The document summarizes a study that analyzed gene expression in the hypothalamus of depressed patients compared to controls using laser microdissection and real-time PCR. The study found increased expression of genes involved in activating the hypothalamic-pituitary-adrenal axis in depressed patients, including corticotropin-releasing factor and receptors for estrogen, vasopressin, and mineralocorticoids. Expression of the androgen receptor, which inhibits the axis, was decreased. This suggests an imbalance in receptor production may contribute to axis hyperactivity in depression. The findings provide molecular evidence for the corticotropin-releasing factor hypothesis of depression.

1. Molecular Psychiatry (2008) 13, 786–799
& 2008 Nature Publishing Group All rights reserved 1359-4184/08 $30.00
www.nature.com/mp
ORIGINAL ARTICLE
Gene expression analysis in the human hypothalamus
in depression by laser microdissection and real-time
PCR: the presence of multiple receptor imbalances
S-S Wang1,2, W Kamphuis1, I Huitinga1, J-N Zhou2 and DF Swaab1
1Netherlands Institute for Neuroscience, Amsterdam, The Netherlands and 2Hefei National Laboratory for Physical Sciences
at Microscale and Department of Neurobiology and Biophysics, Life Science School, University of Science and Technology
of China, Hefei, Anhui, PR China
Hyperactivity of corticotropin-releasing factor (CRF) neurons in the paraventricular nucleus
(PVN) of the hypothalamus is a prominent feature in depression and may be important in the
etiology of this disease. The activity of the CRF neurons in the stress response is modulated
by a number of factors that stimulate or inhibit CRF expression, including (1) corticosteroid
receptors and their chaperones, heat shock proteins 70 and 90, (2) sex hormone receptors,
(3) CRF receptors 1 (CRFR1) and 2, (4) cytokines interleukin 1-b and tumor necrosis factor-a, (5)
neuropeptides and receptors, vasopressin (AVP), AVP receptor 1a (AVPR1A) and oxytocin and
(6) transcription factor cAMP-response element-binding protein. We hypothesized that, in
depression, the transcript levels of those genes that are involved in the activation of the
hypothalamo–pituitary–adrenal (HPA) axis are upregulated, whereas the transcript levels of
the genes involved in the inhibition of the HPA axis are downregulated. We performed laser
microdissection and real-time PCR in the PVN and as a control in the supraoptic nucleus.
Snap-frozen post-mortem hypothalami of seven depressed and seven matched controls
were used. We found significantly increased CRF mRNA levels in the PVN of the depressed
patients. This was accompanied by a significantly increased expression of four genes that are
involved in the activation of CRF neurons, that is, CRFR1, estrogen receptor-a, AVPR1A and
mineralocorticoid receptor, while the expression of the androgen receptor mRNA involved in
the inhibition of CRF neurons was decreased significantly. These findings raise the possibility
that a disturbed balance in the production of receptors may contribute to the activation of the
HPA axis in depression.
Molecular Psychiatry (2008) 13, 786–799; doi:10.1038/mp.2008.38; published online 22 April 2008
Keywords: hypothalamo–pituitary–adrenal axis; depression; paraventricular nucleus; laser
dissection; corticotrophin-releasing factor; steroid receptors
Introduction
The hypothalamo–pituitary–adrenal (HPA) axis is
considered to be the ‘final common pathway’ for a
major part of the depressive symptomatology. Stress-ful
life events and genetic- and epigenetic-risk factors
for depression have been linked to increased HPA-axis
activity in adulthood.1 When patients or animal
models for depression are treated either with anti-depressants,
or with electroconvulsive therapy, or
when patients show spontaneous remission, the HPA-axis
function returns to normal.2 Moreover, studies in
high-risk probands of patients with major depression
(MD) have shown that abnormalities in HPA-axis
function already exist prior to the onset of the clinical
symptoms, suggesting that such abnormalities can, in
fact, precede depressive episodes.3
The hyperactivity of the corticotropin-releasing
factor (CRF) neurons is important in the neurobiology
of depression as it appears from (1) an increased
amount of CRF mRNA in the paraventricular nucleus
(PVN) as determined by in situ hybridization in
depression, (2) a fourfold increase in the number of
CRF-expressing neurons in the PVN and (3) the
increased number of CRF neurons co-expressing
vasopressin (AVP).4,5 An important argument for a
causal role for central effects of CRF in depression is
that similar symptoms, such as decreased food intake,
decreased sexual activity, disturbed sleep and motor
behavior, and anxiety can all be induced in experi-mental
animals by intracerebroventricular injection of
CRF.6 An additional argument for the direct involve-ment
of CRF in the symptomatology of depression is
the recently found increased susceptibility to MD in
Correspondence: Dr J-N Zhou, Hefei National Laboratory for
Physical Sciences at Microscale and Department of Neurobiology
and Biophysics, Life Science School, University of Science and
Technology of China, Huangshan Road 433, Hefei 230026, Anhui,
PR China.
E-mail: jnzhou@ustc.edu.cn
Received 29 June 2007; revised 10 March 2008; accepted 10
March 2008; published online 22 April 2008

2. case of a single-nucleotide polymorphisms in the
CRF receptor 1 (CRFR1) gene.7,8 Antidepressants
attenuate the synthesis of CRF by upregulation of
corticosteroid receptor expression1 that causes a
decrease of the cerebrospinal fluid (CSF) levels of
CRF.9 A transgenic mouse model with an overproduc-tion
of CRF showed increased anxiogenic behavior, a
symptom that is usually related with MD, and
that could be counteracted by injection of a CRF
antagonist.10 Lastly, CRF-receptor antagonists may be
effective in the treatment of depression.11,12 Together,
these arguments have led to the CRF hypothesis of
depression: hyperactivity of CRF neurons, and in
particular those driving the HPA axis, induces
symptoms of depression.
The CRF neurons of the activated HPA axis do not
only stimulate cortisol production by the adrenal
gland but also project centrally. Both this centrally
released CRF and these increased levels of cortisol
contribute to the signs and symptoms of depression
(for review see Bao et al.1). In addition, there is
interaction of the HPA axis, both by centrally
projecting CRF and via cortisol, with the monoami-nergic
systems and with the prefrontal cortex.13–15
Alterations in these systems also contribute to the
mood changes.
The activity of CRF neurons is modulated by a large
number of factors that can be produced in the PVN
and may also be involved in the pathogenesis of
depression, that is,
(1) a change in corticosteroid feedback on the HPA
axis involving the glucocorticoid receptor (GR)
(that is, GRa) and the mineralocorticoid receptor
(MR). MR and GR can form hetero- and homo-dimers
that differ in their activity of gene regula-tion.
A change in the balance of MR/GR ratio in
depressed patients may contribute to the change
in transcription rate of CRF16–20;
(2) the CRF receptors, that is, CRFR1 that stimulates
CRF production21,22 and CRFR2 that opposes this
action23;
(3) alterations in vasopressinergic systems that po-tentiate
effects of CRF24 and the AVP receptor 1a
(AVPR1A) that is involved in anxiety/ depression-related
behavior25; oxytocin (OXT) that attenuates
the stress response was found to be increased in
the PVN only in melancholic depression26;
(4) cAMP-response element-binding protein (CREB)
that stimulates CRF expression as a transcription
factor27;
(5) sex hormones, involving estrogen-receptors
(ESR) 1 and 2 and androgen-receptor (AR),
stimulating and inhibiting CRF gene expression,
respectively28,29;
(6) the powerful CRF-stimulating proinflammatory
cytokines such as interleukin 1-b (IL1b) that is
produced by glial cells and PVN neurons,30 and
tumor necrosis factor-a (TNFa), a circulating state
marker for depression31 that is also produced by
glial cells32;
Gene expression analysis in the human hypothalamus
S-S Wang et al
(7) the heat shock proteins (HSP) 70 and 90 that are
determinants of glucocorticoid resistance.33
We hypothesized that, in depression, the transcript
levels of those genes that are involved in the
activation of the HPA axis (CRF, CRFR1, MR, AVP,
AVPR1A, CREB, ESR1, ESR2, IL1b, TNFa, HSP70 and
90) are upregulated whereas the transcript levels of
the genes involved in the inhibition of the HPA axis
(GRa, CRFR2, AR, OXT) are downregulated.
For the first time, we performed laser microdissec-tion
(LMD) and real-time quantitative PCR (qPCR) on
the isolated PVN and supraoptic nucleus (SON) from
snap-frozen post-mortem hypothalami of seven de-pressed
and seven matched controls to determine
changes at the transcript level of these feedback and
input factors in depression. Subsequently, we deter-mined
the transcript levels of peptides of the stress
axis, that is, CRF, AVP and OXT, and transcription
factors that are possibly involved in the hyperactivity
of the CRF neurons in depression, and thus in the
pathogenesis of this disease. The hypothesis we
wanted to test was whether there was a receptor
imbalance such as the one proposed between MR and
GR16 in the PVN in the depressed patients, and if that
was the case, whether such an imbalance also exists
for other related receptors. The transcripts of these
targets were also determined in the SON, as a control
area, since this nucleus hardly produces CRF, and
AVP expression was only activated in the SON in the
melancholic type of depression,26 while this type of
depression was only present in one of the seven
depressed patients in the present study.
Materials and methods
Subjects
The hypothalami were obtained by autopsy from 14
subjects of which 7 were patients clinically diagnosed
with depression, either in the context of a MD or of a
bipolar disorder (BD), and 7 served as controls
matched for sex, age, post-mortem delay, season and
clock time of death, and brain weight. The depression
and control groups were matched for sex, age
(z =0.192, P = 0.848), season and clock time of death
(w2 = 1.902, P = 0.386; w2 = 2.406, P = 0.300, respec-tively),
brain weight (z =0.704, P = 0.482), post-mortem
delay (z =0.576, P = 0.565) and for pH of
the CSF (z =1.146, P = 0.252) that is a measure of
agonal state (for clinicopathological information
see Table 1). The frozen brain material was obtained
from the Netherlands Brain Bank, following permis-sion
from the patient or the next of kin for a brain
autopsy and for the use of the brain material and
clinical information for research purposes. The
patients suffering from depression were diagnosed
during their life and the diagnosis was checked
by a certified psychiatrist (Dr G Meynen) retrospec-tively
using the medical record, who paid special
attention to the presence of melancholic features
according to Diagnostic and Statistical Manual
787
Molecular Psychiatry

3. Table 1 Clinicopathological information of patients with depression and control subjects
NBB
number
Sex Age
(years)
Diagnosis Braak
stage
Post-mortem
delay
(h:min)
pH CSF Brain
weight
(g)
Clock
time at
death
Suicide
attempt
Medication
taken in
the past
Medication
in the last
3 months
Month
of death
Cause
of death
Died during
depressive
episode?
D1 01-074 M 45 MD 0 7:00 6.55 1427 2:30 Yes SSRI, BZD SSRI 6 Hemorrhage
in pons
Yes
D2 99-115 F 57 MD (Me) 0 5:30 6.28 1345 20:45 Yes TCA,
BZD, ZUC
BZD 9 Legal
euthanasia
because of
multiple
acquired
handicaps,
intractable pain,
shortness
of breath
Yes
D3 02-014 M 68 BD 1 16:46 6.64 1424 ND No Li, ZUC None 2 Subdural
hemorrhage
Yes
D4 99-118 M 68 MD 1 5:55 6.82 1204 23:15 Yes Li, SSRI None 10 Cardiac
ischemia
Yes
D5 02-051 M 81 MD 3 6:00 6.5 1345 15:30 No TCA, Hal, Hal 6 Renal
insufficiency
Yes
D6 06-021 M 70 BD 3 6:23 6.53 1488 13:07 No Li Li, Mo 3 Severe neck
trauma and
pneumonia
Probably
D7 06-011 F 60 MD 1 4:20 ND 1080 16:10 Yes SSRI,
BZD, Hal,
Mo,
Tamoxifen
Hal 1 Legal
euthanasia
because of
metastasized
mamma
carcinoma
Yes
Median — — 68 — 1 6:00 6.54 1345 — — — — — — —
Mean
±s.d.
— — 64.14±
11.42
— 1.29±
1.25
7:24±
4:12
6.55±
0.18
1330.43±
142.61
18:39±
4:13a
— — — 3.5±
2.06a
— —
C1 05-068 M 56 Control 0 9:15 6.54 1553 4:45 — None None 10 Myocardial
infarction
—
C2 99-067 F 59 Control 1 6:20 6.67 1156 13:30 — None None 6 Ileus,
larynx
carcinoma
—
Gene expression analysis in the human hypothalamus
S-S Wang et al
788
Molecular Psychiatry

4. Table 1 Continued
NBB
number
Sex Age
(years)
Diagnosis Braak
stage
Post-mortem
delay
(h:min)
pH CSF Brain
weight
(g)
Clock
time at
death
Suicide
attempt
Medication
taken in
the past
Medication
in the last
3 months
Month
of death
Cause
of death
Died during
depressive
episode?
C3 06-037 M 66 Control 0 7:45 6.7 1590 17:45 — Testosterone
(substitution)
Testosterone
(substitu-tion)
5 Ruptured
abdominal aorta
aneurysm
C4 05-034 M 56 Control 0 14:00 7.03 1323 0:00 — None None 5 Congestive
heart failure
C5 05-019 M 74 Control 3 5:00 6.7 1125 2:00 — Digoxin Mo, Hal 4 Bronchus
carcinoma,
cardiac
decompen-sation
C6 01-033 M 75 Control 1 6:20 6.18 1180 6:10 — None None 3 Dehydration/
pneumonia
C7 99-111 F 88 Control 3 5:40 6.67 1054 3:05 — Digoxin None 9 Respiratory
insufficiency
Median 66 1 6:20 6.67 1180
Mean±s.d — — 67.71±
11.95
— 1.14±
1.35
7:45±
3:05
6.64±
0.25
1283±
213.27
1:00±
4:17a
— — — 5.33±
2.06a
—
Abbreviations: BD, bipolar disorder; BZD, benzodiazepine; F, female; Hal, haloperidol; Li, lithium; Me, melancholic type; MD, major depression; Mo, morphine; M,
male; NBB, Netherlands Brain Bank; ND, no data; none, no medication; s.d., standard deviation; SSRI, selective serotonin reuptake inhibitor; TCA, tricyclic
antidepressant; ZUC, zuclopenthixol.
Braak stages, neuropathological distribution of neurofibrillary Alzheimer changes over the brain; stage 0, no neurofibrillary changes; stages I/II, mild/severe alterations
in the entorhinal cortex; stage III first involvement of the hippocampus. Clinically stages 0–II are unaffected controls, and in stage III mild cognitive impairment may
start.34
aCircular mean and s.d. of the clock time at death or the month of death. Neither the clock time or month of death differed significantly between the group as tested with
the Mardia–Watson–Wheeler test.
Gene expression analysis in the human hypothalamus
S-S Wang et al
789
Molecular Psychiatry

5. Gene expression analysis in the human hypothalamus
S-S Wang et al
of Mental Disorders, fourth edition criteria (American
Psychiatric Association). Five patients fulfilled the
criteria for MD and two patients fulfilled the criteria
for BD. For detailed information, also on the relevant
medication in the past and in the last month before
death (Table 1). The medical records did not reveal
any alcohol or other drug abuse among subjects of
either group. The absence or presence of neuropatho-logical
changes, both in the patients with mood
disorders and in the controls, was confirmed by
systematic neuropathological investigation.35 The
results are set down in Table 1.
Human brain material
Laser microdissection. The freshly frozen hypo-thalami
were serially sectioned at 15 1C on a
cryostat (Leica CM 1850 UV) at a thickness of 20 mm
from rostral to caudal throughout the PVN and the
SON. The PVN and the SON were dissected at the
right side of the hypothalamus. The beginning and the
end of the PVN and the SON were defined by thionin
staining every 10th section from rostral to caudal
throughout the hypothalamus. The tissue sections
were thaw mounted on a slide coated with a plain
film (Birkelbach Film, Germany). In total, there were
126–328 serial sections obtained from the most rostral
to the most caudal part of the SON and PVN
(the variation of the section numbers due to the
orientation of the frozen block). We took 3 out of the 9
unstained sections of every 10 sections (of which one
was stained with thionin). In this way, a total of
66±3 (mean±s.e.m.) sections of PVN in depression
and 64±8 in controls (P = 0.304 in Mann–Whitney
U-test); 60±3 sections of SON in depression and
51±4 in controls (P = 0.14 in Mann–Whitney U-test)
were sampled for LMD in each patient. The frozen
sections were stored under vacuum at room temperature
with silica gel for dehydration for two nights, and the
PVN and SON were dissected from the sections by a
PALM MicroLaser System (Bernried, Germany) (Figure
1) and collected by hand, using a fine needle.36
RNA isolation. For RNA extraction from the LMD
tissue, we used an adapted protocol of the RNeasy
protocol (Qiagen, Hilden, Germany). Trizol (1 ml)
(Invitrogen Life Technologies, Carlsbad, CA, USA)
was added to the vial containing all the dissected
material of the PVN or SON of one patient. After
spinning down at 12 000 g for 10 min at 4 1C, the
supernatant was transferred into another tube; 200 ml
chloroform was added to the supernatant, vortexed
for 15 sec and centrifuged for 15 min at 12 000 g at
4 1C. The upper aqueous phase was transferred into a
clean vial and an equal volume of freshly prepared
70% ethanol was added, after which the sample was
loaded onto an RNeasy column. RNA was extracted
according to RNeasy (Qiagen) manufacturer’s
protocol. RNA quantity was measured on a
NanoDrop 1000 spectrophotometer (NanoDrop
Technologies, Rockland, DE, USA) and the quality
was determined by a 2100 BioAnalyzer (Agilent
Figure 1 The sections for laser microdissection (LMD). Sections of the paraventricular nucleus (PVN, a–c) and supraoptic
nucleus (SON, d–f) at the right side of hypothalamus as seen under the PALM laser-dissection microscope. A thionin-stained
section of the PVN for the orientation is shown in panel a. An unstained section adjacent to panel a is represented in panel b
before LMD, in which the PVN area is outlined under the microscope. The section b is represented in panel c after laser
dissection. The sections of the right SON under the PALM laser-dissection microscope with the same LMD procedure as
for the PVN are represented in panels d–f. Bar = 300 mm. The arrows show the orientation: V, ventral; D, dorsal; M, medial;
L, lateral; OT, optic tract; and III, third ventricle.
790
Molecular Psychiatry

6. Technologies, Palo Alto, CA, USA). RNA integrity
number (RIN) was used to assess the RNA quality
(scale 1–10, with 1 being the lowest and 10 being the
highest RNA quality).
cDNA synthesis. For each sample, an equal quantity
of RNA (300 ng) was used for the synthesis of cDNA,
mixed with 4.1 ml mixture of oligo dT (100 mgml1)
and 10hexanucleotide (Roche, Basel, Switzerland)
(40:1 for the oligodT and hexanucleotide mixture),
heated to 80 1C for 10 min, after which the tubes were
quickly transferred to ice. Then 1 ml reverse
transcriptase Superscript II RT (Invitrogen Life
Technologies) was added together with a mixture of
5 ml 5first-strand buffer, 2.5 ml 100mM
dithiothreitol, 1.5 ml 10mM dNTPs and 0.5 ml RNase
inhibitor. The synthesis reaction was allowed to
proceed for 1 h at 42 1C, after which cDNA was
stored at 20 1C or used immediately.
Primer design. The mRNA sequences for all of the
genes were downloaded from the NCBI at http://
www.ncbi.nlm.nih.gov. The primers were designed
by Primer Premier (version 5.0) to amplify specific
amplicons. Sequences and size of the primer pairs are
shown in Table 2. Most primer pairs were designed to
span the 30-most intron to avoid amplification of DNA
templates that may be present in trace amounts in the
RNA samples. qPCR assays using intron-specific
primer pairs revealed high Ct values of X37,
showing that the amounts of DNA were negligible.
Since none of the samples used in our study showed
an amplification of DNA-specific sequences, it may be
concluded that the qPCR data also obtained by the
non-intron spanning primers for which intron-spanning
primers were not optimal or not possible
(that is, for CRF, AVP, OXT, HSP70) yields
information on transcript levels without
confounding coamplification of genomic DNA.
Quantitative PCR. The qPCR reaction contained
10 ml 2SYBR Green Mastermix (Applied
Biosystems, Foster City, CA, USA), 1 ml of each
primer pair (1 mM) and 5 ml (equivalent to 2 ng ml1
total RNA) of template cDNA in a 20 ml reaction
volume. The PCR was performed in a GeneAmp 7300
thermocycler PCR program: 10 min at 95 1C, followed
by 40 cycles of 15 s at 95 1C and 1 min at 60 1C).
The specificity of the amplification was checked
by melting curve analysis and electrophoresis of
the products on an 8% polyacrylamide gel.
Sterile water, RNA samples without addition of
reverse transcriptase in the cDNA synthesis
and DNA samples were used as a control. The
linearity of each qPCR assay was tested by preparing
a series of dilutions of the same stock cDNA in
multiple plates. A normalization strategy was used
for the gene quantification. The relative absolute
amount of target genes were calculated by 1010Ect
(E=10(1/slope)).37
Gene expression analysis in the human hypothalamus
S-S Wang et al
Normalization strategy. To remove sampling-related
differences (RNA quality and RNA quantity), a
normalization strategy based upon the geNorm
approach was followed.38 The geNorm analysis
revealed that the transcript level of all eight
reference genes that were determined in the PVN
and the SON could be included into the calculation
of the normalization factor. The normalization
factor was the geometric mean of the following
genes: glyceraldehydes-3-phosphate dehydrogenase
(GAPDH), actin-b (ACTb), 18S ribosomal RNA
(RN18S, hydroxymethylbilane synthase (HMBS),
hypoxanthine phosphoribosyltransferase 1 (HPRT1),
ubiquitin C (UBC), tubulin-a (TUBa), tubulin-b4
(TUBb4). The absolute amount of transcript thus
determined was then divided by the normalization
factor to obtain the normalized values.
Considerations in relation to the reference
genes. There are a number of reports indicating
that the classic reference genes may be regulated
under certain conditions and may therefore be
unsuitable for normalization purposes.39,40 In fact,
every experimental situation has its own ideal
normalization method.41 Some reports indeed
indicate that the use of the internal standards
comprising single reference genes or ribosomal RNA
is inappropriate,42 such as RN18S.43 In the present
study, we therefore chose to combine reference genes
according to the geNorm program, using the pair-wise
comparison. We used the geometric mean as the
normalization factor.38
Statistic analysis
Statistic analysis was conducted with SPSS (version
11.5, SPSS Incorporation). The differences between
the groups were statistically evaluated by the
nonparametric Mann–Whitney U-test since the
data were not distributed normally. We compared
the data of depression versus control in PVN and
SON separately. Differences in clock time of death
and month of death (circular parameters) between
control and patients with mood disorders were
tested with the Mardia–Watson–Wheeler test.44
The association between the target genes was
examined by the Spearman’s correlation coefficient.
The tests of association were corrected according
to Bonferroni. Whether the 16 tested genes in the
PVN changed their expression in depression into
the direction predicted by our hypothesis was
tested by the Sign test of proportions. Tests were
two tailed. Values of P 0.05 were considered to be
significant.
Results
RNA quality
Because the overall RNA quality is a major factor in
studies on gene expression, we determined whether
the RIN value was influenced by confounding factors.
The mean RIN of the LMD samples was 7.2±0.6 in
791
Molecular Psychiatry

7. Gene expression analysis in the human hypothalamus
S-S Wang et al
Table 2 Sequence of the primers, gene bank accession numbers, the size of amplified product for the target genes and reference
genes
Gene Primer sequences Accession numbers Amplicon length (bp)
AVP TGTGTGCACCAGGATGCCT NM_000490 84
the PVN and 6.6±0.7 in the SON. However, we found
no significant difference in RIN values between the
depression group and the control group (z =1.529,
P = 0.126).
Gene expression in the PVN in depression versus
controls
Transcript levels of CRF, CRFR1, MR and ESR1 were
found to be significantly higher in the PVN in the
TTCTGGAAGTAGCACGCGG
AVPR1A CTTTTGTGATCGTGACGGCTTA NM_000706 75
TGATGGTAGGGTTTTCCGATTC
AR GTCAACTCCAGGATGCTCTACT NM_000044 101
AGGTGCCTCATTCGGACA
CREB ACCACTGTAACGGTGCCAAC NM_134442 73
CTCCTCCCTGGGTAATGG
CRFR1 CGGGTCGTCTTCATCTACTTCA NM_004382 100
TGGCAGAACGGACCTCACT
CRFR2 AATGCTTGGAGAATGGGACG NM_001883 100
ACAAGGGCGATGCGGTAG
CRF CATCTCCCTGGATCTCACCTTC NM_000756 109
AATAATCTCCATGAGTTTCCTGTTG
ESR1 TCTTGGACAGGAACCAGGGAA NM_000125 82
CGGAACCGAGATGATGTAGCC
ESR2 TGCTTTGGTTTGGGTGATTG NM_001437 118
TTCCATGCCCTTGTTACTCG
GRa (NR3C1) CCATTGTCAAGAGGGAAGGAA NM_001018077 119
TGTTTGGAAGCAATAGTTAAGGAG
GRb (NR3C1) AGAACTGGCAGCGGTTTTATC NM_001020825 91
GTGTGAGATGTGCTTTCTGGTTT
HSP90 CGCTCCTGTCTTCTGGCTTC NM_005348 117
TGGTATCATCAGCAGTAGGGTCA
HSP70 CCATCATCAGCGGACTGTACC NM_005345 87
CTGACCCAGACCCTCCCTT
MR AAGTCGTGAAGTGGGCAAAG NM_000901 83
CCAAGAATACTGGATTAGGGT
OXT GCTGAAACTTGATGGCTCCG NM_000915 67
TTCTGGGGTGGCTATGGG
TNFa GGCGTGGAGCTGAGAGATA NM_000594 88
CAGCCTTGGCCCTTGAAGA
IL1b CCGACCACCACTACAGCAA NM_000576 86
GGCAGGGAACCAGCATCT
ACTb CCCAGCCATGTACGTTGCTA NM_001101 65
TCACCGGAGTCCATCACGAT
GAPDH CAAATTCCATGGCACCGTC NM_002046 62
TCTCGCTCCTGGAAGATGGT
HPRT1 GGACAGGACTGAACGTCTTGC NM_000194 88
ATAGCCCCCCTTGAGCACAC
TUBa CTTTGAGCCAGCCAACCAGA NM_006082 72
GTACAACAGGCAGCAAGCCAT
UBC GCTGCTCATAAGACTCGGCC NM_021009 70
GTCACCCAAGTCCCGTCCTA
HMBS GATCCCGAGACTCTGCTTCG NM_001024382 70
ACACTGCAGCCTCCTTCCAG
TUBb4 GGGCCAAGTTTTGGGAGGT NM_006087 71
CACTGTCCCCATGGTATGTGC
RN18S TCGAGGCCCTGTAATTGGAA M10098 60
CCCTCCAATGGATCCTCGTT
Abbreviations: ACTb, actin-b; AR, androgen receptor; AVP, vasopressin; AVPR1A, AVP receptor 1a; CREB, cAMP-response
element-binding protein; CRF, corticotropin-releasing factor; CRFR, CRF receptor; ESR, estrogen receptor; GAPDH,
glyceraldehydes-3-phosphate dehydrogenase; GR, glucocorticoid receptor; HMBS, hydroxymethylbilane synthase; HPRT1,
hypoxanthine phosphoribosyltransferase 1; HSP, heat shock protein; IL1b, interleukin 1-b ; MR, mineralocorticoid receptor;
OXT, oxytocin; RN18S, 18S ribosomal RNA; TNFa, tumor necrosis factor-a; TUBa, tubulin-a; UBC, ubiquitin C.
792
Molecular Psychiatry

8. depression group while AR was decreased compared
to the controls (Table 3). The median of the total
amount of CRF mRNA in the PVN was 1.9 times
higher than that of the controls (z =1.981, P = 0.048,
Figure 2a). The median amount of CRFR1 mRNA in
the PVN was B2.5 times higher than that in controls
(z =1.981, P = 0.048, Figure 2b). In depression, the
sex hormone receptor expression levels in the PVN
changed significantly. The amount of AR mRNA in
the PVN was decreased by B2.7-fold in the depressed
patients as compared to the controls (z =1.981,
P = 0.048, Figure 2f), while the amount of ESR1
mRNA was B1.7 times higher than that of the
controls (z =2.492, P = 0.013, Figure 2d). The MR
mRNA levels of the depressed patients were B2.2
times higher than those of the controls (z =2.747,
P = 0.006, Figure 2c) and the AVP mRNA levels were
B1.9 times higher in the depressed patients than in
the controls, a trend that did not reach significance
(z =1.597, P = 0.11). The AVPR1A level was B2
times higher in the PVN of depressed patients than in
the controls (z =1.981, P = 0.048, Figure 2e).
We hypothesized that in depression the transcript
levels of those genes that are involved in the
activation of the HPA axis (CRF, CRFR1, MR, AVP,
AVPR1A, CREB, ESR1, ESR2, IL1b, TNFa, HSP70 and
90) are upregulated, whereas the transcript levels of
the genes involved in the inhibition of the HPA axis
(GRa, CRFR2, AR, OXT,) are downregulated. From the
16 tested genes in the PVN, 13 changed their
expression in depression into the direction predicted
by our hypothesis (Table 3), which the Sign test for
proportions deemed significant (a 0.05).
There were interesting correlations present between
the expression levels of sex hormone receptors in the
PVN in the depressed patients but not in the controls.
ESR1 mRNA was positively correlated with estrogen
receptor-b (ESR2) mRNA in the PVN, both in the
depressed patients and in the controls (Figure 3a)
(r = 0.893, P = 0.007; r = 0.821, P = 0.023, respectively).
A significant correlation was found between AR- and
ESR1-mRNA (r = 0.857, P = 0.014) and AR- and ESR2-
mRNA (r = 0.857, P = 0.014) (Figure 3b) in the PVN
but only in the depressed patients.
Gene expression in the SON in depression and controls
No significant difference of these target genes was
found in the SON between the depressed patients and
the controls as far as these target genes are concerned.
Gene expression in the PVN and the SON of depressed
patients and controls
The transcript levels of CRF, OXT, GRa, AR and ESR1
were found to be significantly higher in the PVN than
in the SON both in the depressed patients and in the
controls (Table 4), whereas the MR, ESR2 and CRFR1
were significantly more expressed in the PVN in the
depressed patients than in the controls. There was no
significant change of AVP mRNA in SON and PVN of
depressed patients. A similar level of expression for
the PVN and the SON was found for CREB, TNFa,
Table 3 Mean gene expression levels in the PVN for controls versus depression
CRF AVP AVPR1A CREB OXT TNFa IL1b GRa MR CRFR1 CRFR2 AR ESR1 ESR2 HSP 70 HSP90
Median of depression 224 576 4 061 582 686 3997 855 901 8574 17 108 11 432 33 381 12 532 3927 5776 4898 130 550 21 750 213 062
Median of control 116 209 2 121 455 615 2894 424 931 3666 14 354 11 235 15 383 5017 1359 15 383 2815 88 157 17 893 190 517
P-value 0.048* 0.11 0.048* 0.18 0.085 0.085 0.482 0.406 0.006** 0.048* 0.085 0.048* 0.013* 0.064 0.406 0.406
Abbreviations: AR, androgen receptor; AVP, vasopressin; AVPR1A, AVP receptor 1a; CRF, corticotropin-releasing factor; CRFR, CRF receptors; CREB, cAMP-response
element-binding protein; ESR, estrogen receptor; GR, glucocorticoid receptor; HSP, heat shock protein; IL1b, interleukin 1-b; MR, mineralocorticoid receptor; OXT,
oxytocin; TNFa, tumor necrosis factor-a.
The values represent the total amount of gene expression in the PVN.
*P 0.05, **P 0.01.
Gene expression analysis in the human hypothalamus
S-S Wang et al
793
Molecular Psychiatry

9. Figure 2 Transcript levels of corticotropin-releasing factor (CRF) (a), CRF receptors 1 (CRFR1) (b), mineralocorticoid
receptor (MR) (c), estrogen-receptor (ESR) 1 (d) and vasopressin receptor 1a (AVPR1A) (e) were found to be significantly
higher in the paraventricular nucleus (PVN) of the depression group while androgen receptor (AR) (f) was significantly
decreased compared to the controls. Dots represent the total expression levels in the PVN and supraoptic nucleus (SON) of
individual depressed subjects (n = 7) and controls (n = 7). The numbers1–7 beside the dots represent the patients correlated to
D1–D7, respectively, in Table 1. C1–C7 represents the controls. Numbers 3 and 6 represent the two bipolar disorder (BD)
patients. The horizontal line indicates the median value. The asterisk demonstrates a significant difference in the PVN in
depression versus controls. *P 0.05; **P 0.01.
IL1b, CRFR2, HSP70 and 90. GR subtype-b (GRb)
mRNA was not detected by real-time qPCR, probably
because of its low abundance (Table 4).
Discussion
The present study shows that in depression, the
increase in CRF expression was accompanied by a
significant increased expression of four genes that are
involved in activation of CRF neurons, that is, CRFR1,
ESR1, MR and AVPR1A, while the expression of the
AR that is involved in the inhibition of CRF
neurons was decreased significantly. The direction
in which 13 out of the 16 genes changed their
expression level was significant and confirmed our
hypothesis. The data were obtained in the PVN and
SON of depressed patients and controls, using for the
first-time LMD of the SON and PVN tissue followed
by real-time qPCR in these patients. The results
indicate that depression is accompanied by an
imbalance in the expression of genes regulating the
HPA axis.
Gene expression analysis in the human hypothalamus
S-S Wang et al
794
Molecular Psychiatry

10. Gene expression analysis in the human hypothalamus
S-S Wang et al
Figure 3 Correlation between the expression levels of sex hormone receptors. (a) Estrogen-receptor (ESR) 1 mRNA was
positively correlated with ESR2 mRNA in the paraventricular nucleus (PVN) both in depressed patients and controls. (b) A
significant correlation was presented between androgen receptor (AR)- and ESR1-mRNA and AR- and ESR2-mRNA in the
PVN only in depression.
Table 4 Differences in gene expression between the PVN and the SON (the value represents the median of the total expression
levels per PVN or SON)
CRF AVP AVPR1A CREB OXT TNFa IL1b GRa MR CRFR1 CRFR2 AR ESR1 ESR2 HSP 70 HSP90
CRF neurons and CRFR1 and CRFR2 imbalance
The CRF hypothesis of depression is supported in our
study by the increased total amount of CRF mRNA in
the PVN of depressed patients, now for the first time
determined by real-time PCR. This confirms our
earlier studies in depressed patients with other
techniques, showing an increase in the number of
CRF-immunopositive neurons in depression4,28 and
elevated levels of CRF mRNA as determined by in situ
hybridization.5 So far, only one related study45 on
brain tissue in suicide victims has been carried out in
which no significant increase of CRF mRNA in the
PVN was found. However, in the study, the concen-tration
of CRF was measured in a PVN punch and not
the total amount of CRF mRNA in the PVN, as we did
in the present study.
Our new finding of an enhanced amount of CRFR1
mRNA in the PVN in depressed patients supports the
CRF hypothesis of depression. No information on this
receptor has been available for the human brain until
now. Although observations in human post-mortem
material can only reveal correlations and cannot
distinguish cause and effect, our findings are fully
supported by the enhanced CRF expression in the
PVN in various types of stress in rodents that
mediates CRF-induced ACTH secretion, anxiety and
anorectic effects. CRFR1 expression occurs widely in
the central nervous system indicating a large number
of sites of CRF action. The expression of CRFR1 is low
within the PVN but substantially and selectively
increases after stress.46 It is surprising that an increase
in ligand (CRF) expression is associated with an
increase in the expression of its cognate receptor
CRFR1 rather than downregulation, but again this
observation agrees very well with the animal experi-mental
data. Injection of CRF in the rodent PVN
increased CRFR1 expression, and the majority of the
CRF-containing neurons in the PVN express this
receptor.47 There are also CRF synapses on CRF
neurons present in the rat PVN.48 In our study, the
increase of CRF was accompanied by an increase of
CRFR1 expression in the PVN. This suggests a
Depression
PVN 224 576 4 061 582 686 3997 855 901 8574 17 108 11 432 33 381 12 532 3927 5776 4898 130 550 21 750 213 062
SON 1363 4 029 505 698 2717 126 638 5977 9094 5131 11 156 2733 2631 2091 1191 81 552 14 720 176 688
P-value 0.002a 0.848 0.475 0.180 0.002a 0.277 0.180 0.018a 0.004a 0.004a 0.338 0.009a 0.002a 0.035a 0.406 0.565
Controls
PVN 116 209 2 121 455 615 2894 424 931 3666 14 354 11 235 15 383 5017 1359 15 383 2815 88 157 17 893 190 517
SON 2336 3 828 294 669 2716 110 072 6427 23 745 4715 12 821 2667 2131 2874 1024 110 612 16 448 187 961
P-value 0.002b 0.003b 0.225 0.609 0.013b 0.225 0.277 0.013b 0.565 0.110 0.277 0.003b 0.035b 0.338 0.848 0.949
Abbreviations: AR, androgen receptor; AVP, vasopressin; AVPR1A, AVP receptor 1a; CRF, corticotropin-releasing factor;
CRFR, CRF receptors; CREB, cAMP-response element-binding protein; ESR, estrogen receptor; GR, glucocorticoid receptor;
HSP, heat shock protein; IL1b, interleukin 1-b; MR, mineralocorticoid receptor; OXT, oxytocin; PVN, paraventricular
nucleus; SON, supraoptic nucleus; TNFa, tumor necrosis factor-a.
aP 0.05, significant differences in the PVN and SON of the depressed patients.
bP 0.05, significant differences in the PVN and SON of the controls.
795
Molecular Psychiatry

11. potential autocrine or neuroendocrine effect of CRF
on CRF cells. CRF seems to enhance its own response
to stress by increasing amount of CRFR1 in the CRF
neural circuits within the PVN by an ultra short
positive feedback loop as part of the functional
adaptation of the HPA axis in response to stress.
Indeed, a CRFR1 polymorphism is associated with an
increased risk to present a seasonal pattern and an
early onset of the first depressive episode,49 indicat-ing
a possible causal role of this receptor in the
pathogenesis of some aspects of depression. More-over,
CRFR1 seems to be involved in the antidepres-sant
response to selective serotonin reuptake
blocker.11 CRFR2, which opposes the actions of
CRFR122 and mediates an anxiolytic effect,50 showed
nonsignificant change, indicating an imbalance in the
regulation of CRF in depression via the two CRF
receptors. Our data support the hypothesis that
increased CRF signaling via CRFR1 is an important
mechanism in the pathogenesis of depression and
that CRFR1 antagonists might be an effective novel
class of antidepressant drugs.21,51
CREB
cAMP-response element-binding protein has a critical
role as a transcription factor in the response to several
signal transduction cascades. A genome-wide linkage
survey suggested that pathways converging on CREB
may also affect the development of MD.52 There are
cAMP-response elements located in the CRF gene
promoter and binding of CREB stimulates CRF gene
expression.27 In vitro, glucocorticoids inhibit the CRF
promoter through cAMP-dependent activity.53 How-ever,
in our study, a change in CREB mRNA to
accompany the increase of CRF mRNA expression in
the PVN in depression was not found, so that our data
do not provide support for a central role of CREB in
the PVN in mood disorders. Alternatively, CRF gene
regulation by CREB might not be attributed to
different expression levels of CREB mRNA but to
protein levels of phosphorylated CREB, which has
been studied both in vitro and in vivo.27,54
GR and MR imbalance
The glucocorticoid feedback on the HPA axis is
mediated by two types of receptors, GR and MR that
have a different localization in the brain.16 In
depression, a downregulation of these receptors,
secondary to the persistent hypercortisolism was
presumed. However, Young et al.17 found with
endocrine assays an indication that, despite the high
basal cortisol levels in patients with MD, an increased
functional activity of the MR system was present. We
observed an increased expression of MR, whereas
GRa was not altered and the GRb, as an inhibitory
modulator of GRa, was undetectable. A very low
GRb expression was also reported in the human
hippocampus.55 Our observations confirm, but now
by direct measurements in the PVN, the findings of
Young et al.17 of increased MR and support the
GR/MR imbalance hypothesis for depression as
formulated by De Kloet et al.16 The proportion of
hetero- and homodimers of the MR and GR receptors
influences the efficacy of gene transcription.20 Our
finding of an imbalance of MR/GR ratio in the PVN of
depressed patients may, therefore, contribute to the
change in transcription rate of CRF.
MR and GR in the hippocampus mediate in a
coordinate manner the steroid control of HPA activity
via GABAergic neurons.56,57 A balance between GR
and MR is thought to be important for homeostasis
and an imbalance through an excess of MR or GR was
proposed to enhance vulnerability to depression.16
MR has been found to colocalize with GR in the
parvocellular neurons in rat PVN.58 Fornix transac-tion
or adrenalectomy induced a significant increase
in MR mRNA signal in the parvocellular region
together with an increase in CRF mRNA in the
PVN.59 The increased MR we found in the PVN thus
agrees with the other measures of HPA-axis activa-tion.
Changes in corticosteroid receptor in depression
seem to differ per brain region.60 Decreased GR mRNA
levels have been found in depression in various
neocortical and hippocampal areas, while diminished
MR levels were found in the prefrontal cortex,61
which may contribute to the proposed imbalance
between GR and MR in depression.
HSP
The assembly of various co-chaperone proteins, such as
HSP70 and 90, to the GR-chaperone complex, directs
the GR to adopt a glucocorticoid-binding conformation.
Glucocorticoid resistance is frequently observed in
depressed patients and is thought to be associated with
alterations in HSP70 and 90.33 In addition, some studies
show that alterations in HSP70 or 90 are accompanied
by mood disorders.62,63 However, we did not find
different HSP70 or 90 expressions in the PVN in
depressed patients and the data therefore do not support
a central role for these HSP molecules in depression.
Sex hormones receptor imbalance
Fluctuations in sex hormone levels are a risk factor for
depression.1 In addition, polymorphisms in the genes
for the sex hormone receptors AR and ESR1/2 were
recently found to be risk factors for this disorder.64 Sex
hormones can affect the HPA axis in a direct way via
ESRs and ARs that are expressed by CRF neurons.28,29
There are five perfect half-palindromic estrogen-responsive
elements in the human CRF-promoter
region, which may confer direct estrogenic stimulation
on CRF gene expression.28,65 Differential effects have
been described in vitro on gene expression by the two
receptor subtypes ESR1 and 2.66 ESR1 mRNA expres-sion
dominates in the human hypothalamus while
ESR2 mRNA and protein were lower in this brain
area.28,67 In contrast to estrogens, androgens may
inhibit CRF gene expression via AR expressed by
CRF neurons, acting by androgen-responsive elements
in the CRF-promoter region.29,68 In the present study,
we found a differential change in sex hormone
receptors. The expression of ESR1 mRNAwas upregu-
Gene expression analysis in the human hypothalamus
S-S Wang et al
796
Molecular Psychiatry

12. lated in depressed subjects, whereas AR was down-regulated
compared with the controls. Both changes go
together with increased CRF expression. Moreover,
there was only a trend for an increase of ESR2
expression, while activation of this receptor subtype
reduces anxiety.69 The two ESR subtypes correlated
positively both in depressed patients and controls
(Figure 3a), while a correlation between ESR and AR
was only found in the PVN of depressed patients as
shown in Figure 3b. Our data show an imbalance in the
changes of the three sex hormone receptors that will
contribute to the increased activity of the CRF neurons
and thus to the signs and symptoms of depression.
Cytokines
Cytokine levels may be enhanced during depression
and elicit depressive symptoms.70,71 CRF production is
stimulated by proinflammatory cytokines such as
IL1b,72,73 produced by glial cells and PVN neurons.30
Also TNFa, a circulating state marker for depression
may stimulate CRF production.31,74 In addition, TNFa
is produced by astrocytes and ependymal cells.32 In
the present study, we did not find a change of TNFa or
IL1b in mRNA levels in the PVN in depressed patients.
AVP
No significant difference of AVP mRNA expression
was found between the SON or the PVN of controls
and depressed patients, AVP mRNA expression was
earlier found to be significantly increased in both the
SON and the PVN, but only in the melancholic
subgroup of depressed patients.24 In the present
study, only one patient was diagnosed as having the
melancholic type of depression (Table 1), which fully
explained why we did not find a significant change of
AVP mRNA in our group of depressed subjects.
The receptor AVPR1A was reported to be present in
the rat PVN and to control hormone release.75,76 In
animal experiments, AVPR1A immunoreactive cells
in the PVN increased after mineralocorticoid adminis-tration77
and an AVPR1A antagonist resulted in a
decrease in anxiety/depression-related behavior.25
The increased AVPR1A mRNA found in the PVN of
depressed patients may therefore be directly related
with the symptoms of depression.
Several limitations of the present study should be
mentioned. The groups are relatively limited in size.
However, for qPCR, frozen brain material is needed
from clinically well-documented depressed patients
and well-matched control material with a relatively
short post-mortem time and good quality RNA, which
is extremely difficult to obtain.
A second point is that the five MD subjects and the
two BD patients may be seen as pathophysiologically
non-identical entities. For instance, image studies
showed that the hippocampal volume is reduced in
MD, while BD patients did not show a reduction of
hippocampal volume.78 Indeed, for each depression
subtype—and even probably for each MD patient—
there are different genetic and epigenetic factors
involved in the pathogenesis of depression. However,
Gene expression analysis in the human hypothalamus
S-S Wang et al
previous studies have shown that both, MD and BD,
are accompanied by an activation of the final common
pathway, the HPA axis. Both types of depression
exhibit similar activation of the CRF- and ESR1-
expressing neurons in the hypothalamic PVN,4,5,28
both go together with a decreased activity in the
biological clock.79 Apparently, whatever the indivi-dual
risk factors and pathogenetic mechanisms for MD
and BD are, they ultimately seem to lead to similar
activity changes on the level of the hypothalamus.
At a third point, it should be noted that the
increased activity of the PVN CRF neurons in the
patients with mood disorders is unlikely to be the
result of the administration of antidepressants, since
it has been found that they may attenuate rather than
enhance the activity of CRF neurons.80–83 Thus, if
antidepressants interfered with our measurements,
this would have led to an underestimation of the
observed difference between controls and patients
with mood disorders with regard to the activation of
their CRF-expressing neurons in the PVN. Further-more,
antidepressants did not influence AVP mRNA
or OXT mRNA levels in PVN and SON in an animal
experimental study.84 On the effect on the expression
of the other genes studied (MR, ESR, AR and CRFR),
there is, however, insufficient information.
In conclusion, in the present study, we combined
laser microdissection and real-time PCR, which enables
detection of differences in gene expression levels in
specific areas of the human hypothalamus. A combina-tion
of in situ hybridization and immunocytochemistry
would be a next step to determine in what cell type in
the PVN the expression of the different genes is
localized. Our study contributes new data to the
question how the activity of the HPA axis may be
modulated by a number of factors in depression. The
finding of multiple receptor imbalances in the PVN
indicates new targets for future work, a study of
possible cross talk between these receptors systems in
theMD being one of them. The significant change in the
expression of five genes that all indicate a stimulation
of the HPA-axis activity may also offer new avenues for
therapeutic strategies, such as testing combinations of
different receptor agonists and antagonists.
Acknowledgments
We are indebted to the Netherlands Brain Bank at the
Netherlands Institute for Neuroscience for providing
us with the brain material and patient information.
We thank Dr Michel A Hofman and Dr Aimin Bao for
their statistical assistance, Dr Gerben Meynen for the
psychiatric evaluations, Dimitra Kontostavlaki for pro-viding
us with the primers and Dr Elly Hol, Nathalie
Koning, Dr Yinhui Wu, Tian Zhou, Bart Fisser, Rawien
A Balesar, Arja A Sluiter, Unga A Unmehopa, Joop Van
Heerikhuize and Paula van Hulten van Run for their
technical advice. This investigation was supported by
the projects of the Royal Netherlands Academy of Arts
and Sciences (06CDP026) and the Natural Science
Foundation of China (30530310).
797
Molecular Psychiatry

13. References
1 Bao AM, Meynen G, Swaab DF. The stress system in depression
and neurodegeneration: focus on the human hypothalamus. Brain
Res Rev 2008; 57: 531–553.
2 Nemeroff CB. The corticotropin-releasing factor (CRF) hypothesis
of depression: new findings and new directions. Mol Psychiatry
1996; 1: 336–342.
3 Holsboer F. The corticosteroid receptor hypothesis of depression.
Neuropsychopharmacology 2000; 23: 477–501.
4 Raadsheer FC, Hoogendijk WJ, Stam FC, Tilders FJ, Swaab DF.
Increased numbers of corticotropin-releasing hormone expressing
neurons in the hypothalamic paraventricular nucleus of depressed
patients. Neuroendocrinology 1994; 60: 436–444.
5 Raadsheer FC, van Heerikhuize JJ, Lucassen PJ, Hoogendijk WJ,
Tilders FJ, Swaab DF. Corticotropin-releasing hormone mRNA
levels in the paraventricular nucleus of patients with Alzheimer’s
disease and depression. Am J Psychiatry 1995; 152: 1372–1376.
6 Holsboer F. Stress, hypercortisolism and corticosteroid receptors
in depression: implications for therapy. J Affect Disord 2001; 62:
77–91.
7 Liu Z, Zhu F, Wang G, Xiao Z, Wang H, Tang J et al. Association of
corticotropin-releasing hormone receptor1 gene SNP and haplo-type
with major depression. Neurosci Lett 2006; 404: 358–362.
8 Wasserman D, Sokolowski M, Rozanov V, Wasserman J. The
CRHR1 gene: a marker for suicidality in depressed males exposed
to low stress. Genes Brain Behav 2008; 7: 14–19.
9 Heuser I, Bissette G, Dettling M, Schweiger U, Gotthardt U,
Schmider J et al. Cerebrospinal fluid concentrations of cortico-tropin-
releasing hormone, vasopressin, and somatostatin in
depressed patients and healthy controls: response to amitriptyline
treatment. Depress Anxiety 1998; 8: 71–79.
10 Stenzel-Poore MP, Heinrichs SC, Rivest S, Koob GF, Vale WW.
Overproduction of corticotropin-releasing factor in transgenic
mice: a genetic model of anxiogenic behavior. J Neurosci 1994;
14(5 Part 1): 2579–2584.
11 Grammatopoulos DK, Chrousos GP. Functional characteristics of
CRH receptors and potential clinical applications of CRH-receptor
antagonists. Trends Endocrinol Metab 2002; 13: 436–444.
12 Keck ME, Holsboer F. Hyperactivity of CRH neuronal circuits as a
target for therapeutic interventions in affective disorders. Peptides
2001; 22: 835–844.
13 Ruhe HG, Mason NS, Schene AH. Mood is indirectly related to
serotonin, norepinephrine and dopamine levels in humans: a
meta-analysis of monoamine depletion studies. Mol Psychiatry
2007; 12: 331–359.
14 Swaab DF, Fliers E, Hoogendijk WJ, Veltman DJ, Zhou JN.
Interaction of prefrontal cortical and hypothalamic systems in
the pathogenesis of depression. Prog Brain Res 2000; 126:
369–396.
15 Reyes BA, Valentino RJ, Xu G, Van Bockstaele EJ. Hypothalamic
projections to locus coeruleus neurons in rat brain. Eur J Neurosci
2005; 22: 93–106.
16 de Kloet ER, Derijk RH, Meijer OC. Therapy insight: is there an
imbalanced response of mineralocorticoid and glucocorticoid
receptors in depression? Nat Clin Pract Endocrinol Metab 2007;
3: 168–179.
17 Young EA, Lopez JF, Murphy-Weinberg V, Watson SJ, Akil H.
Mineralocorticoid receptor function in major depression. Arch
Gen Psychiatry 2003; 60: 24–28.
18 Nestler EJ, Barrot M, DiLeone RJ, Eisch AJ, Gold SJ, Monteggia LM.
Neurobiology of depression. Neuron 2002; 34: 13–25.
19 Miller DB, O’Callaghan JP. Aging, stress and the hippocampus.
Ageing Res Rev 2005; 4: 123–140.
20 Trapp T, Rupprecht R, Castren M, Reul JM, Holsboer F. Hetero-dimerization
between mineralocorticoid and glucocorticoid re-ceptor:
a new principle of glucocorticoid action in the CNS.
Neuron 1994; 13: 1457–1462.
21 Muller MB, Wurst W. Getting closer to affective disorders: the role
of CRH receptor systems. Trends Mol Med 2004; 10: 409–415.
22 Imaki T, Katsumata H, Miyata M, Naruse M, Imaki J, Minami S.
Expression of corticotropin-releasing hormone type 1 receptor in
paraventricular nucleus after acute stress. Neuroendocrinology
2001; 73: 293–301.
23 Valdez GR, Zorrilla EP, GF K. Homeostasis within the cortico-tropin-
releasing factor system via CRF2 receptor activation: a
novel approach for the treatment of anxiety. Drug Dev Res 2005;
65: 205–215.
24 Meynen G, Unmehopa UA, van Heerikhuize JJ, Hofman MA,
Swaab DF, Hoogendijk WJ. Increased arginine vasopressin mRNA
expression in the human hypothalamus in depression: a pre-liminary
report. Biol Psychiatry 2006; 60: 892–895.
25 Wigger A, Sanchez MM, Mathys KC, Ebner K, Frank E, Liu D et al.
Alterations in central neuropeptide expression, release, and
receptor binding in rats bred for high anxiety: critical role of
vasopressin. Neuropsychopharmacology 2004; 29: 1–14.
26 Meynen G, Unmehopa UA, Hofman MA, Swaab DF, Hoogendijk WJ.
Hypothalamic oxytocin mRNA expression and melancholic
depression. Mol Psychiatry 2007; 12: 118–119.
27 Legradi G, Holzer D, Kapcala LP, Lechan RM. Glucocorticoids
inhibit stress-induced phosphorylation of CREB in corticotropin-releasing
hormone neurons of the hypothalamic paraventricular
nucleus. Neuroendocrinology 1997; 66: 86–97.
28 Bao AM, Hestiantoro A, Van Someren EJ, Swaab DF, Zhou JN.
Colocalization of corticotropin-releasing hormone and oestrogen
receptor-alpha in the paraventricular nucleus of the hypothalamus
in mood disorders. Brain 2005; 128(Part 6): 1301–1313.
29 Bao AM, Fischer DF, Wu YH, Hol EM, Balesar R, Unmehopa UA et
al. A direct androgenic involvement in the expression of human
corticotropin-releasing hormone. Mol Psychiatry 2006; 11: 567–576.
30 Huitinga I, van der Cammen M, Salm L, Erkut Z, van Dam A,
Tilders F et al. IL-1beta immunoreactive neurons in the human
hypothalamus: reduced numbers in multiple sclerosis. J Neuro-immunol
2000; 107: 8–20.
31 Himmerich H, Binder EB, Kunzel HE, Schuld A, Lucae S, Uhr M
et al. Successful antidepressant therapy restores the disturbed
interplay between TNF-alpha system and HPA axis. Biol Psychia-try
2006; 60: 882–888.
32 Kuno R, Yoshida Y, Nitta A, Nabeshima T, Wang J, Sonobe Y et al.
The role of TNF-alpha and its receptors in the production of NGF
and GDNF by astrocytes. Brain Res 2006; 1116: 12–18.
33 Tissing WJ, Meijerink JP, den Boer ML, Brinkhof B, Pieters R.
mRNA expression levels of (co)chaperone molecules of the
glucocorticoid receptor are not involved in glucocorticoid resis-tance
in pediatric ALL. Leukemia 2005; 19: 727–733.
34 Braak H, Braak E. Neuropathological stageing of Alzheimer-related
changes. Acta Neuropathol (Berl) 1991; 82: 239–259.
35 van de Nes JA, Kamphorst W, Ravid R, Swaab DF. Comparison of
beta-protein/A4 deposits and Alz-50-stained cytoskeletal changes
in the hypothalamus and adjoining areas of Alzheimer’s disease
patients: amorphic plaques and cytoskeletal changes occur
independently. Acta Neuropathol (Berl) 1998; 96: 129–138.
36 Koning N, Bo L, Hoek RM, Huitinga I. Downregulation of
macrophage inhibitory molecules in multiple sclerosis lesions.
Ann Neurol 2007; 62: 504–514.
37 Kamphuis W, Schneemann A, van Beek LM, Smit AB, Hoyng PF,
Koya E. Prostanoid receptor gene expression profile in human
trabecular meshwork: a quantitative real-time PCR approach.
Invest Ophthalmol Vis Sci 2001; 42: 3209–3215.
38 Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N,
De Paepe A et al. Accurate normalization of real-time quantitative
RT-PCR data by geometric averaging of multiple internal control
genes. Genome Biol 2002; 3: RESEARCH0034.1-0034.11.
39 Dheda K, Huggett JF, Bustin SA, Johnson MA, Rook G, Zumla A.
Validation of housekeeping genes for normalizing RNA expression
in real-time PCR. Biotechniques 2004; 37: 112–114, 116, 118–119.
40 Huggett J, Dheda K, Bustin S, Zumla A. Real-time RT-PCR
normalisation; strategies and considerations. Genes Immun 2005;
6: 279–284.
41 Bustin SA, Benes V, Nolan T, Pfaffl MW. Quantitative real-time
RT-PCR—a perspective. J Mol Endocrinol 2005; 34: 597–601.
42 Tricarico C, Pinzani P, Bianchi S, Paglierani M, Distante V,
Pazzagli M et al. Quantitative real-time reverse transcription
polymerase chain reaction: normalization to rRNA or single
housekeeping genes is inappropriate for human tissue biopsies.
Anal Biochem 2002; 309: 293–300.
43 Elberg G, Elberg D, Logan CJ, Chen L, Turman MA. Limitations of
commonly used internal controls for real-time RT-PCR analysis of
Gene expression analysis in the human hypothalamus
S-S Wang et al
798
Molecular Psychiatry

14. renal epithelial-mesenchymal cell transition. Nephron Exp
Nephrol 2006; 102: e113–e122.
44 Batschelet . Circular Statistics in Biology. Academic Press: New
York, 1981.
45 Merali Z, Kent P, Du L, Hrdina P, Palkovits M, Faludi G et al.
Corticotropin-releasing hormone, arginine vasopressin, gastrin-releasing
peptide, and neuromedin B alterations in stress-relevant
brain regions of suicides and control subjects. Biol Psychiatry
2006; 59: 594–602.
46 Mansi JA, Rivest S, Drolet G. Regulation of corticotropin-releasing
factor type 1 (CRF1) receptor messenger ribonucleic acid in the
paraventricular nucleus of rat hypothalamus by exogenous CRF.
Endocrinology 1996; 137: 4619–4629.
47 Imaki T, Naruse M, Harada S, Chikada N, Imaki J, Onodera H et al.
Corticotropin-releasing factor up-regulates its own receptor mRNA
in the paraventricular nucleus of the hypothalamus. Brain Res Mol
Brain Res 1996; 38: 166–170.
48 Silverman AJ, Hou-Yu A, Chen WP. Corticotropin-releasing factor
synapses within the paraventricular nucleus of the hypothalamus.
Neuroendocrinology 1989; 49: 291–299.
49 Papiol S, Arias B, Gasto C, Gutierrez B, Catalan R, Fananas L. Genetic
variability at HPA axis in major depression and clinical response to
antidepressant treatment. J Affect Disord 2007; 104: 83–97.
50 Kishimoto T, Radulovic J, Radulovic M, Lin CR, Schrick C,
Hooshmand F et al. Deletion of crhr2 reveals an anxiolytic role for
corticotropin-releasing hormone receptor-2. Nat Genet 2000; 24:
415–419.
51 Kunzel HE, Zobel AW, Nickel T, Ackl N, Uhr M, Sonntag A et al.
Treatment of depression with the CRH-1-receptor antagonist
R121919: endocrine changes and side effects. J Psychiatr Res
2003; 37: 525–533.
52 Zubenko GS, Maher B, Hughes III HB, Zubenko WN, Stiffler JS,
Kaplan BB et al. Genome-wide linkage survey for genetic loci that
influence the development of depressive disorders in families
with recurrent, early-onset, major depression. Am J Med Genet B
Neuropsychiatr Genet 2003; 123: 1–18.
53 Nicholson RC, King BR, Smith R. Complex regulatory interactions
control CRH gene expression. Front Biosci 2004; 9: 32–39.
54 Wolfl S, Martinez C, Majzoub JA. Inducible binding of cyclic
adenosine 30,50-monophosphate (cAMP)-responsive element bind-ing
protein (CREB) to a cAMP-responsive promoter in vivo. Mol
Endocrinol 1999; 13: 659–669.
55 DeRijk RH, Schaaf M, Stam FJ, de Jong IE, Swaab DF, Ravid R et al.
Very low levels of the glucocorticoid receptor beta isoform in the
human hippocampus as shown by Taqman RT-PCR and immuno-cytochemistry.
Brain Res Mol Brain Res 2003; 116: 17–26.
56 de Kloet ER. Hormones, brain and stress. Endocr Regul 2003;
37: 51–68.
57 Cole RL, Sawchenko PE. Neurotransmitter regulation of cellular
activation and neuropeptide gene expression in the paraventri-cular
nucleus of the hypothalamus. J Neurosci 2002; 22: 959–969.
58 Han F, Ozawa H, Matsuda K, Nishi M, Kawata M. Colocalization of
mineralocorticoid receptor and glucocorticoid receptor in the
hippocampus and hypothalamus. Neurosci Res 2005; 51: 371–381.
59 Han F, Ozawa H,Matsuda KI, Lu H, De Kloet ER, KawataM. Changes
in the expression of corticotrophin-releasing hormone, mineralocor-ticoid
receptor and glucocorticoid receptor mRNAs in the hypotha-lamic
paraventricular nucleus induced by fornix transection and
adrenalectomy. J Neuroendocrinol 2007; 19: 229–238.
60 Webster MJ, Knable MB, O’Grady J, Orthmann J, Weickert CS.
Regional specificity of brain glucocorticoid receptor mRNA
alterations in subjects with schizophrenia and mood disorders.
Mol Psychiatry 2002; 7: 985–994, 924.
61 Xing GQ, Russell S, Webster MJ, Post RM. Decreased expression of
mineralocorticoid receptor mRNA in the prefrontal cortex in
schizophrenia and bipolar disorder. Int J Neuropsychopharmacol
2004; 7: 143–153.
62 Shen WW, Liu HC, Yang YY, Lin CY, Chen KP, Yeh TS et al.
Anti-heat shock protein 90 is increased in acute mania. Aust N Z
J Psychiatry 2006; 40: 712–716.
63 Shimizu S, Nomura K, Ujihara M, Sakamoto K, Shibata H, Suzuki T
et al. An allele-specific abnormal transcript of the heat shock
protein 70 gene in patients with major depression. Biochem
Biophys Res Commun 1996; 219: 745–752.
Gene expression analysis in the human hypothalamus
S-S Wang et al
64 Geng Y-G, Su Q-R, Su L-Y, Chen Q, Ren G-Y, Shen S-Q et al.
Comparison of the polymorphisms of androgen receptor gene and
estrogen alpha and beta gene between adolescent females with
first-onset major depressive disorder and controls. Int J Neurosci
2007; 117: 539–547.
65 Vamvakopoulos NC, Chrousos GP. Evidence of direct estrogenic
regulation of human corticotropin-releasing hormone gene expres-sion.
Potential implications for the sexual dimophism of the stress
response and immune/inflammatory reaction. J Clin Invest 1993;
92: 1896–1902.
66 Paech K, Webb P, Kuiper GG, Nilsson S, Gustafsson J, Kushner PJ
et al. Differential ligand activation of estrogen receptors ERalpha
and ERbeta at AP1 sites. Science 1997; 277: 1508–1510.
67 Osterlund MK, Gustafsson JA, Keller E, Hurd YL. Estrogen receptor
beta (ERbeta) messenger ribonucleic acid (mRNA) expression
within the human forebrain: distinct distribution pattern to
ERalpha mRNA. J Clin Endocrinol Metab 2000; 85: 3840–3846.
68 Lund TD, Munson DJ, Haldy ME, Handa RJ. Androgen inhibits,
while oestrogen enhances, restraint-induced activation of neuro-peptide
neurones in the paraventricular nucleus of the hypotha-lamus.
J Neuroendocrinol 2004; 16: 272–278.
69 Bodo C, Rissman EF. New roles for estrogen receptor beta in
behavior and neuroendocrinology. Front Neuroendocrinol 2006;
27: 217–232.
70 Besedovsky HO, del Rey A. Immune-neuro-endocrine interac-tions:
facts and hypotheses. Endocr Rev 1996; 17: 64–102.
71 Hayley S, Poulter MO, Merali Z, Anisman H. The pathogenesis of
clinical depression: stressor- and cytokine-induced alterations of
neuroplasticity. Neuroscience 2005; 135: 659–678.
72 Berkenbosch F, van Oers J, del Rey A, Tilders F, Besedovsky H.
Corticotropin-releasing factor-producing neurons in the rat acti-vated
by interleukin-1. Science 1987; 238: 524–526.
73 Melik Parsadaniantz S, Levin N, Lenoir V, Roberts JL, Kerdelhue B.
Human interleukin 1 beta: corticotropin releasing factor and
ACTH release and gene expression in the male rat: in vivo and
in vitro studies. J Neurosci Res 1994; 37: 675–682.
74 O’Brien SM, Scott LV, Dinan TG. Cytokines: abnormalities in major
depression and implications for pharmacological treatment. Hum
Psychopharmacol 2004; 19: 397–403.
75 Hurbin A, Boissin-Agasse L, Orcel H, Rabie A, Joux N,
Desarmenien MG et al. The V1a and V1b, but not V2, vasopressin
receptor genes are expressed in the supraoptic nucleus of the rat
hypothalamus, and the transcripts are essentially colocalized in
the vasopressinergic magnocellular neurons. Endocrinology 1998;
139: 4701–4707.
76 Hurbin A, Orcel H, Alonso G, Moos F, Rabie A. The vasopressin
receptors colocalize with vasopressin in the magnocellular
neurons of the rat supraoptic nucleus and are modulated by water
balance. Endocrinology 2002; 143: 456–466.
77 Pietranera L, Saravia F, Roig P, Lima A, De Nicola AF.
Mineralocorticoid treatment upregulates the hypothalamic vaso-pressinergic
system of spontaneously hypertensive rats. Neuroen-docrinology
2004; 80: 100–110.
78 Videbech P, Ravnkilde B. Hippocampal volume and depression: a
meta-analysis of MRI studies. Am J Psychiatry 2004; 161: 1957–1966.
79 Zhou JN, Riemersma RF, Unmehopa UA, Hoogendijk WJ,
van Heerikhuize JJ, Hofman MA et al. Alterations in arginine
vasopressin neurons in the suprachiasmatic nucleus in depres-sion.
Arch Gen Psychiatry 2001; 58: 655–662.
80 Fischer P, Simanyi M, Danielczyk W. Depression in dementia of
the Alzheimer type and in multi-infarct dementia. Am J Psychiatry
1990; 147: 1484–1487.
81 Vingerhoets AJ, Ratliff-Crain J, Jabaaij L, Tilders FJ, Moleman P,
Menges LJ. Self-reported stressors, symptom complaints and
psychobiological functioning-II: psychoneuroendocrine variables.
J Psychosom Res 1996; 40: 191–203.
82 Nemeroff CB. Dosing the antipsychotic medication olanzapine.
J Clin Psychiatry 1997; 58(Suppl 10): 45–49.
83 Oldehinkel AJ, van den Berg MD, Flentge F, Bouhuys AL, ter Horst
GJ, Ormel J. Urinary free cortisol excretion in elderly persons with
minor and major depression. Psychiatry Res 2001; 104: 39–47.
84 Marar IE, Amico JA. Vasopressin, oxytocin, corticotrophin-releas-ing
factor, and sodium responses during fluoxetine administration
in the rat. Endocrine 1998; 8: 13–18.
799
Molecular Psychiatry