1. Hellinga Lab Protocol
Department of Biochemistry
Duke University Medical Center
Protein Fabrication Automation (PFA)
Protocol #3
TNT CREATION:
in vitro coupled transcription and translation reactions
Written by J. Colin Cox, Ph.D.
Version 1.2 (December 23, 2009)
2. 2
Introduction......................................................................................................................... 4
1. Mark II system............................................................................................................... 5
1.1 Description of a basic TnT reaction......................................................................... 5
1.1.1 Cellular machinery............................................................................................. 5
1.1.2 Raw materials.................................................................................................... 5
1.1.3 Energy and energy regeneration compounds.................................................... 6
1.1.4 Inhibitory compounds....................................................................................... 6
1.1.5 Stabilizing compounds...................................................................................... 6
1.1.6 DNA template................................................................................................... 6
1.2 Analysis of the Swartz lab’s findings ...................................................................... 7
1.2.1 Pyruvate (and NAD, CoA, and oxalate) ........................................................... 7
1.2.2 Contrasting PANOxSP with Cytomim ............................................................. 7
1.2.3 Oxygen.............................................................................................................. 8
1.2.4 Buffering........................................................................................................... 8
1.3 Changes from the Swartz lab system....................................................................... 9
1.3.1 Fermentation ..................................................................................................... 9
1.3.2 Reaction mix components pre-mixing.............................................................. 9
1.3.3 BL21 Star cell strain ......................................................................................... 9
1.3.4 Template terminal blockage.............................................................................. 9
1.3.5 Additional reaction mix compounds............................................................... 10
1.4 Description of the Mark II system ......................................................................... 11
1.4.1 Template ......................................................................................................... 11
1.4.2 Cell-free extract .............................................................................................. 12
1.4.3 Reaction mix................................................................................................... 12
1.4.4 TnT reaction.................................................................................................... 12
1.5 Current yield example............................................................................................ 13
2. Preparation of S30 extract............................................................................................ 14
2.1 Day 1 (clonal isolation).......................................................................................... 15
2.2 Day 2 (starting seed culture).................................................................................. 16
2.3 Day 3 (culture growth & harvest).......................................................................... 16
2.4 Day 4 (cell-free extract creation)........................................................................... 17
2.4.1 Lyse the cells and remove debris.................................................................... 17
2.4.2 Perform the run-off reaction ........................................................................... 18
2.4.3 Dialyze the lysate............................................................................................ 18
2.4.4 Aliquot and store the cell-free extract............................................................. 18
2.5 Lysate yield example ............................................................................................. 19
3. Preparation of the reaction mix.................................................................................... 20
4. Recipes and materials .................................................................................................. 22
4.1 Media and Buffers.................................................................................................. 22
4.1.1 2xYT-PG............................................................................................................. 22
4.1.2 S30 buffer............................................................................................................ 23
4.2 Reaction mix components...................................................................................... 25
4.2.1 PEP.................................................................................................................. 26
4.2.2 NAD................................................................................................................ 27
4.2.3 CoA................................................................................................................. 28
4.2.4 Putrescine........................................................................................................ 29
3. 3
4.2.5 Spermidine...................................................................................................... 30
4.2.6 Oxalic acid ...................................................................................................... 31
4.2.7 Mg(glu)2.......................................................................................................... 32
4.2.8 NH4(glu).......................................................................................................... 33
4.2.9 K(glu).............................................................................................................. 34
4.2.10 Folinic acid.................................................................................................... 35
4.2.11 tRNAs ........................................................................................................... 36
4.2.12 Rifampicin..................................................................................................... 37
4.2.12 ATP............................................................................................................... 38
4.2.13 CTP ............................................................................................................... 39
4.2.14 GTP............................................................................................................... 40
4.2.15 UTP............................................................................................................... 41
4.2.16 AA Mix......................................................................................................... 42
5. References.................................................................................................................... 44
Appendix A – Sample instruction sheet for the end user.................................................. 46
Appendix B – 5’ and 3’ sequences ................................................................................... 47
Appendix C – Reaction mix cost ...................................................................................... 48
Hellinga Research Group
Department of Biochemistry
Duke University Medical Center
Nanaline Building, Room 415
Research Drive, DUMC 3711
Durham, NC, 27710, USA
Author’s e-mail: colin@biochem.duke.edu
Investigator’s e-mail: hwh@biochem.duke.edu
Written by J. Colin Cox, Ph.D.
This work is hereby released into the Public Domain. To view a copy of the public domain dedication, visit
http://creativecommons.org/licenses/publicdomain/ or send a letter to Creative Commons, 171 Second Street, Suite 300,
San Francisco, California, 94105, USA.
4. 4
Introduction
This guide in intended to serve as a full, portable protocol to enable a molecular
biology laboratory to routinely create robust in vitro coupled transcription and translation
reactions (often abbreviated as TnT reactions).
1. The Mark II System; this section details the contributions to the field from the Swartz
lab at Stanford University, explains changes we have implemented to their
system, and provides an overall description of the Mark II in vitro protein
expression system.
2. Preparation of the S30 extract; this chapter provides a protocol for growth, lysis,
preparation, and storage of the cell-free extract.
3. Preparation of the reaction mix; a simple recipe is presented to create the reaction mix
component of the in vitro expression system.
4. Recipes and materials; this detailed section fully lists all chemicals and reagents
needed to replicate the Mark II System. Detailed instructions for solublizing
certain reagents are provided to ensure the correct composition of the reaction
mix.
5. References
5. 5
1. Mark II system
The in vitro protein expression system described here is principally derived from
the work of the James Swartz lab at Stanford University. They have developed systems
they label PANOx [1, 2] PANOxSP [3, 4], and Cytomim [4]. “Mark II” refers to this
system as the second incarnation and enhancement of an in vitro coupled transcription
and translation (TnT) expression system developed within the Hellinga lab.
1.1 Description of a basic TnT reaction
Several biological components are required to synthesize protein from a DNA
template. The soluble portion of the cytoplasm is crudely purified and contains the
necessary proteins to carry out translation. Additionally, raw materials, energy sources,
stabilizers, inhibitors and energy regeneration molecules are added.
1.1.1 Cellular machinery
In prokaryotic cells, the events of transcription and translation (TnT) are coupled,
with translation starting before the RNA polymerase finishes transcribing the message
RNA. Thus, a crude purification of bacterial cell lysate contains the necessary cellular
machinery for mRNA transcription and protein translation. Extract contains the
machinery required for translation, including ribosomes, ribosome initiation factors,
ribosome elongation factors, ribosome termination factors, etc. Small molecules, raw
materials and cofactors are added in addition to the DNA template to produce protein
from a cell-free extract. A TnT reaction will produce protein for a limited amount of
time, usually until either one of the amino acids or the energy supply is depleted and/or
degraded.
One mechanism of energy and reagent depletion is through unregulated,
endogenous cellular phosphatases that nonspecifically dephosphorylate ribonucleotide
triphosphates in the reaction mix. This drastically cuts the effective energy supply,
limiting protein production [5]. Scientific literature can provide some solutions to this
issue, but at the cost of greatly increasing the complication of lysate production.
However, one research group demonstrated that exogenous inorganic phosphate and
glucose in the medium downregulates expression of some E. coli phosphatases [6]. This
elegant and simple step more than doubles effective expression time with a ~ 35%
increase in expressed protein.
1.1.2 Raw materials
The so-called ‘building blocks’ of RNA and protein are of course required. The
canonical four ribonucleotides are supplied for mRNA transcription, and the twenty
6. 6
canonical amino acids are supplied for protein translation. In addition, total E. coli tRNAs
are included.
1.1.3 Energy and energy regeneration compounds
ATP (and to some extent, GTP) is the primary source of energy for a majority of
processes involved in transcription and translation. However, energy in this form is
quickly depleted, and a supplementary energy regeneration system is required. Many
energy regeneration systems have been described in the literature, and often utilize
phosphoenolpyruvate, creatine phosphate, or acetyl phosphate. (See [7] for a review of
energy regeneration systems.) Additionally, these systems may require the addition of
cofactors such as coenzyme A, nictotinamide–adenine dinucleotide (NAD), and folinic
acid.
1.1.4 Inhibitory compounds
Many of the endogenous enzymes in a cell-free extract may have undesirable
activity. A variety of inhibitory compounds may be added to the TnT reaction for
mitigation. These may include nuclease inhibitors, proteases inhibitors, and E. coli
polymerase inhibitors. Additionally, inhibitors of enzymes that break down specific
amino acids may be included. Specific enzymes within the TCA cycle or glycolytic
pathway may be targeted as well.
1.1.5 Stabilizing compounds
Conversely, some compounds are added to TnT reactions in order to stabilize the
nucleic acid or protein products, or to enhance levels of expression. Message transcripts
may be stabilized with polyamines or other polymers. Protein stabilization is sometimes
achieved by the addition of molecular crowding agents, such as poly-ethylene glycol.
1.1.6 DNA template
Finally, a DNA template is supplied for transcription and subsequent translation.
It is advantageous to supply a DNA template and perform transcription rather than just
supplying a purified mRNA template. The activity of endogenous ribonucleases in the
extract is high, and a mRNA template generally lasts on the order of seconds-to-minutes.
By constantly regenerating mRNA from a DNA template, a large amount of protein may
be produced. Additionally, the mRNA may have a stem-loop structure to enhance
message stability.
7. 7
1.2 Analysis of the Swartz lab’s findings
The systems derived and conceived by the Swartz lab work well and are robust;
however, their body of literature may be confusing to novices of in vitro protein
expression. Below, “the authors” refer to Swartz lab publications.
1.2.1 Pyruvate (and NAD, CoA, and oxalate)
The authors initially reported that pyruvate can be employed as a secondary
energy source (with the purinic nucleotides as the primary source)[2]. The theory is that
pyruvate is metabolized into acetyl phosphate, driving endogenous ATP regeneration[2,
3]. In their conventional system which led to PANOx and Cytomim, it is reported that
using pyruvate combined with NAD roughly triples protein production, while pyruvate
with NAD and CoA roughly quadruples protein production[2]. However, in studying a
time course with the newer Cytomim system, the authors discovered that pyruvate is
depleted after 30 minutes (or 1/6th
of the active production time)[3]. “The brief presence
of pyruvate relative to the duration of protein synthesis is very curious and indicates that
there is most likely another energy source for ATP regeneration. Furthermore, it implies
that pyruvate may not be necessary for protein synthesis in the Cytomim system”[3].
Pyruvate subsequently is omitted from the ingredients of Cytomim (for example, refer to
[7]).
It was stated that NAD and CoA are added to the reaction to yield additional
energy from pyruvate which is produced by pyruvate kinase from PEP[8]. This begs the
question of the need to continue adding NAD and CoA to the reaction mix. In the same
publication, the authors investigated this, finding that removal of CoA had no effect,
while removal of NAD decreased apparent production by ~15%[3]. CoA continues to be
included as an ingredient of the reaction mix (for example, refer to [7]).
Finally, like NAD and CoA, it seems that oxalic acid was initially added to aid the
pyruvate-based energy subsystem. The authors employ the use of oxalic acid to inhibit
PEP-synthetase, which could waste energy by converting pyruvate into PEP[4, 9]. A
publication containing an investigation into the necessity of oxalic acid in the newer
systems is not found; however, they continue to use it in the reaction mix (for example,
refer to [7]). It is then difficult to deductively assign defined, specific biochemical
functions to oxalic acid, NAD, and CoA in this system in this light. Regardless, we
continue to add them to the reaction mix, following the Swartz lab’s protocol.
1.2.2 Contrasting PANOxSP with Cytomim
The finding that pyruvate is depleted from the Cytomim system practically
obviates the distinction between the PANOxSP and Cytomim systems. The major
difference had been that PANOx utilized a PEP energy subsystem while cytomim utilized
8. 8
the more cost-effective pyruvate for its energy regeneration. According to a recent
review article[7], there is (now) very little difference in the makeup of the reaction mixes.
The values of salts presented in this document’s recipes are closer to Cytomim for
magnesium (10 mM) and is the PANOxSP value for potassium (175 mM). These values
were provided via direct communication with the Swartz lab as to their current protocols.
1.2.3 Oxygen
The authors state that the Cytomim
system requires oxygen (for oxidative
phosphorylation) while the PANOx(SP)
system utilizing PEP does not[10, 11]. This
statement is in contradiction to our
empirical results when employing their
reaction mix recipe including PEP.
However, it is possible this is due to
differences in cell strains, or other such
phenomenon. Regardless, the expression
system in our hands benefits from
atmospheric oxygen during incubation. We
incubate our reaction in vesicles covered
with an air-permeable membrane. Shown is a test of GFP template after maturation in
tubes either capped or uncapped during expression.
1.2.4 Buffering
In their transition from PANOx to PANOxSP, the authors removed “unnatural”
compounds, including pH buffers[4]. However, it is incorrect to view the system as
being unbuffered because glutamate is used as the counter-ion in many of the salts. The
high concentration of the glutamate salts, in addition to the remaining reaction mix
components, serves as the biological buffer of the system. Failure to pH adjust the
reaction mix ingredients produces nonfunctional reaction mix.
PANOxSP Cytomim
[Mg++
] (mM) 20 8
[K+
] (mM) 175 130
[PEP] (mM) 33 none
9. 9
1.3 Changes from the Swartz lab system
We have altered our protocols from the Swartz lab in the following ways:
1.3.1 Fermentation
The Swartz lab makes extensive use of fermentation procedures that they have
optimized for generating cell-free lysate[12, 13]. In lieu of having access to a highly
configurable fermenter, we attempted to assess whether growing lysate in shaking
cultures is feasible. Although cell mass is lower per volume of culture, the quality of
lysate produced in shaking cultures is fine for TnT reactions.
1.3.2 Reaction mix components pre-mixing
In order to provide a system that is easily distributed within a lab, it is
advantageous to reduce the total amount of reagent tubes an end-user is required to
handle. Additionally, this alleviates much burden of inventory tracking. The Swartz
system is made of eleven reagent tubes[7]; we have reduced this to two. The T7 RNAP
tube is obviated by the cell strain (see below), while all the other reaction mix
components are simply mixed together and stored at -80°C. Details on creating the
reaction mixture follow.
1.3.3 BL21 Star cell strain
We work with Invitrogen’s BL21 Star (DE3) cell strain (P/N C6010-03). BL21
Star contains a deletion in the rne131 gene, coding for RNase E. The deletion in this
gene contains the N-terminal domain for ribosomal RNA processing but lacks the C-
terminal domain[14, 15]. Removal of this domain increases the stability of the mRNA
and improves protein production in cell-free extracts[16, 17]. This strain also contains a
DE3 lysogen that harbors T7 RNA polymerase under control of a lac promoter.
The full genotype is: F-
ompT hsdSB(rB
-
mB
-
) gal dcm rne131 (DE3)
1.3.4 Template terminal blockage
The Swartz lab uses supercoiled plasmid DNA templates, whereas we typically
transcribe from linear DNA templates produced by automated gene assembly[18]. Linear
templates are susceptible to endogenous exonuclease activity. We surmised that
chemically altering the ends of the DNA may physically block access to exonucleases.
We block the 5’ ends with biotin by biotinylating the two terminal primers during gene
10. 10
synthesis or downstream PCR
amplification. This has a profound
effect on protein expression
(illustrated in the above figure).
1.3.5 Additional reaction
mix compounds
We were curious to
determine if additional reaction
mix compounds could have an enhancing effect on the yield of protein production. We
identified several compounds that had no effect, damaged, or killed the reactions entirely:
calcium phosphate, Roche Complete Mini EDTA-free protease inhibitor cocktail, E. coli
poly(A) polymerase, A. niger catalase, E. coli Mn-superoxide dismutase, sheared salmon
sperm DNA, polyvinylpyrollidone-40, and Ambion SUPERase•In RNase inhibitor.
We identified two
compounds which substantially
increased protein protein:
rifampicin and S. cervasie
pyrophosphatase. Rifampicin
is an antibiotic compound
whose mode of action is to
block transcription initiation by
binding to the active site of E.
coli RNA polymerase[19, 20].
Rifampicin is often included in
in vitro coupled transcription
and translation reactions[21,
22] to avoid the reagent and energy expenditure of the lysate and reaction mix to produce
E. coli proteins from endogenous, preexisting mRNA. The antibiotic is often included in
commercial E. coli lysate kits.
Pyrophosphate is
known to inhibit many key
cellular process events,
including both
transcription[23, 24] and
translation[25, 26]. We have
found that exogenously
adding pyrophosphate
inhibits protein expression at
an initial concentration of ~ 1
µM. A reaction at 10 mM
pyrophosphate completely
-1000.00
1000.00
3000.00
5000.00
7000.00
9000.00
11000.00
13000.00
0 500 1000 1500 2000 2500
Seconds
RFU
Esterase, 'plain'
Esterase, biotinylated
No template
0
10000
20000
30000
40000
50000
60000
70000
80000
90000
0 200 400 600 800 1000 1200 1400
Time (s)
RFU
Lysate only
pNB
biotinylated pNB
biotinylated pNB + 100 ug/ml RIF
biotinylated pNB + 20 ug/ml RIF
biotinylated pNB + 4 ug/ml RIF
biotinylated pNB + 0.8 ug/ml RIF
0
10000
20000
30000
40000
50000
60000
70000
80000
90000
0 200 400 600 800 1000 1200 1400
Time (s)
RFU
Lysate only
pNB
biotinylated pNB
biotinylated pNB + 2 U PPi-ase
biotinylated pNB + 1 U PPi-ase
biotinylated pNB + 0.5 U PPi-ase
biotinylated pNB + 0.25 U PPi-ase
11. 11
inhibits all protein expression. This prompted us to explore the enzymatic conversion of
toxic pyrophosphate into less toxic phosphate. We first used E. coli pyrophosphatase.
Surprisingly, addition of 20 U, 4 U, 0.8 U, or 1.6 U / 50 µl reaction volume completely
inhibited protein production. We also assayed the pyrophosphatase from S. cervasie
because it is commercially cheaper and more stable than its prokaryotic counterpart. We
observed increases in protein expression at concentrations between 0.25 – 4 U / 50 µl
reaction; 0.5 U / 50 µl was later verified as the optimal concentration (see above figure).
We tested whether inclusion of both yeast pyrophosphatase and rifampicin in our
reactions is additive.
Unfortunately, the
combination of the two
items produced marginally
more protein than that of
rifampicin alone,
suggesting that another
agent becomes limiting.
For the current
implementation of the
Mark II system, we have
chosen to supplement the
reaction mix with only
rifampicin because it is less
expensive.
1.4 Description of the Mark II system
The Mark II system is a simple, robust, cost-effective in vitro coupled
transcription and translation reaction mixture for protein expression. The constituents of
the assembled expression reactions can be categorized in terms of DNA template, cell-
free extract, and the reaction mix. Instructions for end-users of the reactions are provided
in Appendix A.
1.4.1 Template
A DNA template is supplied for transcription and subsequent translation. It is
advantageous to supply a DNA template and perform transcription rather than just
supplying a purified mRNA template. The activity of endogenous ribonucleases in the
extract is high, and a mRNA template generally lasts on the order of seconds-to-minutes.
By constantly regenerating mRNA from a DNA template, a large amount of protein may
be produced. Additionally, the mRNA may have a stem-loop structure to enhance
message stability. The template and its synthesis have been previously described. In
addition to a gene, the synthetic construct contains a T7 RNA polymerase promoter [27,
0
5000
10000
15000
20000
25000
30000
0 500 1000 1500 2000 2500
Time (s)
RFUs
No template
Roche, pNB template
Mark II, bio-pNB
Mark II, bio pNB, 4ug/ml RIF
Mark II, bio pNB, 0.5 U PPi-ase
Mark II, bio-pNB, 4ug/ml RIF & 0.5U PPi-ase
12. 12
28], a Shine-Dalgarno ribosome binding site [29, 30], an optimized open reading frame,
and a T7 terminator stem-loop structure [31]. (Refer to Appendix B for sequences.)
1.4.2 Cell-free extract
The cell-free extract is essentially a crude purification of the total soluble,
membrane-free cellular material. The extract contains the machinery required for
translation, including ribosomes, ribosome initiation factors (IF1, IF2, IF3), ribosome
elongation factors (EF-Tu, EF-Ts, EF-G), ribosome termination factors (RF1, RF2, RF3,
RRF), met-tRNAf-formylation enzymes, tRNA synthetases, energy processing enzymes,
etc. When inducing the BL21 Star cell strain during growth, the cell-free extract contains
T7 RNA polymerase as well.
Unregulated, endogenous cellular phosphatases nonspecifically dephosphorylate
the ribonucleotide triphosphates in the reaction mix. This drastically cuts the effective
energy supply, limiting protein production[5]. The literature provides a few solutions
that greatly complicate lysate production. However, one lab demonstrated that
exogenous inorganic phosphate and glucose in the medium downregulates expression of
some E. coli phosphatases[6]. This elegant and simple step more than doubles effective
expression time with a ~ 35% increase in expressed protein.
1.4.3 Reaction mix
The reaction mix contains the small molecules, energy compounds, raw materials,
and co-factors required to fuel transcription and translation in the cell-free extract. In the
Mark II system, the reaction mix is comprised of magnesium glutamate, ammonium
glutamate, potassium glutamate, the canonical ribonucleotide triphosphates, folinic acid,
E. coli total tRNAs (the canonical sixty-four), the canonical amino acids,
phosphoenolpyruvate, nicotinamide adenine dinucleotide, coenzyme A, oxalic acid,
putrescine, spermidine, and rifampicin.
1.4.4 TnT reaction
The reaction is created by adding equal volumes of cell-free extraction and
reaction mix, along with two volumes of (water + template). This setup makes it simple
for an end-user to set up reactions. Additionally, 50% of the reaction volume is saved for
(water + template), which helps to facilitate the expression of protein from more dilute
DNA samples without concentration; this also provides a large amount of space for
additional components, such as disulfide bond-forming enzymes.
13. 13
1.5 Current yield example
In the current configuration, we are able to produce ~ 2-5 µg / 50 µl TnT reaction.
An example is provided below for p-nitro benzyl esterase from a linear DNA template
(expect roughly ~10x more from a circular plasmid template). Enough product is made
to easily visualize on a Comassie-stained gel.
para -nitro benzyl esterase (p NB) activity
0.000
0.500
1.000
1.500
2.000
2.500
3.000
3.500
4.000
Roche, No template Roche, pNB Mark II, No template Mark II, pNB Mark II, bio-pNB Mark II, bio-pNB +
RIF + PPi-ase
Relativeactivity
0.0 0.57 0.0 0.39 1.60 2.44
µg of protein per 50
µl TnT reaction
6
15
20
28
43
57
104
194
Roche
No template
Roche
pNB
Mark II
No template
Mark II
pNB
Mark II
bio-pNB
+RIF +PPi-ase
54kD
pNB
5µl crude reaction on 4-12% gradient Bis-Tris
14. 14
2. Preparation of S30 extract
The procedure to produce cell-free extract has been highly streamlined by the
Swartz lab[32] and removes superfluous steps found in older extract preparation papers.
Extract preparation requires four days. The first two days require a negligible amount of
time, the third day requires roughly half a day’s time of work, and the last day requires
the majority of the day to complete the extract.
The expression system presented here utilizes the BL21 Star (DE3) cell strain.
The BL21 Star strain contains a deletion in the rne131 gene, coding for RNase E. This
specific deletion contains the N-terminal domain for obligate ribosomal RNA processing
but lacks the C-terminal domain [14, 15]. Removal of this domain increases the stability
of the mRNA and improves protein production in cell-free extracts [16, 17]. This strain
also contains a DE3 lysogen that harbors T7 RNA polymerase under control of a lac
promoter.
To begin the process of lysate creation, BL21 Star (DE3) competent cells
(Invitrogen, C6010-03) are plated on a LB agar plate in order to yield distinct colonies.
The plate is incubated overnight at 37°C. The next day, a sterile, baffled 250 ml flask is
filled with 75 ml of 2xYT-PG medium (16 g / l tryptone (Sigma Aldrich, T7293), 10 g / l
yeast extract (Sigma Aldrich, 70161), 5 g / l NaCl (Sigma Aldrich, 71376), 22 mM
NaH2PO4 (Sigma Aldrich, S5011), 40 mM Na2HPO4 (Sigma Aldrich, S5136), and 100
mM glucose (Sigma Aldrich, G7021)). One colony of BL21 Star (DE3) is used to
inoculate the medium and the flask is incubated on a shaking platform overnight at 37°C.
The overnight seed culture is used to inoculate large, baffled flasks for growth.
During logarithmic growth phase, the cell strain is mildly induced to express T7 RNA
polymerase. Prior to an initial fermentation, an optical density-based growth curve is
performed to determine times of lagging and logarithmic growth, as these can greatly
vary between medium ingredient lots, different flask sizes, different incubators, etc.
Thus, baffled culture flasks containing 2xYT-PG medium are inoculated with 1/100th
volume of overnight culture. The flasks are incubated on a shaking platform at 37°C (at
115 rpm for six liter baffled flasks) according to the preestablished growth curve; cultures
are grown to approximately 30% of completion of logarithmic growth (~ 2.5 hours for
1.5 liter medium in a six liter baffled flask) and T7 RNA polymerase expression is
induced with the addition of 0.25 M IPTG.
Cultures are permitted to grow and continue expression until reaching
approximately 75% of completion of logarithmic growth (an additional ~ 1.75 hours at
the above conditions) and then immediately chilled on ice for 15 minutes. The cells are
then harvested by centrifugation in a pre-chilled rotor at 4°C for 20 min at 5,000 g. Next,
the cell pellets are washed by decanting the exhausted medium supernatant and
resuspending them in 1/20th
original medium volume of S30 buffer (10 mM Tris-acetate,
(pH 8.2; Sigma Aldrich, T1258), 14 mM magnesium acetate tetrahydrate (Sigma Aldrich,
M5661), 60 mM potassium acetate (Sigma Aldrich, P1190), and 2 mM dithiotheitol
(Sigma Aldrich, D9779)). The pellets can be resuspended through vigorous agitation
15. 15
with a microcentrifuge tube vortexer, or a cordless drill with a plastic spatula attached as
the bit (VWR, 53800-005). Two empty 250 ml conical centrifuge tubes are weighed and
the mass is recorded. The resuspended cell slurry is divided among the tubes and pelleted
at 4°C for 10 min at 5,000 g. The tubes are then carefully decanted and weighed again to
determine the wet cell paste mass. Finally, the pellets are flash frozen in liquid nitrogen
and stored overnight at -80°C.
Next, the frozen cell pellets are thawed on ice for approximately one hour. S30
buffer is added at a volume of 1 ml per g of wet cell paste, and the pellets are
resuspended by vortexing. DTT is added to the approximate volume of cell slurry to a
concentration of 5 mM. The cells are then ruptured by application of a French press at
17,000 psi one or two times. The soluble fraction is enriched by centrifugation at 4°C,
30,000 g, for 30 min. The soluble portion is then clarified again by a second
centrifugation application at 4°C, 30,000 g, for 30 min in a new centrifuge tube.
A simplified run-off reaction [32] is performed to facilitate release of E. coli
mRNA from the ribosomes; the run-off reaction does not require any reagents. The
centrifuged supernatant is carefully aspirated and placed into centrifuge tubes (e.g., 15 ml
or 50 ml conical tubes) and is incubated at 37°C for 80 min, rotating end-over-end on a
Mini LabRoller (Labnet International, H5500) in the dark (alternatively, the tubes are
covered with foil). Next, the lysate is dialyzed in order to control the pH and salt
concentration, and then clarified to remove any precipitated proteins.
During the run-off reaction, dialysis tubing (6 – 8 kDa MWCO; Spectra/Por, 132-
650) is prepared by equilibration in Heavy Metals Cleaning Solution (Spectra/Por, 132-
908) for approximately one-half hour. The tubing is then copiously washed with ultra-
pure water. The run-off reaction is loaded into the tubing and then dialyzed into
approximately 80 volumes of pre-chilled S30 buffer at 4°C for one-hour. After dialysis,
the lysate is centrifuged at 4°C, 4,000 g, for 10 min to remove precipitated products.
Finally, the cell-free extract is aliquoted into microcentrifuge tubes, flash-frozen in liquid
nitrogen, and stored at -80°C. The lysate is stable without reduction in expression for at
least two months.
2.1 Day 1 (clonal isolation)
BL21 Star does not possess an antibiotic resistance gene; care must be taken not
to contaminate the cell strain throughout the growth process.
1) Prepare LB-agar plates without antibiotic.
2) Using proper microbial technique, streak BL21 Star from a competent cell tube on
the plate in order to isolate single colonies.
3) Incubate the plate overnight at 37°C.
16. 16
2.2 Day 2 (starting seed culture)
A small liquid culture is grown overnight to seed the lysate culture the next day. It is
recommended on this day to make and sterilize the growth medium and flasks for use the
next day.
1) Make or aliquot 100 ml of 2xYT-PG
2) Place into a 250 ml baffled flask and sterilize
3) Inoculate the culture with a single colony of BL21 Star
4) Grow the culture overnight at 37°C with shaking (~ 250 rpm)
2.3 Day 3 (culture growth & harvest)
The overnight seed culture is used to inoculate large, baffled flasks for growth.
During logarithmic growth phase, the cell strain is slightly induced to express T7 RNA
polymerase. The cells are harvested, washed, and flash-frozen. It is recommended to
construct a growth curve prior to a production run to determine precise timing, which
may vary between individuals, medium ingredient lots, different flask size, different
incubators, etc.
1) Inoculate baffled cultures flasks at 1:100 ratio. For example, inoculate 1.5 liters
of 2xYT-PG in a 6 l baffled flask with 15 ml of overnight seed culture.
2) Incubate the flasks at 37°C with shaking (rpm dependant on the flask size; for
instance, 115 rpm in a 6 liter flask).
3) When the cultures reach an OD indicating 30% completion of logarithmic growth,
induce the cultures with 0.25 mM IPTG. It is not recommended to increase this
concentration. (Typically 2.5 hours in a 6 l baffled flask)
4) Allow induction to continue until growth reaches 50-70% of logarithmic growth
(approximately 1.75 hours).
5) Immediately place the flasks on ice.
6) Harvest the cells by centrifugation. Spin in a pre-chilled rotor for 20 min., 5,000
g, 4°C.
7) Begin washing the cell pellet by decanting the supernatant followed by the
addition of ~ 1/20 volume of 1x S30 buffer (e.g., for 500 ml culture, add 25 ml of
1x S30 buffer).
8) Resuspend the pellet to wash the cells. With pellet sizes this large, it is often
difficult to simply resuspend by vortexing. We use a cordless drill with a plastic
spatula attached to the bit (for instance, VWR P/N 53800-005).
17. 17
9) Weigh two empty 250 ml conical centrifuge tubes. Record the empty weight.
10) Combine the resuspended cells into the two tubes, balance.
11) Spin in a pre-chilled rotor for 10 min., 5,000 g, 4°C.
12) Decant the supernatant carefully, weigh the bottles again to determine the wet cell
paste mass.
13) Flash-freeze the pellet by dipping the bottles in liquid nitrogen, store overnight at
-80°C.
2.4 Day 4 (cell-free extract creation)
The frozen cell paste is now ready to be lysed and centrifuged to separate soluble
from nonsoluble cellular material. A simplied run-off reaction[32] is performed to
facilitate release of E. coli mRNA from the ribosomes, making the mRNA available to
endogenous RNases. Next, the lysate is dialyzed in order to control the pH and salt
concentration, and then clarified to remove any precipitated proteins. Finally, the cell-
free extract is aliquoted and stored for use.
2.4.1 Lyse the cells and remove debris
1) Add 1 ml of fresh 1x S30 buffer per gram of frozen cell paste. Thaw on ice
(generally 30-60 minutes).
2) Suspend the cells carefully, using a combination of the drill-mixer and vortexing.
This is a crucial step; any small clumps of cells will clog the small channel in the
French-press cell diminishing proper cell lysis.
3) Estimate the volume of the resuspended cells and add DTT from a freshly
prepared 1 M stock to a final concentratin of 5 mM to protect the lysate against
oxidation.
4) Using a French press, lyze the cells in an ice-cold cell. Incorrect use of the
French press can cause damage to the cell, the press, or to your body.
(Ensure that you are correctly trained to use both the machine and the press cell
you will employ.) Prior to use, the press cell should be rinsed with RNase-free
deionized water.
5) Run the cell solution through once at 17,000 PSI. Capture lysate in a RNase-free
vesicle kept on ice.
6) Reload the lysate and run through the press a second time at 17,000 PSI.
7) Separate the soluble fraction by centrifugation in a pre-chilled rotor, 30 min.,
30,000 g, 4°C.
8) Immediately transfer the supernatant to a fresh centrifuge tube. Slowly pipet from
the top down, to minimize the amount of insoluble material you carry over to the
new tubes.
18. 18
9) Spin again, 30 min., 30,000 g, 4°C.
2.4.2 Perform the run-off reaction
1) Cover two conical tubes (e.g., 15 ml RNase-free Falcon tubes) with aluminum foil
(or use amber Falcon tubes).
2) Carefully transfer the supernatant, top down, from the centrifuge tubes to the
conical tubes.
3) Incubate the lysate on a rotary or flipping shaker, 37°C, 120-280 rpm, 80 min
2.4.3 Dialyze the lysate
1) First, prepare a >40X volume of cold 1X S30 buffer. (Generally, a 80X volume is
employed.)
2) Cut an appropriate length of 6-8 kDa dialysis tubing (for instance, Spectra/Por
P/N 132-650).
3) Soak the tubing for ~30 minutes in 100 mM sodium bicarbonate, 10 mM EDTA
in order to chelate the trace amounts of heavy metals that may be present on the
dialysis tubing. (Note: this step may be unnecessary, see manufacturer’s
instructions)
4) Wash the dialysis tubing well, at least three times, with deionized water.
5) Load the tubing with the run-off reaction, and dialyze against >40 volumes of 1x
S30 buffer, 4°C, 1 hour.
6) A small amount of protein will precipitate during dialysis; clarify by
centrifugation for 10 min., 4,000 g, 4°C
2.4.4 Aliquot and store the cell-free extract
1) While the dialysis is processing, prepare an area to aliquot the cell-free extract.
Fill a large tray or bucket with ice, and set eppendorf tube holders into the ice to
cool.
2) Set up a number of DNase-, RNase-free eppendorf tubes into the holders.
Approximate the rough volume and divide by the amount you will aliquot.
3) Place the freezer box that will house the aliquoted tubes and place on dry ice.
4) Fill an insulated dewer with liquid nitrogen.
5) Use a repeater pipette to aliquot the cell-free extract into the eppendorf tubes
(suggested: 260 µl, which will facilitate 1 ml of reaction).
6) Cap the tubes and toss into the liquid nitrogen to flash-freeze the extract.
7) Remove the tubes (with, for instance, a plastic slotted kitchen spoon) and place
into the freezer box.
19. 19
8) Label the freezer box with initials, date, and extract batch number. Store at -
80°C. No discernable decrease in quality is seen after three months of storage.
2.5 Lysate yield example
• In the current configuration, six liters of culture, grown in 1.5 l batches in six l
baffled flasks, produces ~ 45 g of wet cell paste when cultured correctly.
• 45 g of wet cell waste is processed into ~ 45 ml of cell-free extract.
• 45 ml of cell-free extract accomplishes 180 ml of TnT reactions.
• Thus, 1 g of wet cell paste provides 1 ml of extract yielding 4 ml of TnT reaction.
• This equates to 1 ml of cell culture producing 30 µl of TnT reaction.
20. 20
3. Preparation of the reaction mix
It is suggested to create a large batch of reaction mix, to minimize potential lot-to-
lot variability and also to reduce the overall time per year spent on keeping the stocks up.
We find a nice volume is 250 ml of reaction mix, enough to fuel 1 l of TnT reactions.
(Refer to Appendix C for costs).
The 4X reaction mix contains the small molecules, energy compounds, raw
materials, and co-factors required to fuel transcription and translation in the cell-free
extract. It is comprised of magnesium glutamate, ammonium glutamate, potassium
glutamate, the canonical ribonucleotide triphosphates, folinic acid, E. coli total tRNAs,
the canonical amino acids, phosphoenolpyruvate, nicotinamide adenine dinucleotide,
coenzyme A, oxalic acid, putrescine, spermidine, and rifampicin.
*Tyrosine is handled separately because it is difficult to solublize at high concentrations.
1) Prepare the individual components of the reaction mix as indicated in Section 4.2.
2) Take a clean beaker, and rinse several times with pure water.
3) First, add the amino acid mixture aliquot to the beaker.
4) Add 371 mg of tyrosine to the beaker.
5) Next, add the pure water to the beaker.
6) Add the three glutamate salts. Now, mix well.
7) Add the folinic acid, tRNAs, PEP, NAD, coenzyme A, oxalic acid, putrescine,
spermidine, and rifampicin. Again, mix well.
Solution Stock Amount to add 4x conc. 1x conc.
19 amino acids 50 mM 40 ml 8 mM 2 mM
Tyrosine n/a 371 mg 8 mM 2 mM
Water n/a 37.3 ml n/a n/a
Mg++
glutamate 1 M 10 ml 40 mM 10 mM
NH4
+
glutamate 1.5 M 6.7 ml 40 mM 10 mM
K+
glutamate 3.5 M 50 ml 700 mM 175 mM
Folinate 10.8 mg / ml 3.14 ml 136 µg / ml 34 µg / ml
tRNAs 34 mg / ml 5 ml 682 µg / ml 171 µg / ml
PEP 1 M 33.3 ml 120 mM 30 mM
NAD 50 mM 6.67 ml 1.33 mM 0.33 mM
CoA 40 mM 6.67 ml 1.08 mM 0.27 mM
Oxalate 1 M 2.7 ml 10.8 mM 2.7 mM
Putrescine 100 mM 10 ml 4 mM 1 mM
Spermadine 100 mM 15 ml 6 mM 1.5 mM
Rifampicin 1 mg/ml 15 ml 40 µg / ml 10 µg / ml
rATP 500 mM 2.5 ml 5 mM 1.25 mM
rCTP 500 mM 2 ml 4 mM 1 mM
rGTP 500 mM 2 ml 4 mM 1 mM
rUTP 500 mM 2 ml 4 mM 1 mM
21. 21
8) Add the four ribonucleotide triphosphates. Mix.
9) Set up an area with eppendorf tube holders, and load with DNase-, RNase-free 0.5
ml eppendorf tubes.
10) Use a repeater pipette to aliquot the cell-free extract into the eppendorf tubes
(suggested: 260 µl, which will facilitate 1 ml of reaction). Important: Keep the
beaker constantly mixing on a magnetic stir plate to ensure the even distribution
of tyrosine flakes throughout the reaction mix as you aspirate.
11) Cap the tubes (carefully to avoid the introduction of RNase), and place in a
freezer box.
12) Label the freezer box with initials, date, and extract batch number. Store at
-80°C. No discernable decrease in quality is seen after six months of storage.
22. 22
4. Recipes and materials
The Mark II system employs 1 growth medium, 1 buffer, and 35 reaction mix
components (20 of which are the canonical amino acids). The cost of reagents shown in
this section was valid as of Spring 2008.
4.1 Media and Buffers
As discussed, 2xYT-PG is employed as the growth medium to inhibit the
expression of certain phosphatases. S30 buffer is used to suspend, wash, and equilibrate
the lysate.
4.1.1 2xYT-PG
2xYT-PG (Twice amount yeast and tryptone with phosphate and glucose) is
comprised of the following concentrations of reagents: 16 g tryptone / liter, 10 g yeast
extract / liter, 5 g NaCl / liter, 22 mM NaH2PO4, 40 mM Na2HPO4, and 100 mM glucose.
Item MW Vendor P/N Cost
Tryptone n/a Sigma T7293 $156.50 / kg
Yeast extract n/a Sigma (Fluka) 70161 $58 / 500 g
Sodium phosphate
dibasic
141.96 Sigma S5136 $76.30 / kg
Sodium phosphate
monobasic
119.98 Sigma S5011 $82.20 / kg
Glucose 180.16 Sigma G7021 $25.60 / kg
To make 1 liter of 2xYT-PG:
1) Fill a cylinder with ~ 500 ml pure water.
2) Dissolve 16 g tryptone
3) Dissolve 10 g yeast extract
4) Dissolve 5 g salt
5) Bring volume up to 825 ml
6) Autoclave
7) Allow the medium to cool
8) With aseptic technique, add 44 ml 0.5 M NaH2PO4
9) With aseptic technique, add 80 ml 0.5 M Na2HPO4
10) With aseptic technique, add 50 ml 2 M glucose
23. 23
To make 1 liter of 0.5 M NaH2PO4:
Measure 60.0 g sodium phosphate monobasic; suspend in water up to 1000 ml. Filter
sterilize.
To make 1 liter of 0.5 M Na2HPO4:
Measure 71.0 g sodium phosphate dibasic; suspend in water up to 1000 ml. Filter
sterilize.
To make 1 liter of 2.0 M glucose:
Measure 360.3 g glucose; suspend in water up to 1000 ml. Filter sterilize.
4.1.2 S30 buffer
1x S30 buffer is comprised of the following reagents: 10 mM Tris-acetate, (pH
8.2), 14 mM magnesium acetate tetrahydrate, 60 mM potassium acetate, and 2 mM
dithiotheitol.
Item MW Vendor P/N Cost
Tris-OAc 181.19 Sigma T1258 $198.50 / 250 g
MgOAc 214.45 Sigma M5661 $26.90 / 250 g
KOAc 98.14 Sigma P1190 $56.60 / 500 g
DTT 154.25 Sigma D9779 $192 / 10 g
In order to ensure that the DTT in the buffer remains fresh, we find it useful to
make a 20x stock of S30 buffer without DTT, and adding the DTT in when we dilute the
stock to 1x concentration.
To make 1 liter of 20X [S30 minus DTT] buffer:
1) Add 200 ml 1M Tris-OAc, pH 8.2
2) Add 280 ml 1M MgOAc
3) Add 300 ml 4M KOAc
4) Add 220 ml water
5) Filter sterilize
To make 1 liter 1X S30 buffer:
1) Add 50 ml 20X [S30 minus DTT]
2) Add 2 ml 1M DTT
3) Add 948 ml water
24. 24
To make 1.0 liter of 1.0 M Tris-acetate, pH 8.2:
Measure 181.19 g Tris-acetate, suspend in 800 ml water. Adjust pH to 8.2 with acetic
acid. Bring final volume up to 1000 ml.
To make 1.0 liter of 1.0 M magnesium acetate:
Measure 214.5 g magnesium acetate tetrahydrate; suspend in water up to 1000 ml.
To make 1.0 liter of 4.0 M potassium acetate:
Measure 392.6 g potassium acetate; suspend in water up to 1000 ml.
To make 15 ml of 1.0 M DTT:
Measure 2.32 g DTT; place in 15 ml tube and fill with water up to 15 ml. Cap tightly and
store at -20°C.
25. 25
4.2 Reaction mix components
Extreme care is used in the creation of the individual reaction mix components.
Chemical purity grades are generally selected near the highest purity, or a near-highest
purity if cost is an issue. Chemicals are handled in a way to minimize the components
with exogenous RNase sources. To adjust the pH of small volumes, a ‘micro’ pH probe
will be needed. Potassium hydroxide (Sigma P5958) is often used to increase the pH.
.
Table of stock concentrations, volumes, and pH used to construct the 4X reaction master mix solution. Solutions that are not
completely consumed in one batch of reaction mix are stored at -80°C. Putrescine and spermidine are incubated at 37°C in order to
change phase into liquid form and are pipetted rather than weighed. Solutions listed as “unbuffered” are not pH-corrected with acid
or base due to the solutions’ weak buffering capacity, or because it was specifically left unbuffered in previous protocols
Solution [Stock] Sol’n Volume Amount Final pH Acid/base
PEP 1 M 35 ml 7.22 g 6.8 – 7.3 10N KOH
NAD 50 mM 7 ml 232 mg 6 – 7 10N KOH
CoA 40 mM 7 ml 215 mg 7.3 10N KOH
Putrescine 100 mM 10 ml 88.2 mg / 100.5 µl 7.3 glacial HOAc
Spermidine 100 mM 15 ml 218 mg / 236 µl 7.3 glacial HOAc
Oxalate 1 M 15 ml 2.76 g 8.4 unbuffered
Mg++
glutamate 1 M 50 ml 19.43 g 7.3 10N KOH
NH4
+
glutamate 1.5 M 50 ml 12.32 g 7.3 10N KOH
K+
glutamate 3.5 M 250 ml 177.83 g 8.2 unbuffered
Folinate 10.8 mg / ml 15 ml 162 mg 7.0 – 7.5 unbuffered
tRNAs 34 mg / ml 5 ml 172 mg 7.2 dissolved in 10
mM K2PO4, pH 7.2
Rifampicin 1mg / ml 50 ml 50 mg 6 – 7 10N KOH
rATP 500 mM 5 ml 1.38 g 7.3 10N KOH
rCTP 500 mM 5 ml 1.32 g 7.3 10N KOH
rGTP 500 mM 5 ml 1.31 g 7.3 10N KOH
rUTP 500 mM 5 ml 1.38 g 7.3 10N KOH
19 amino acids 50 mM 250 ml Various n/a 10N KOH
26. 26
4.2.1 PEP
Phosphoenol-pyruvate monopotassium salt
Roche 108294
$179.10 / 1 g
For 1L of TnT (250 ml of 4x Reaction mix)
You will make 35 ml of solution
You will use 33.3 ml of solution
Stock concentration = 1 M
Reaction mix concentration = 120 mM
Final reaction concentration = 30 mM
FW: 206.1
Mass required = 7.22 g
• Weigh powder, place in 50 ml conical tube.
• Add 15 ml pure water and small magnetic stir bar.
• Increase pH with KOH to 6.8 - 7.3
o Initial pH will be ~ 2.5 and a majority of PEP is insoluble.
o Use will need ~ 6 ml of 10 N KOH to facilitate complete solvation (pH ~
5.5)
o After fully solvated, then begin to pH read and adjust pH.
o You will use about 3 ml more to reach ~ pH 6.5
o At this point, add very small aliquots of KOH as the buffering capability
of PEP is greatly diminished at this pH range.
• Remove stir bar, finalize volume to 35 ml.
Discard the unused portion.
Date: Starting pH:
Final pH:
For lot #: KOH added:
27. 27
4.2.2 NAD
β-Nicotinamide adenine dinucleotide hydrate
Sigma N6522
$305.00 / 5 g
For 1L of TnT (250 ml of 4x Reaction mix)
You will make 7 ml of solution
You will use 6.67 ml of solution
Stock concentration = 50 mM
Reaction mix concentration = 1.33 mM
Final reaction concentration = 0.33 mM
FW: 663.43
Mass required = 232 mg
• Weigh powder, place in 15 ml conical tube.
• Add 5 ml pure water and small magnetic stir bar.
• Increase pH with KOH to 6-7.
o Initial pH will be ~ 2.3
o Use will need 20-35 µl of 10N KOH
o Stop increasing pH after solution is above 6.0; at this point, it has very
little buffering capability and will easily overshoot.
• Remove stir bar, finalize volume to 7 ml.
• Discard the unused portion.
Date: Starting pH:
Final pH:
For lot #: KOH added:
28. 28
4.2.3 CoA
Coenzyme A hydrate
Sigma C4282
$198.50 / 100 mg
For 1L of TnT (250 ml of 4x Reaction mix)
You will make 7 ml of solution
You will use 6.75 ml of solution
Stock concentration = 40 mM
Reaction mix concentration = 1.08 mM
Final reaction concentration = 0.27 mM
FW: 767.53
Mass required = 215 mg
• Weigh powder, place in 15 ml conical tube.
• Add 5 ml pure water and small magnetic stir bar.
• Increase pH with KOH to 7.3
o Initial pH will be ~ 1.5
o Use will need 60-120 µl of 10N KOH
• Remove stir bar, finalize volume to 7 ml.
Discard the unused portion.
Date: Starting pH:
Final pH:
For lot #: KOH added:
29. 29
4.2.4 Putrescine
1,4-Butanediamine
Aldrich D13208
$24.20 / 25 g
For 1L of TnT (250 ml of 4x Reaction mix)
You will make 10 ml of solution
You will use 10 ml of solution
Stock concentration = 100 mM
Reaction mix concentration = 4 mM
Final reaction concentration = 1 mM
FW: 88.15
Density: 0.877
Mass required = 88.2 mg
Volume required = 100.5 µl
• Melt solid by incubating in 37°C incubator.
• Add 7 ml pure water and small magnetic stir bar in 15 ml conical tube.
• Decrease pH with glacial acetic acid to 7.3
o Initial pH will be ~ 11.8
o Use will need 80-120 µl of acetic acid
• Remove stir bar, finalize volume to 10 ml.
• Before storing the Aldrich bottle, blanket well with argon; seal and wrap tightly.
(Polyamines are sensitive to oxidation by atmospheric oxygen).
Note: Unpleasant smell.
Date: Starting pH:
Final pH:
For lot #: Acid added:
30. 30
4.2.5 Spermidine
N-(3-Aminopropyl)-1,4-diaminobutane
Sigma S0266
$88.30 / 5 g
For 1L of TnT (250 ml of 4x Reaction mix)
You will make 15 ml of solution
You will use 15 ml of solution
Stock concentration = 100 mM
Reaction mix concentration = 6 mM
Final reaction concentration = 1.5 mM
FW: 145.25
Density: 0.925
Mass required = 0.218 mg
Volume required = 236 µl
• Melt solid by incubating in 37°C incubator.
• Add 10 ml pure water and small magnetic stir bar in 15 ml conical tube.
• Decrease pH with glacial acetic acid to 7.3
o Initial pH will be ~ 12
o Use will need 250-300 µl of acetic acid
• Remove stir bar, finalize volume to 15 ml.
• Before storing the Sigma bottle, blanket well with argon; seal and wrap tightly.
(Polyamines are sensitive to oxidation by atmospheric oxygen).
Note: Unpleasant smell.
Date: Starting pH:
Final pH:
For lot #: Acid added:
31. 31
4.2.6 Oxalic acid
Potassium oxalate monohydrate
Sigma O0501
$13.20 / 100 g
For 1L of TnT (250 ml of 4x Reaction mix)
You will make 15 ml of solution
You will use 2.7 ml of solution
(!) Is there frozen stock left?
Stock concentration = 1 M
Reaction mix concentration = 10.8 mM
Final reaction concentration = 2.7 mM
FW: 184.23
Mass required = 2.763 g
• Weigh powder, place in 15 ml conical tube.
• Dissolve and bring the volume up to 15 ml.
o The pH of this solution is naturally 8.4; this solution is too weakly
buffered to bother attempting to adjust the pH.
Store the remainder at -80°C
Date: Starting pH:
For lot #:
32. 32
4.2.7 Mg(glu)2
L-Glutamic acid hemimagnesium salt tetrahydrate
Fluka 49605
$34.10 / 250 g
For 1L of TnT (250 ml of 4x Reaction mix)
You will make 50 ml of solution
You will use 10 ml of solution
(!) Is there frozen stock left?
Stock concentration = 1 M
Reaction mix concentration = 40 mM
Final reaction concentration = 10 mM
FW: 388.61
Mass required = 19.43 g
• Weigh powder, place in 50 ml conical tube.
• Add 35 ml pure water and small magnetic stir bar.
• Rotate tube to dissolve powder; it may take 10-60 minutes.
• Increase pH with KOH to 7.3
o Initial pH will be ~ 6.5
o Use will need 200-400 µl of 10N KOH
• Remove stir bar, finalize volume to 50 ml.
• Filter sterilize.
Store the remainder at -80°C
Date: Starting pH:
Final pH:
For lot #: KOH added:
33. 33
4.2.8 NH4(glu)
L-Glutamic acid ammonium salt
Sigma G1376
$34.40 / 100 g
For 1L of TnT (250 ml of 4x Reaction mix)
You will make 50 ml of solution
You will use 6.67 ml of solution
(!) Is there frozen stock left?
Stock concentration = 1.5 M
Reaction mix concentration = 40 mM
Final reaction concentration = 10 mM
FW: 164.16
Mass required = 12.315 g
• Weigh powder, place in 50 ml conical tube.
• Add 35 ml pure water and small magnetic stir bar.
• Rotate tube to dissolve powder; it may take 10-60 minutes.
• Increase pH with KOH to 7.3
o Initial pH will be ~ 6
o Use will need 190-250 µl of 10N KOH
• Remove stir bar, finalize volume to 50 ml.
• Filter sterilize.
Store the remainder at -80°C
Date: Starting pH:
Final pH:
For lot #: KOH added:
34. 34
4.2.9 K(glu)
L-Glutamic acid potassium salt monohydrate
Sigma G1501
$98.60 / 500 g
For 1L of TnT (250 ml of 4x Reaction mix)
You will make 250 ml of solution
You will use 50 ml of solution
(!) Is there frozen stock left?
Stock concentration = 3.5 M
Reaction mix concentration = 700 mM
Final reaction concentration = 175 mM
FW: 203.23
Mass required = 177.83 g
• Weigh powder, place in 250 ml volumetric flask.
• Dissolve and bring the volume up to 250 ml.
o The pH of this solution is naturally 8.2; the authors’ protocol does not call
to adjust the pH of this salt.
• Filter sterilize.
Store the remainder at -80°C
Date: Starting pH:
For lot #:
35. 35
4.2.10 Folinic acid
Folinic acid calcium salt
Sigma F7878
$358.50 / 1 g
For 1L of TnT (250 ml of 4x Reaction mix)
You will make 15 ml of solution
You will use 3.15 ml of solution
(!) Is there frozen stock left?
Stock concentration = 10,800 µg/ml
Reaction mix concentration = 136 µg/ml
Final reaction concentration = 34 µg/ml
FW: 511.5
Mass required = 162 mg
• Weigh powder, place in 15 ml conical tube
• Dissolve and bring the volume up to 15 ml.
o The pH of this solution is naturally 7.0 – 7.5; this solution is too weakly
buffered to bother attempting to adjust the pH.
Store the remainder at -80°C
Date: Starting pH:
For lot #:
36. 36
4.2.11 tRNAs
tRNA from E. coli MRE 600
Roche 109550
$418.00 / 500 mg
For 1L of TnT (250 ml of 4x Reaction mix)
You will make 5 ml of solution
You will use 5 ml of solution
Stock concentration = 34,000 µg/ml
Reaction mix concentration = 682.4 µg/ml
Final reaction concentration = 170.6 µg/ml
FW: N/A
Mass required = 172 mg
• Weigh powder, place in 15 ml conical tube
• Dissolve and bring the volume up to 5 ml.
o Dissolve this solution in 10 mM potassium phosphate, pH 7.2.
Store the remainder at -80°C
Date: Starting pH:
For lot #:
37. 37
4.2.12 Rifampicin
Rifampicin
Sigma R3501
$72.80 / 1 g
For 1L of TnT (250 ml of 4x Reaction mix)
You will make 50 ml of solution
You will use 15 ml of solution
(!) Is there frozen stock left?
Stock concentration = 1,000 µg/ml
Reaction mix concentration = 40 µg/ml
Final reaction concentration = 10 µg/ml
FW: 823.0
Mass required = 50 mg
• Weigh powder, place in 50 ml conical tube.
• Add 40 ml pure water and small magnetic stir bar.
• Increase pH with KOH
o Initial pH will be ~ 4.5
o Add 5 µl of 10N KOH
• Remove stir bar, finalize volume to 50 ml.
Store the remainder at -80°C
38. 38
4.2.12 ATP
Adenosine 5′-triphosphate disodium salt
Sigma A2383
$123 / 10 g
For 1L of TnT (250 ml of 4x Reaction mix)
You will make 5 ml of solution
You will use 2.5 ml of solution
(!) Is there frozen stock left?
Stock concentration = 500 mM
Reaction mix concentration = 5 mM
Final reaction concentration = 1.25 mM
FW: 551.14
Mass required = 1.378 g
Lot specific information: 8% water, 0.1% solvent
Mass adjustment for water & solvent = 1.081
Real mass required = 1.489 g
• Weigh powder, place in 15 ml conical tube.
• Add 3 ml pure water and small magnetic stir bar.
• Increase pH with KOH to 7.3
o Initial pH will be ~ 3
o Use will need 100-400 µl of 10N KOH
• Remove stir bar, finalize volume to 5 ml.
Store the remainder at -80°C
Date: Starting pH:
Final pH:
For lot #: KOH added:
39. 39
4.2.13 CTP
Cytidine 5′-triphosphate disodium salt
Sigma C1506
$305.50 / 1 g
For 1L of TnT (250 ml of 4x Reaction mix)
You will make 5 ml of solution
You will use 2 ml of solution
(!) Is there frozen stock left?
Stock concentration = 500 mM
Reaction mix concentration = 4 mM
Final reaction concentration = 1 mM
FW: 527.12
Mass required = 1.318 g
Lot specific information: 4% water, 2% solvent
Mass adjustment for water & solvent = 1.06
Real mass required = 1.397 g
• Weigh powder, place in 15 ml conical tube.
• Add 3 ml pure water and small magnetic stir bar.
• Increase pH with KOH to 7.3
o Initial pH will be ~ 3.5
o Use will need 100-400 µl of 10N KOH
• Remove stir bar, finalize volume to 5 ml.
Store the remainder at -80°C
Date: Starting pH:
Final pH:
For lot #: KOH added:
40. 40
4.2.14 GTP
Guanosine 5′-triphosphate sodium salt hydrate
Sigma G8877
$397.50 / 1 g
For 1L of TnT (250 ml of 4x Reaction mix)
You will make 5 ml of solution
You will use 2 ml of solution
(!) Is there frozen stock left?
Stock concentration = 500 mM
Reaction mix concentration = 4 mM
Final reaction concentration = 1 mM
FW: 523.18
Mass required = 1.308 g
Lot specific information: 5.4% water, 0.2% solvent
Mass adjustment for water & solvent = 1.056
Real mass required = 1.381 g
• Weigh powder, place in 15 ml conical tube.
• Add 3 ml pure water and small magnetic stir bar.
• Increase pH with KOH to 7.3
o Initial pH will be ~ 5-6
o Use will need 100-200 µl of 10N KOH
• Remove stir bar, finalize volume to 5 ml.
Store the remainder at -80°C
Date: Starting pH:
Final pH:
For lot #: KOH added:
41. 41
4.2.15 UTP
Uridine 5′-triphosphate trisodium salt hydrate
Sigma U6750 (Sigma U6625)
$147.50 / 1 g ($337.50 / 1 g)
For 1L of TnT (250 ml of 4x Reaction mix)
You will make 5 ml of solution
You will use 2 ml of solution
(!) Is there frozen stock left?
Stock concentration = 500 mM
Reaction mix concentration = 4 mM
Final reaction concentration = 1 mM
FW: 550.09
Mass required = 1.375 g
Lot specific information: 6% water, 0% solvent
Mass adjustment for water & solvent = 1.06
Real mass required = 1.458 g
• Weigh powder, place in 15 ml conical tube.
• Add 3 ml pure water and small magnetic stir bar.
• Increase pH with KOH to 7.3
o Initial pH will be ~ 5-6
o Use will need 100-200 µl of 10N KOH
• Remove stir bar, finalize volume to 5 ml.
Store the remainder at -80°C
Date: Starting pH:
Final pH:
For lot #: KOH added:
42. 42
4.2.16 AA Mix
19 amino acids mixture
L-alanine Fluka 05129 $37.70 / 25 g 89.09 g/mol
L-arginine Fluka 11009 $19.60 / 25 g 174.20 g/mol
L-asparagine Fluka 11149 $36.10 / 25 g 132.12 g/mol
L-aspartic acid Fluka 11189 $45.90 / 100 g 133.10 g/mol
L-cysteine Fluka 30089 $45.90 / 25 g 121.16 g/mol
L-glutamic acid Fluka 49449 $25.10 / 100 g 147.13 g/mol
L-glutamine Fluka 49419 $31.60 / 25 g 146.14 g/mol
Glycine Fluka 50049 $14.80 / 100 g 75.07 g/mol
L-histidine Fluka 53319 $32.10 / 25 g 155.15 g/mol
L-isoleucine Fluka 58879 $95.40 / 50 g 131.17 g/mol
L-leucine Fluka 61819 $33.10 / 25 g 131.17 g/mol
L-lysine monoHCl Fluka 62929 $27.10 / 100 g 182.65 g/mol
L-methionine Fluka 64319 $21.60 / 25 g 149.21 g/mol
L-phenylalanine Sigma P5482 $23.60 / 25 g 165.19 g/mol
L-proline Fluka 81709 $33.70 / 25 g 115.13 g/mol
L-serine Fluka 84959 $50.50 / 25 g 105.09 g/mol
L-threonine Fluka 89179 $131.60 / 50 g 119.12 g/mol
L-tryptophan Fluka 93659 $134.20 / 50 g 204.23 g/mol
L-tyrosine Fluka 93829 $23.10 / 25 g 181.19 g/mol
L-valine Fluka 94620 $23.10 / 25 g 117.15 g/mol
For 1L of TnT (250 ml of 4x Reaction mix)
You will make 250 ml of solution
You will use 40 ml of solution
(!) Is there frozen stock left?
Stock concentration = 50 mM each
Reaction mix concentration = 8 mM each
Final reaction concentration = 2 mM each
Start with 200 ml pure water
Add:
Valine 1.464 g
Tryptophan 2.553 g
Phenylalanine 2.065 g
Isoleucine 1.640 g
Shake / incubate for 15 minutes at 37°C
43. 43
Add:
Leucine 1.640 g
Cysteine 1.515 g
Shake / incubate for 15 minutes at 37°C
Add:
Methionine 1.865 g
Alanine 1.114 g
Arginine 2.178 g
Asparagine 1.652 g
Aspartic acid 1.664 g
Glutamic acid 1.839 g
Glycine 0.938 g
Glutamine 1.826 g
Add 1.0 ml of 10N KOH.
Add:
Histidine 1.939 g
Lysine 2.283 g
Proline 1.439 g
Serine 1.314 g
Threonine 1.489 g
Tyrosine Added
later
• Finalize volume to 250 ml.
• Label six 50 ml conical tubes.
• Pipette 41 ml of the 19 amino acid mixture into each conical tube.
Test remainder or discard
Store aliquots at -80°C
Date: Starting pH:
Final pH:
For lot #: KOH added:
44. 44
5. References
1. Jewett, M.C. and J.R. Swartz, Rapid expression and purification of 100 nmol
quantities of active protein using cell-free protein synthesis. Biotechnol. Prog.,
2004. 20(1): p. 102-109.
2. Kim, D.M. and J.R. Swartz, Regeneration of adenosine triphosphate from
glycolytic intermediates for cell-free protein synthesis. Biotechnol. Bioeng., 2001.
74(4): p. 309-316.
3. Jewett, M.C. and J.R. Swartz, Substrate replenishment extends protein synthesis
with an in vitro translation system designed to mimic the cytoplasm. Biotechnol.
Bioeng., 2004. 87(4): p. 465-472.
4. Jewett, M.C. and J.R. Swartz, Mimicking the Escherichia coli cytoplasmic
environment activates long-lived and efficient cell-free protein synthesis.
Biotechnol. Bioeng., 2004. 86(1): p. 19-26.
5. Kawarasaki, Y., et al., A long-lived batch reaction system of cell-free protein
synthesis. Anal. Biochem., 1995. 226(2): p. 320-324.
6. Kim, R.G. and C.Y. Choi, Expression-independent consumption of substrates in
cell-free expression system from Escherichia coli. J. Biotechnol., 2001. 84(1): p.
27-32.
7. Calhoun, K.A. and J.R. Swartz, Energy systems for ATP regeneration in cell-free
protein synthesis reactions. Methods Mol. Biol., 2007. 375: p. 3-17.
8. Yang, J., et al., Expression of active murine granulocyte-macrophage colony-
stimulating factor in an Escherichia coli cell-free system. Biotechnol. Prog., 2004.
20(6): p. 1689-1696.
9. Kim, D.M. and J.R. Swartz, Oxalate improves protein synthesis by enhancing
ATP supply in a cell-free system derived from Escherichia coli. Biotechnol. Lett.,
2000. 22: p. 1537-1542.
10. Jewett, M.C. and J.R. Swartz, Rapid expression and purification of 100 nmol
quantities of active protein using cell-free protein synthesis. Biotechnol Prog.,
2004. 20(1): p. 102-109.
11. Voloshin, A.M. and J.R. Swartz, Efficient and scalable method for scaling up cell
free protein synthesis in batch mode. Biotechnol. Bioeng., 2005. 91(4): p. 516-
521.
12. Zawada, J., et al., High-density, defined media culture for the production of
Escherichia coli cell extracts. Ferm. Biotechnol., 2003. 862: p. 142-156.
13. Zawada, J. and J. Swartz, Maintaining rapid growth in moderate-density
Escherichia coli fermentations. Biotechnol. Bioeng., 2005. 89(4): p. 407-415.
14. Kido, M., et al., RNase E polypeptides lacking a carboxyl-terminal half suppress
a mukB mutation in Escherichia coli. J. Bacteriol., 1996. 178(13): p. 3917-3925.
15. Lopez, P.J., et al., The C-terminal half of RNase E, which organizes the
Escherichia coli degradosome, participates in mRNA degradation but not rRNA
processing in vivo. Mol. Microbiol., 1999. 33(1): p. 188-199.
16. Hahn, G.H. and D.M. Kim, Production of milligram quantities of recombinant
proteins from PCR-amplified DNAs in a continuous-exchange cell-free protein
synthesis system. Anal. Biochem., 2006. 355(1): p. 151-153.
45. 45
17. Ahn, J.H., et al., Cell-free synthesis of recombinant proteins from PCR-amplified
genes at a comparable productivity to that of plasmid-based reactions. Biochem.
Biophys. Res. Commun., 2005. 338(3): p. 1346-1352.
18. Cox, J.C., et al., Protein fabrication automation. Protein Sci., 2007. 16(3): p. 379-
390.
19. Wehrli, W., et al., Interaction of rifamycin with bacterial RNA polymerase. Proc.
Natl. Acad. Sci. USA, 1968. 61(2): p. 667-673.
20. Lowe, P.A. and A.D. Malcolm, Rifampicin binding as a probe for subunit
interactions in Escherchia coli RNA polymerase. Biochim. Biophys. Acta., 1976.
454(1): p. 129-137.
21. Iskakova, M.B., et al., Troubleshooting coupled in vitro transcription-translation
system derived from Escherichia coli cells: synthesis of high-yield fully active
proteins. Nucleic Acids Res., 2006. 34(19): p. e135.
22. Nevin, D.E. and J.M. Pratt, A coupled in vitro transcription-translation system for
the exclusive synthesis of polypeptides expressed from the T7 promoter. FEBS
Lett., 1991. 291(2): p. 259-263.
23. Brooks, R.R. and J.A. Andersen, Substrate, metal and template effects on
inhibition of bacteriophage-qbeta ribonucleic acid polymerase by ortho- and
pyro-phosphate. Biochem J., 1978. 171(3): p. 725-732.
24. Rubin, H., Central role for magnesium in coordinate control of metabolism and
growth in animal cells. Proc. Natl. Acad. Sci. USA, 1975. 72(9): p. 3551-3555.
25. Airas, R.K. and F. Cramer, Pyrophosphate-caused inhibition of the
aminoacylation of tRNA by the leucyl-tRNA synthetase from Neurospora crassa.
Eur. J. Biochem., 1986. 160(2): p. 291-296.
26. Ravel, J.M., et al., Glutamyl and Glutaminyl Ribonucleic Acid Synthetases of
Escherichia Coli W. Separation, Properties, and Stimulation of Adenosine
Triphosphate-Pyrophosphate Exchange by Acceptor Ribonucleic Acid. J. Biol.
Chem., 1965. 240: p. 432-438.
27. Chamberlin, M., J. McGrath, and L. Waskell, New RNA polymerase from
Escherichia coli infected with bacteriophage T7. Nature, 1970. 228(5268): p. 227-
231.
28. Davanloo, P., et al., Cloning and expression of the gene for bacteriophage T7
RNA polymerase. Proc. Natl. Acad. Sci. USA, 1984. 81(7): p. 2035-2039.
29. Curry, K.A. and C.S. Tomich, Effect of ribosome binding site on gene expression
in Escherichia coli. DNA, 1988. 7(3): p. 173-179.
30. Shine, J. and L. Dalgarno, The 3'-terminal sequence of Escherichia coli 16S
ribosomal RNA: complementarity to nonsense triplets and ribosome binding sites.
Proc. Natl. Acad. Sci. USA, 1974. 71(4): p. 1342-1346.
31. Mertens, N., E. Remaut, and W. Fiers, Increased stability of phage T7g10 mRNA
is mediated by either a 5'- or a 3'-terminal stem-loop structure. Biol. Chem.,
1996. 377(12): p. 811-817.
32. Liu, D.V., J.F. Zawada, and J.R. Swartz, Streamlining Escherichia coli S30
extract preparation for economical cell-free protein synthesis. Biotechnol. Prog.,
2005. 21(2): p. 460-465.
46. 46
Appendix A – Sample instruction sheet for the end user
Mark II TnT instructions:
1) You get reaction mix from the bottom shelf of the -80°C freezer.
2) You get S30 lysate from the bottom shelf of the -80°C freezer.
Both tubes are filled with 210µl, and are effectively 4x (to comprise ¼ of your final
reaction volume, each). Thus, each tube can make 0.84ml of TnT reaction. (Assume 0.8
ml) If you have spare master mix or S30 lysate (especially the master mix), please share
it with lab mates also doing TnTs that day.
Recipe:
¼ volume master mix
¼ volume lysate
½ volume water and template and anything else
Example:
12.5 µl master mix
12.5 µl lysate
25.0 µl water + 500 ng your template
Protocol:
1) Set up your water + template volumes in appropriate tubes for air exchange.
2) Vortex the master mix tube to disperse the precipitate (tyrosine) throughout the
mixture. Do this just before aliquoting; the tyrosine settles quickly. At 1x, the
tyrosine will be (nearly) completely solubilized.
3) Add the master mix and lysate to your templates. You can add them individually,
or you can first mix the lysate and vortexed master mix together and then aliquot.
4) Mix each reaction well, do not vortex.
5) Incubate at 30°C or 37°C. Remember to provide air to the reactions! Use
AirPore adhesive membrane (Qiagen 19571) to minimize water loss and prevent
dust from entering the reaction. Set the incubator to 4°C after expression for
overnight reactions.
Version 1.3, created 4/16/08, last revised 12/23/09
47. 47
Appendix B – 5’ and 3’ sequences
For linear templates, we use the following DNA sequence amended to the 5’ portion of
the open reading frame, directly preceding the start codon:
5’−GCCAGTGAATTCCGGTCACGCTTGGGACTGCCATAGGCTGG
CCCGGTGATGCCGGCCACGATGCGTCCGGCGTAGAGGATCGAGA
TCTCGATCCCGCGAAATTAATACGACTCACTATAGGGAGACCAC
AACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGA
GATATACC−3’
This contains the T7 promoter (in blue) and ribosomal binding site (in green).
We add the following segment to the 3’ portion of the open reading frame:
5’−GGCGGCTCCCACCATCACCATCACCATTAATGAAAGGGCGA
TATCCAGCACACTGGCGGCCGTTACTAGTGGATCCGGCTGCTAA
CAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGC
AATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGG
GGTTTTTTGCTGAAAGGAGGAACTATATCCGGAGCGACTCCCAC
GGCACGTTGGCAAGCTCGAAGCTTGGCGTAATC−3’
This contains a linker (GlyGlySer, in orange), a purification tag (here, His6, in yellow)
and stop codons (in red) followed by the T7 terminator.
