for improvement. Here's how to configure lost reasons in Odoo 17 CRM
This presentation includes basic of PCOS their pathology and treatment and also Ayurveda correlation of PCOS and Ayurvedic line of treatment mentioned in classics.
How to Fix the Import Error in the Odoo 17Celine George
An import error occurs when a program fails to import a module or library, disrupting its execution. In languages like Python, this issue arises when the specified module cannot be found or accessed, hindering the program's functionality. Resolving import errors is crucial for maintaining smooth software operation and uninterrupted development processes.
1. Equations
Mass
Mass Oligo Mass Base Terminal Correction
Ionic Strentgh
n
1
I ci z2
i
2 i 1
where
n is the number of different types of ions
ci is the concentration of each ion
zi is the number of charges on the ion
IUPAC definition
Extinction Coefficients
Linear
n n 1
260 Oligo 260 dinucleotidei 260 nucleotidei
i 1 i 2
Nucleic Acids: Structures, Properties, and Functions.(2000) V. Bloomfield, D. Crothers, I. Tinoco, 174-176
Circular
n
1
260 Oligo 260 dinucleotidei
2 i 1
Nucleic Acids: Structures, Properties, and Functions.(2000) V. Bloomfield, D. Crothers, I. Tinoco, 174-176
Hypochromicity correction
260 duplex 260 Top Strand 260 Bottom Strand 1 h260
where
h260 duplex 0.287 FractionAT duplex 0.059 FractionGC duplex
Biophys.Chem.(2008) 133, 66 - 70
Printed by Mathematica for Students
2. 2 cheat_sheat.nb
Thermodynamics
Gibbs Free Energy
GT H T S
GT R T Ln Keq
Individual Nearest Neighbor Hydrogen Bonding Model (INN - HB)
G Duplex
n 1
G dinucleotidei Initiation Correction Terminal Correction Symmetry Correction
i 1
where
Initiation Correction is applied to correct for initial complex formation
Terminal correction is applied once for each terminal A T or A U pair
Symmetry correction is applied if the sequence is self complimentary palindrome
Nucleic Acids: Structures, Properties, and Functions.(2000) V. Bloomfield, D. Crothers, I. Tinoco, 271-286
Equilibrium Distribution
Keq
A B
Equlibrium conditions :
B eq
Keq
A eq
Conservation of mass :
A eq B eq A 0 B 0
Substituting conservation of mass into equilibrium conditions yields :
B eq
Keq
A 0 B eq B 0
Solve for B eq :
A 0 B 0 Keq
B eq
1 Keq
A 0 B 0
A eq
1 Keq
Printed by Mathematica for Students
3. cheat_sheat.nb 3
KD
AB A+B
Equlibrium conditions :
A eq B eq
KD
AB eq
Conservation of mass :
Assuming all mass starts in AB 0
AB eq A eq AB 0
AB eq B eq AB 0
Substituting conservation of mass into equilibrium conditions yields the folowing polynomial:
2
AB 0 AB eq
KD
AB
Physically relevant solution to the polynomial:
1 1
A eq B eq KD KD 2 4 KD AB 0
2 2
1 1
AB eq AB 0 KD KD 2 4 KD AB 0
2 2
K Db K Dc
AB A+B AC A+C
Equlibrium conditions :
A eq B eq A eq C eq
KDb , KDc
AB eq AC eq
Conservation of mass :
Assuming all mass starts in AB 0 and C 0
AB eq AC eq A eq AB 0
AB eq B eq AB 0
AC eq C eq C 0
Substituting conservation of mass into equilibrium conditions and subsequent workup yields the folowing polynomial:
3 2
A eq Α A eq Β A eq Γ 0
where
Α KDb KDc A 0
Β KDb A 0 AB 0 KDb KDc
Γ KDb KDc AB 0
Physically relevant solution to the polynomial:
Printed by Mathematica for Students
4. 4 cheat_sheat.nb
Α 2 Θ
A eq Α2 3Β cos
3 3 3
Θ
AB 0 2 Α2 3Β cos 3
Α
B eq AB 0
Θ
3 KDb 2 Α2 3Β cos 3
Α
Θ
Α 2 Θ AB 0 2 Α2 3Β cos 3
Α
2
C eq C 0 AB 0 Α 3Β cos
3 3 3 Θ
3 KDb 2 Α2 3Β cos 3
Α
Θ
AB 0 2 Α2 3Β cos 3
Α
AB eq
Θ
3 KDb 2 Α2 3Β cos 3
Α
Θ
AB 0 2 Α2 3Β cos 3
Α Α 2 Θ
AC eq AB 0 Α2 3Β cos
Θ 3 3 3
3 KDb 2 Α2 3Β cos 3
Α
where
2 Α3 9 ΑΒ 27 Γ
Θ arccos
3
2 Α2 3Β
FEBS letters 1995, 360, 111-4
Melting Temperatures
A+A AA
H
Tn
S R Ln Ct
Where
Ct 2 A 0
Nucleic Acids: Structures, Properties, and Functions.(2000) V. Bloomfield, D. Crothers, I. Tinoco, 273
A+B AB
H
Tn
Ct
S R Ln 4
Where
Ct 2 A 0
Nucleic Acids: Structures, Properties, and Functions.(2000) V. Bloomfield, D. Crothers, I. Tinoco, 273
Printed by Mathematica for Students
5. cheat_sheat.nb 5
Nucleic Acids: Structures, Properties, and Functions.(2000) V. Bloomfield, D. Crothers, I. Tinoco, 273
Elementary Reaction Kinetics
Detailed Balance
For a reversible first order equilibrium is defined as the point at which the forward reaction rate is equal to the
reverse reaction rate, and therefore:
kf A eq kb B eq
kb B eq
kf
A eq
kf B eq
kb A eq
Furthermore thermodynamics tells us that for a reversible first order equilibrium is defined as:
B eq
Keq
A eq
kf
Keq
kb
This works regardless of the order of reaction. For example, in the case of a second order reaction A + B C
kf A eq B eq
kb C eq
kb C eq
kf
A eq B eq
kf C eq
kb A eq B eq
And thermodynamics tells us for a second order reaction:
C eq
Keq
A eq B eq
kf
Keq
kb
And thus regardless of the order of the reaction:
kf
Keq
kb
Physical Chemistry Kinetics, (2006) Horia Metiu, 78
First-Order Irreversible
Printed by Mathematica for Students
6. 6 cheat_sheat.nb
First-Order Irreversible
k
A B
kt
Η t A 0 1 A 0
where
A t A 0 Η t
B t B 0 Η t
Physical Chemistry Kinetics, (2006) Horia Metiu, 27
First-Order Reversible
kf
A B
kb
kb B 0 kf A 0 kb kf t
Η t 1
kb kf
where
A t A 0 Η t
B t B 0 Η t
Physical Chemistry Kinetics, (2006) Horia Metiu, 73
A 0 kf B 0 kb
Ηeq
kb kf
where
A eq A 0 Ηeq
B eq B 0 Ηeq
Physical Chemistry Kinetics, (2006) Horia Metiu, 78
Second-Order Irreversible
k
A B C
A B A 0 kt B 0 kt
0 0
Η t
A A 0 kt B B 0 kt
0 0
where
A t A 0 Η t
B t B 0 Η t
C t C 0 Η t
Physical Chemistry Kinetics (2006) Horia Metiu, 54
Printed by Mathematica for Students
7. cheat_sheat.nb 7
k
2A B
A 2 kt
0
Η t
2 1 A 0 kt
where
A t A 0 Η t
B t B 0 2Η t
Physical Chemistry Kinetics, (2006) Horia Metiu, 57
Second-Order Reversible
General Solution :
2 e0
Η t
t
e1 Coth 2
where
e1 2 4 e0 e2
Physical Chemistry Kinetics, (2006) Horia Metiu, 99
kf
A B C
kb
e0 kf A 0 kb B 0 C 0
e1 kf kb B 0 C 0
e2 kb
where
A t A 0 Η t
B t B 0 Η t
C t C 0 Η t
Physical Chemistry Kinetics, (2006) Horia Metiu, 93
kf
A B C
kb
e0 kf A 0 B 0 kb C 0
e1 kf A 0 B 0 kb
e2 kf
where
A t A 0 Η t
B t B 0 Η t
C t C 0 Η t
Physical Chemistry Kinetics, (2006) Horia Metiu, 93
Printed by Mathematica for Students
8. 8 cheat_sheat.nb
Physical Chemistry Kinetics, (2006) Horia Metiu, 93
kf
A B C D
kb
e0 kf A 0 B 0 kb C 0 D 0
e1 kf A 0 B 0 kb C 0 D 0
e2 kf kb
where
A t A 0 Η t
B t B 0 Η t
C t C 0 Η t
D t D 0 Η t
Physical Chemistry Kinetics, (2006) Horia Metiu, 94
Constants
Mass
Printed by Mathematica for Students
9. cheat_sheat.nb 9
Extinction Coefficients
DNA 260 RNA 260
1 1 1 1
Dinucleotide L mol cm Dinucleotide L mol cm
DNA 260 AA 27 400 AA 27 400
Nucleotide 1 1 AG 25 000 AG 25 000
L mol cm
AT 22 800 AU 24 000
A 15 400 AC 21 200 AC 21 000
G 11 500 GA 25 200 GA 25 200
T 8700 GG 21 600 GG 21 600
C 7400 GT 20 000 GU 21 200
RNA 260 GC 17 600 GC 17 400
1 1
Nucleotide L mol cm TA 23 400 UA 24 600
A 15 400 TG 19 000 UG 20 000
G 11 500 TT 16 800 UU 19 600
U 9900 TC 16 200 UC 17 200
C 7200 CA 21 200 CA 21 000
CG 18 000 CG 17 800
CT 15 200 CU 16 200
CC 14 600 CC 14 200
DNA : Biopolymers (1970) 9, 1059 - 1077
RNA : Handbook of Biochem.and Mol.Bio.(1975) 1, 589
Printed by Mathematica for Students
10. 10 cheat_sheat.nb
Thermodynamics
DNA | DNA
Biochemistry (1997) 36, 10581 - 10594
Printed by Mathematica for Students
11. cheat_sheat.nb 11
RNA | RNA
Biochemistry (1998) 37, 14719 - 14735
Printed by Mathematica for Students
12. 12 cheat_sheat.nb
DNA | RNA
Biochemistry (1995) 34, 11211 - 11216
Printed by Mathematica for Students
13. cheat_sheat.nb 13
Some Emperical Assocation Rate Constants
Self Hybrid RNA DNA Ionic Strength Temp °C Sequence kf 106 M 1 Sec 1
Hybrid RNA 0.025 23.3 AAAAAAAAA 0.53
Hybrid RNA 0.025 23.3 AAAAAAAAAAA 0.5
Hybrid RNA 0.025 23.5 AAAAAAAAAAAAAA 0.61
Self RNA 0.125 21. AAAAUUUU 1.
Self RNA 0.125 21. AAAAAUUUUU 2.
Self RNA 0.125 21. AAAAAAUUUUUU 1.5
Self RNA 0.125 21. AAAAAAAUUUUUUU 0.8
Self RNA 0.5 22.1 AAAAAAAUUUUUUU 2.7
Self RNA 0.025 23.3 AAGCUU 1.6
Self RNA 0.5 23. AAGCUU 10.
Self RNA 0.025 23.3 AAAGCUUU 0.75
Self RNA 0.025 23.3 AAAAGCUUUU 0.13
Self RNA 0.5 23. AAAAGCUUUU 0.9
Hybrid RNA 0.025 16.8 AAAAGG 11.4
Hybrid RNA 0.025 23.3 AAAAAGG 4.4
Hybrid RNA 0.5 21.1 CAAAAAG 4.6
Hybrid DNA 0.5 20. CAAAAAG 9.
Hybrid RNA 0.05 21.5 GGGC 5.4
Self DNA 0.5 25. GCGCGC 12.
Hybrid DNA RNA 0.5 23. TTTTTTTTT 10.
Self DNA 0.006 31.1 GCATGC 0.98
Self DNA 0.021 31.1 GCATGC 1.6
Self DNA 0.5 31.1 GCATGC 9.9
Self DNA 0.026 31.1 GCATGC 7.3
Hybrid DNA 0.025 25. TCTCCATGTCACTTC 3.
Hybrid DNA 0.06985 37. CTAGCCTTATGGAGGAGTACCAAC 69.448
Hybrid DNA 0.5 25. GGAAAGGACAACACCCGCGTATTAG 0.202
Nucleic Acids : Structures, Properties, and Functions.(2000) V. Bloomfield, D. Crothers, I. Tinoco, 289
Printed by Mathematica for Students