1. HWH Lab Protocol
Department of Biochemistry
Duke University Medical Center
Protein Fabrication Automation (PFA)
Protocol #2
GENE SYNTHESIS
Specific for DNA synthesizer: Bioautomation MerMade™ 192
Specific for liquid handling platform: Tecan Genesis & Tecan Evo
Written by J. Colin Cox, Ph.D.
Version 1.2 (October 23, 2008)

2. Introduction......................................................................................................................... 4
1. Presynthesis preparation ................................................................................................ 5
1.1 Sequence file preparation.......................................................................................... 5
1.2 Scheduling the Synthesizer....................................................................................... 6
1.3 Brief reagent inventory inspection............................................................................ 6
2. Starting a synthesis run.................................................................................................. 7
2.1 Progressing through the software set-up................................................................... 7
2.2 Other things to check before starting........................................................................ 7
2.3 “Select plates” screen................................................................................................ 8
2.4 “Select CPGs” screen................................................................................................ 9
2.5 “Final deblock settings” screen............................................................................... 11
2.6 “Select run script” screen........................................................................................ 11
2.7 “Estimated reagent usage” screen........................................................................... 12
2.8 “Lot numbers” screen ............................................................................................. 12
2.9 “Run information” screen ....................................................................................... 12
2.10 “Machine status” screen........................................................................................ 13
2.11 “Injection line check” screen ................................................................................ 13
2.12 “Vacuum test” screen............................................................................................ 14
2.13 “Wash test” screen................................................................................................ 15
2.14 Wrap-up screens.................................................................................................... 16
2.15 “Run status” screen............................................................................................... 16
2.16 Pausing the synthesizer......................................................................................... 16
2.17 Resuming the synthesizer ..................................................................................... 17
3. Finishing a synthesis run.............................................................................................. 19
3.1 “Post run information” screen................................................................................. 19
3.2 Removing the manifold(s) ...................................................................................... 19
3.3 Closing down the synthesizer ................................................................................. 20
4. Chemical handling & loading...................................................................................... 21
4.1 Chemical safety....................................................................................................... 21
4.2 Replenishing the chemical reagents........................................................................ 22
4.3 Solvating and replenishing amidites....................................................................... 22
5. Oligonucleotide postprocessing................................................................................... 24
5.1 Standard cleavage with overnight deprotection...................................................... 24
5.2 Alcohol precipitation .............................................................................................. 25
5.3 Quantification ......................................................................................................... 26
5.4 Rearraying............................................................................................................... 27
5.4.1 Rearray run preparation ................................................................................... 28
5.4.2 Rearray run....................................................................................................... 28
5.4.3 Rearray clean-up.............................................................................................. 28
5.4.4 Manual ‘working plate’ dilution...................................................................... 29
5.5 Executing the robotic assembly script (building genes) ......................................... 29
5.5.1 Assembly run preparation................................................................................ 29
5.5.2 Assembly run ................................................................................................... 30
5.5.3 Assembly clean-up........................................................................................... 31
2

3. 6. Checklists..................................................................................................................... 32
6.1 Synthesizer run checklist ........................................................................................ 33
6.2 Synthesizer finish checklist..................................................................................... 34
6.3 Robotic gene assembly checklist ............................................................................ 35
Appendix A – Gene Building cycle file............................................................................ 36
Appendix B – Gene Building reagent file......................................................................... 37
Appendix C – Synthesis consumables.............................................................................. 38
Hellinga Research Group
Department of Biochemistry
Duke University Medical Center
Nanaline Building, Room 415
Research Drive, DUMC 3711
Durham, NC, 27710, USA
Author’s e-mail: colin@biochem.duke.edu
Investigator’s e-mail: hwh@biochem.duke.edu
Written by J. Colin Cox, Ph.D.
This work is hereby released into the Public Domain. To view a copy of the public domain dedication, visit
http://creativecommons.org/licenses/publicdomain/ or send a letter to Creative Commons, 171 Second Street, Suite 300,
San Francisco, California, 94105, USA.
MerMade and MerMade 192 are trademarks of Bioautomation Corp.
GENios, Genesis, and Evo are trademarks of Tecan Trading, AG.
Kimwipes is a trademark of Kimberly-Clark Corporation.
NanoDrop is a trademark of Thermo Fisher Scientific.
Excel is a trademark of Microsoft Corporation.
3

4. Introduction
This guide is intended to be an inclusive protocol chain as a segment of Protein
Fabrication Automation. Specifically, detailed here are steps from design commitment
up to robotic gene assembly.
1. Presynthesis preparation; this section lists preparatory events to perform prior to
starting the synthesis.
2. Starting a synthesis run; this chapter details the software interface and explains
the various options. Column loading is covered.
3. Finishing a synthesis run; here, we explain the actions to be taken once a run
completes.
4. Chemical handling & loading; proper handling, storage, and dilution of chemical
reagents and amidites are discussed, including relevant chemical safety
procedures.
5. Oligonucleotide postprocessing; in this segment, the cleavage, deprotection,
precipitation, and quantification of the synthesized oligos are explained. Methods
are provided.
6. Checklists
4

5. 1. Presynthesis preparation
Generally, you need to have created the file of the sequences you wish to
synthesize, place your synthesis in the lab’s queue (if applicable), and ensure enough
reagents are on-site to complete your synthesis.
1.1 Sequence file preparation
Oligonucleotide list file creation can be created in an automated manner for
synthetic gene synthesis as described in PFA Protocol #1: PFA Software Suite. Once the
list is created, the end-user should sign-up to use the synthesizer if a queue system is
being implemented in his/her lab.
The oligonucleotide list file is a standard text file with an extension of .CSV (comma-
delimited text). There are four (comma delimited) values:
Value 1: Oligo name, a unique value. If the file is generated with VFABMGR, the format
for this value will be “scaffold#####”. For instance, GFP.designs00001,
GFP.designs00002, etc.
Value 2: Oligonucleotide sequence.
Value 3: CPG column format, given as either “S” or “U”. Standard columns come with
the last base preconjugated, while Universal columns have no bases on them. (We use
standard columns for superior cleavage.)
Value 4: State of the ‘final’ deblocking
step reflecting whether the trityl protection
group is removed, given either as “OFF”
or “ON”. Generally, you will always
choose “OFF” (to remove the trityl). In
cases where you plan to perform a 5’
modification (e.g., biotinylation), you will
select “ON” so that the trityl remains on
the oligo chain until the modification
reagent is prepared.
Example:
ecPurR_flash00097,TTCTGGCACCTTGATCATGGCTTCTTCCATGGCCTTCATGA
AGCCCGCCAGACGGCCGGCGCCGGTGTTGCGCTCGAGTGGACAACAACCCGG
GCAACAG,S,OFF[Line feed/return for next oligo]
You will need to transfer your .CSV file to the synthesizer’s computer (using a
USB drive if not networked) to the C:MM192Sequence folder.
5

6. If you generate an oligo list using VFABMGR and find that the synthesizer imports
it only as a single oligo (Section 2.3), you likely have a platform-dependent carriage-
return issue. That is, you still have linux carriage-returns and need PC carriage returns.
To fix this, simply open your oligo list file in WordPad (not NotePad), and just resave the
file. WordPad will automatically replace the linux character with the PC version.
1.2 Scheduling the Synthesizer
As a general rule of thumb, a standard MerMade™ 192 will require ~3 days to
synthesize 192 oligonucleotides when run in ‘gene building’ mode. A MerMade™ 192
outfitted with the optional 12-port oxidizer, Cap A, and Cap B dispense manifold will
only require ~2 days of synthesis time.
1.3 Brief reagent inventory inspection
Check for enough acetonitrile (large and small bottles), amidites, columns, and
gas. Consider the following values for a large run of two full synthesis plates at 100-mer
length using the liberal ‘gene building’ protocol:
• Acetonitrile, 4 l bottles 5-7 required
• Acetonitrile, 100 ml diluents 22-24 required
• Deblock 2 required
• All other chemical reagents 1 required
• Amidite bottles, 10 g amounts 2-3 each
• CPG columns ~50 each
• Argon gas One full reserve tank
• Argon liquid Over ¼ full
6

7. 2. Starting a synthesis run
For simplicity, the steps in software set-up and chemical handling & loading are
separated here, though they coincide when starting a run.
2.1 Progressing through the software set-up
It is a good habit to get into the practice of
closing out the software after a run, and running a
fresh session prior to starting a new run. Run-based
sensor deactivations perpetuate throughout any run
while the software is running; this could cause
catastrophe in certain situations where, for instance,
vacuum pressure is lost within a manifold and the
liquid sensor has been ‘ignored’ by the operator in a
previous session.
If the software is already running, hit the ‘STOP’ button, and when the pull-down
menu appears, choose File then Exit. Now relaunch the software, and allow it to
perform the X-and Y-axis motor homing procedure.
2.2 Other things to check before starting
There are a few things the software fails to have you check. Be sure to verify the
following:
• Turn on the vacuum pump.
• An argon gas cylinder feeds the argon pressure to the reagents and amidites. The
cylinder needs at least 500 psi to successfully supply gas through a night. If less
than 500 psi, replace with a fresh cylinder. The output pressure should be
approximately 20-23 psi. Take care to not set the output pressure above 25
psi; the MerMade has a hard pressure relief valve set at 25 psi, and setting the
output at 26 or 27 psi ensures that your gas cylinder will artificially empty at a
much faster rate, often during an overnight run.
• An argon liquid dewar feeds the argon to the synthesis chamber. It is difficult to
accurately gauge the amount of liquid remaining in the dewar; often the integrated
full-to-empty tank gauges are extremely miscalibrated or broken. You will want
to ‘yank’ on the top support ring of the tank to gauge its level by its apparent
weight. It is easy to tip the tank up an inch if near empty (for most people).
However, you can sometimes rely on the tank pressure as a rough gauge. The
7

8. maximum pressure of a liquid argon tank is 235 psi; if the internal tank pressure is
less than 80 psi, it may also indicate a low tank, and likely will not last the night.
The output pressure should be approximately 30-40 psi. Unfortunately,
accurately gauging these tanks requires experience.
2.3 “Select plates” screen
After clicking the green
“SET UP” button, you are prompted
for the number of plates to
synthesize. The MerMade™ 192 not
only can synthesize two plates at
once, but can apply a different
method file (chemistry/protocol
instructions) to each plate.
However, a second plate cannot be started if the machine is currently synthesizing.
When you press “NEXT”, you are prompted for your sequence files, as you
prepared under the Sequence File Preparation section of this document. The software
then displays a schematic of your plate(s). Note and/or verify the following information
to prevent error.
• Verify that the filenames you chose are displayed on the upper-right portion of the
screen as “FILENAME 1” (and “FILENAME 2”).
• Note that the longest oligonucleotide length for each plate is displayed. This
value is actually n-1 as the software does not count the existing base
preconjugated on a standard CPG column.
• To verify that your sequence file is properly formatted, click a few of the green
wells with your mouse cursor. As you hold the left button down, the (1) well, (2)
8

9. oligo name, and (3) sequence should appear on the upper portion of the screen, as
shown below. If the data is empty, or only one green wells appears, it is likely
that you have a formatting issue with your sequence file(s). Possibly, you are not
using comma-based delimitation of values, you are employing Linux-formatted
carriage returns rather than Windows-formatted line-feeds, etc.
2.4 “Select CPGs” screen
At this time, you will load the preconjugated, standard CPG columns onto the vacuum
manifold(s). Click the green “CPG” button to launch the CPG color map.
CPG (controlled-pore glass) is the matrix upon which growing oligonucleotide chains
are synthesized. Because you are synthesizing long oligos, CPG with a pore size of 1,000
Å is employed. 50 nmol columns generally yield enough material in order to generate a
wild-type scaffold anywhere from a few hundred to a thousand alleles. The columns are
color coded: adenosine, cytosine, guanosine, and thymidine.
1. Ensure that the vacuum
manifold top and bottoms
pieces are tightly put
together with the six hex-
screws. Note that the side
with the vacuum chuck is
considered ‘up’ in the
software’s schematic.
2. Next, use the adhesive-
based aluminum
microplate seals to cover
the unused wells in the
vacuum manifold.
Typically, it is easier to
cover a partial row/column
and then use a razor blade
to remove the needed
wells. For instance, in
Plate 1, use a strip of
aluminum adhesive cover
to completely cover the last
three columns of the plate (36 wells). Then, use a razor blade to remove the foil
over the bottom seven wells of that column/row. Do this step before loading the
columns.
3. If the adhesive seems to stick poorly, throw that foil away and clean the manifold
surface with acetonitrile to remove residue, and if necessary, employ a razor blade
to assist in removing residue. Seal the plate again with a fresh adhesive foil. This
9

10. is a crucial step; if the adhesive comes off during a run, the vacuum will be
breached on that plate and waste reagents will not be removed from it, and
ultimately will overflow the machine, causing damage.
4. Lightly place the correct CPG in each well, one color at a time.
5. Verify that the correct CPGs have been placed by checking the block vertically.
To further reduce error, verify again by checking the colors horizontally. This is
a crucial step; these preconjugated bases are the last base (3’) of each assembly
oligonucleotide. If the last base is incorrectly chosen, it will hybridize poorly and
greatly reduce extension (assembly) in the assembly PCR reaction leading to
ION-assembly failure, not to mention incorporating a point mutation if it does
extend.
6. Take the large rubber mallet, and pound in the
columns. Pound hard. Note the flange on the
columns, indicated with the white arrows. The
flange does not actually need to be sitting flush
on the vacuum manifold, but should be within
2-3 mm of it to ensure a tight fit.
7. Place the plate in the machine. With the door
closed on the synthesizer, click the “LOAD PLATE” button to bring the vacuum
stage to the front of the chamber. Open the lid, and guide the manifold’s vacuum
line into the vacuum line hole first, then drop/place the vacuum manifold in the
base cut-out. Finger tighten the nut, and then use the supplied wrench to fully
tighten the nut, approximately one-eighth to one-quarter of a full turn.
8. While the door is still open, use the yellow acetonitrile squirt-bottle to solvate any
dried material on the injection manifold. Try to clean in a way such that most of
the liquid will fall in the middle waste tray. Wipe any large spills outside the
waste tray.
9. While the door is still open, verify that the liquid sensor
is displaying a small green LED, thus reporting a no-
liquid state. The sensor is embedded in plastic in the
upper-left corner of the stage. If you have accidentally
gotten the sensor wet, pull the sensor off its mounting by
sliding it to the left. Use a Kimwipe™ to clean the
bottom of the sensor, and and rinse the trapezoid-shaped
mounting with acetonitrile and then dry it. If you slide
the sensor back on and the light remains red, slide a
Kimwipe™ between the bottom of the trapezoid and the stage surface to absorb
liquid on the bottom of the mounting.
10

11. 10. Finally, close the lid, and engage the two door compressor-locks. Click “DONE”,
then click “NEXT” to move on.
2.5 “Final deblock settings” screen
This screen displays the schematic indicating
whether the final deblocking action will be performed
on each oligo. DMT (dimethoxytrityl group) OFF
(green color) indicates that a final deblock protocol
will be employed at the end of the synthesis. This is
the default state.
The DMT is only left ON (red color) at the
end of a synthesis if a 5’-modification or other special
processing of the oligo is desired (e.g., capping an
oligonucleotide with biotin).
The state of the DMT may be selected in two ways. First, it is indicated in the
fourth column of the sequence information file (see Sequence File Prepartion section in
this document) as “OFF” or “ON”. If that information is missing from the sequence file,
it is assumed to be OFF. The second method is to simply click each desired oligo with
your left mouse button on this screen to toggle the state.
2.6 “Select run script” screen
This screen permits the selection of the
chemical protocol to be used during
synthesis. Note that each plate may
have a different script protocol.
We are currently using the
Bio50nmoleDNA(GeneBuilding)
script. This script is generous both
with its reaction times as well as
reagent volumes.
Never run the instrument with any
other protocol for gene writing.
11

12. 2.7 “Estimated reagent usage” screen
This screen displays the estimated amount of reagents required to complete the
synthesis run. In general, err on the side of caution. The synthesizer does not have
sensors to detect if a given reagent is low or empty. When in doubt regarding if a current
bottle level will be sufficient until the next day or the end of a run, replace/refill the
reagent. A failed synthesis due to
reagent depletion is very costly in
money and time (and frustration).
You will likely never use a
sulfurization reagent; this is typically
employed for sulfur-containing nucleic
acid, e.g., preparing phosphorothioate
linkages. Note that amidite ports are
listed in alphabetical order: 1=A, 2=C,
3=G, 4=T. Refer to the Chemical
Handling & Loading section in this
document at this point to prepare and
load the liquid reagents.
2.8 “Lot numbers” screen
At this time, you may enter lot number should you wish to track them. To skip this
screen; hit “NEXT”.
2.9 “Run information” screen
Here, briefly give a name to your
run, such as your initials and/or the project
and/or the scaffold, etc. Additionally, place
expanded notes in the “Run Notes” section.
Use the up/down arrow next to the Plate
number box to switch between first and
second plates. Alternatively, enter the
information for one plate and click “Set
same for all plates” to copy the information
to the second plate.
Due to software limitations, do not use non-standard Windows OS characters on
this screen such as question marks, slashes/backslashes, etc. To do so will cause a failure
when you start the run as the software attempts to create a filename in the operating
system called the same as the “Run Name”.
12

13. 2.10 “Machine status” screen
This screen prompts you to check a few settings on the synthesizer. First, you
verify the reagent and amidite bottle pressures. The reagent gauge is mounted on the
back, left side of the machine, the
amidite gauge is mirrored on the
back, right side.
If you need to adjust the
pressure, find the regulators on the
left side of the instrument. Twist the
knob clockwise to increase the
pressure, and counter-clockwise to
decrease it. Note that to decrease the
pressure, you’ll need to manually
vent a bottle to have the pressure
reduce gauge reduce immediately. It
will take approximately two-to-five
minutes for the new pressure level
to equilibrate in full.
Next, you will test the argon low-flow and high-flow rates. You can alternate
between the two by clicking on the orange check-boxes on the screen. You will find the
flow meters on the front-right post of the instrument. Use the black knobs on them to
adjust the air flow.
Finally, check that the chemical waste carboys are empty. If not, refer to the
Chemical Handling & Loading section in this document.
2.11 “Injection line check” screen
Displayed here is a
schematic of the injection
manifold. You will ‘run
through’ the lines for three
purposes. First, you expel
old, water-logged reagents
at the end of the reagent
line. Second, this lets you
‘run out’ air bubbles you
introduced into lines during
reagent refilling (generally
the acetonitrile and the
deblock, but it is necessary
for any reagent you
refilled). Third, this test
13

14. identifies any blocked lines. Recall that as reagents age, a majority of their breakdown
products are solvent-insoluble.
You can select each individual wash (acetonitrile) line by clicking on each
individual port, labeled ACN #. However, you can run all twelve at once by pressing
“INJECT ALL WASH LINES”. If you refilled the acetonitrile carboy and introduced air
into the feed line, you will need to keep this button pressed for 5-15 seconds. While you
hold the button down, watch the flow through the front or side window. When the air
pocket is expelled, you will see the streams briefly empty for a split second. When all
twelve streams run clear with reagent again, release the button.
Repeat the above for deblock as well (with the “INJECT ALL DEBLOCK
LINES” button. Do not overflow the waste tray. If it becomes near full during these line
tests, hit the “Drain Waste” button.
Next, flush out the CAP A, CAP B, and OXI lines. Then, you will run through
the amidite/activator pairings. Each amidite has its own activator line. On the screen, the
amidite is the left circle of the pair (unlabeled) and the activator is the right circle (labeled
ACT). Thus, for the four canonical bases, you will run through eight lines here. When
finished, empty the waste tray using the “Drain Waste” button.
2.12 “Vacuum test” screen
This screen allows you to test the vacuum
subsystem for leaks or poor sealing. Click the plate
button once to open its vacuum valve, and again to
close it (a closed valve equilibrates to atmospheric
pressure). When you hit the button, watch the
vacuum valve, located on the front, right portion of
the machine. As a crude rule of thumb, each plate
should hit the 5 inch mark within the first 5-7
seconds, and stabilize above 6 inches within 10-15
seconds.
If you do not observe the above, you may have an air/vacuum leak somewhere in
the vacuum subsystem (the real test is the next screen). This could be anywhere from the
column vacuum manifold itself down to the reciprical vacuum pump. Check the
following, which is presented in likelyhoods of decreasing order:
• Check that the adhesive foil covering the empty column holes is well sealed.
• Check that each chemical waste carboy’s lid is tight (it does not need to be
insanely tight).
14

15. • Check that there is no dirt or decay in the interface between the two column
vacuum manifold pieces, as no grease or collar is used to connect them.
• Verify that the connection nut between the manifold plate and the vacuum line is
tight (do not over-tighten!)
• Check the lines in the chemical waste carboy’s lid; listen for air hissing.
• Check the lines entering and exiting the vacuum valve relays under the machines;
listen for air hissing when the valve is opened.
• Verify the lines entering the vacuum pump are connected well and unkinked.
• The diaphragm in one of the reciprical pumps may have gone bad, especially if
exposed to the solvents used here. If this is the case, a replacement diaphram will
need to be ordered and installed. (It’s recommended to always have a spare
diaphram kit on hand at any time.)
• There may be a physical piece of debris clogging a line; the entire vacuum
pathway, especially the connection joints, need to be individually taken apart and
visually inspected. This can happen when people hammer out the CPG columns
into the synthesis chuck; never do this. Always hammer them somewhere else,
such as the deprotection chuck.
2.13 “Wash test” screen
This is the last screen
and the ‘real’ test that the
system is working
completely as a whole. Here,
when you press each
“WASH” button, the
synthesizer will fill each
column with 250 µl
acetonitrile, then open the
plate’s vacuum valve for 15 seconds, and allow pressure equilibration for 10 seconds.
After the injection manifold finishes dispensing, the stage will move to its ‘load plate’
position, bringing the stage to the front of the machine so you can view it better. Be sure
to stand in front of the machine looking down into the chamber through the glass top,
watching for any column that may not be draining. If a single column is slow to drain or
not draining, replace it (this almost never happens). If the plate takes almost the entire
fifteen seconds to drain, or fails to fully drain in that time, there is a vacuum problem and
you must not run the synthesis until the issue is identified and repaired. Generally, all
the columns fully drain in the first 5-10 seconds.
15

16. 2.14 Wrap-up screens
Now hit “FINISH”. Now press “RUN”.
2.15 “Run status” screen
The “run status” screen is displayed during the
course of the chemical synthesis. Prior to synthesis, the
chamber is evacuated with argon via the high-flow gas
line for 10 minutes. You should never skip this step
unless you are certain the chamber has already been
evacuated and blanketed somehow.
The Run status screen displays the current chemical step, both in a text window
and as a graphical representation of the vacuum manifold.
2.16 Pausing the synthesizer
During a run, you have an option to
invoke four types of pauses/stops: PAUSE
NOW, PAUSE AT END OF INJECTION
CYCLE, TEST INJECTION HEAD AFTER
NEXT WASH CYCLE, and finally PAUSE AT
BASE. Clicking the “PAUSE NOW” button
causes an immediate and abrupt stop of the
motors and injection manifold; this is very similar to an ‘emergency’ stop. For instance,
if the machine is currently in a coupling step and you hit “PAUSE NOW”, it will
instantly stop, with some columns actively coupling (now without a timer), and other
columns not. This should almost never be used. This option would be used only in a
case where a hardware collision is imminent, or the user realizes that he’s chosen the
incorrect chemistry (or some such) and wants to quickly abort before a liquid reagent is
dispensed on a column.
“PAUSE AT END OF INJECTION CYCLE” is a ‘semi-safe’ stop. That is, it will
complete its current dispense pattern and then freeze. For instance, if the machine is
currently in a coupling step, it will continue to add amidite and activator to all the
columns before stopping. This is ‘semi’-safe because while the machine is paused, the
chemistry can still be active, and thus damaging. You would want to chose this when
you want to pause the machine quite soon, and only for a brief amount of time (e.g., to
remove some debris hanging from an injection head, adjust the height of an injection
head, etc).
“TEST INJECTION HEAD AFTER NEXT WASH CYCLE” is a ‘mostly-safe’
stop. I.e., the machine will finish its current dispense pattern, perform a bundled washing
16

17. step if necessary, and then freeze. For instance, if the machine is currently in a coupling
step, it will continue to add amidite and activator to all columns, incubate for the proper
amount of reaction time, and then finally wash the columns with acetonitrile to stop the
reaction prior to freezing. In this manner, the machine could adjusted for several minutes
without fear of a particular chemical step overreacting. Additionally, when the pause
activates, the “Injection line check” appears, exactly as during the set-up to facilitate line
testing as well. This is especially useful if you need to swap a reagent immediately.
“PAUSE AT BASE” is a pause that
you will routinely use. Generally, a full run
of long oligonucleotides using both plates
would run out of wash (acetonitrile) and/or
overflow the waste carboys sometime in the late night/early morning. Because the
synthesizer has no sensors for these conditions, the user must manually specify a ‘safe’
base position at which to stop synthesis. This is done by clicking PAUSE AT BASE and
then using the mouse or keyboard to set the pause. This pause always stops at the safest
position in the synthesis round, just prior to the deblock step. It is regarded that oligos
are ‘safer’ with the DMT protection group on, rather than removed and having functional
groups available for chemistry or degradation during a pause.
Choosing the exact base to pause is difficult due to variations in base
compositions between runs; however, the end user is again cautioned not to play so-
called ‘Synthesizer Chicken’. When in doubt; synthesize a few less bases overnight.
Consider the following for synthesizing two full plates of 90 – 100-mers. A novice user
should first convince his/herself that the first overnight will easily permit 25 bases. In the
morning, the novice can begin to see deltas in reagent volumes from overnight rounds. A
user that quickly becomes experienced can have faith that 30 bases can safely be
synthesized overnight with full amidites and wash; an expert may decide to step up to 34
or 35 bases if the expert has run several dozen series of syntheses and intimately tracks
reagent usage.
Recall these numbers are for full 5g/10g amidite bottles, a full 10 l acetonitrile
wash carboy, the slow, liberal ‘gene building’ script protocol, and empty waste carboys,
while synthesizing two full plates. Any times these values change, the PAUSE AT
BASE value must be reconsidered. Of course, synthesis of fewer primers and/or a single
plate starts to become limited by waste bottle volume, rather than initial reagent volume.
For maximum synthesis speed, it is best that a novice refers to an experience user for
assistance in choosing this value.
2.17 Resuming the synthesizer
After pausing the instrument, you have five possible options: CONTINUE, INIT
CHAMBER & CONTINUE, ABORT, TEST INJECTION HEAD, and DELETE WELL.
17

18. “CONTINUE” simply restarts the synthesis, and is a typical choice if the chamber
remains unbreached. If you opened the glass top for some reason, then select the “INIT
CHAMBER & CONTINUE”. This initiates a five minute argon reblanking of the
chamber. “ABORT” completely terminates the run, regardless of current position or
progress.
“TEST INJECTION HEAD” is always used in conjugation with the “PAUSE AT
BASE” function. If, for instance, the pause causes the machine to stop several hours
before the user can replenish the reagents, reagents may crystallize due to evaporation at
the end of the injection line. This is a crucial step; a brief, few seconds injection of each
line will clean out the line termini. Absence of this action may cause the first few oligo
columns to fail as the proper reagent amount will not be dispensed, or often, the crystals
cause the reagent to ‘shoot’ off to the side for a few seconds, completely missing the
destination column.
“DELETE WELL” is used to identify individual columns to remove from the
continuing synthesis. This could save reagents in certain situations, but we have never
needed to use this function. Additionally, note that during this pause, there is a
“REMOVE” button underneath both manifold schematics. This is similar to a partial
ABORT, killing one plate while allowing the other to continue. Again, this would be
invoked very rarely.
18

19. 3. Finishing a synthesis run
Upon completion of the synthesis, you will remove the manifolds from the
synthesizer to perform postprocessing. Additionally, you will put the machine in a
‘stand-by’ or ‘suspended’ state.
3.1 “Post run information” screen
When the synthesis fully completes,
this screen is shown. This is identical to the
“run information” screen and is useful to
track certain issues that may arise during
synthesis. Any user or mechanical errors,
odd phenomenon, etc., should be briefly
entered in the Run Notes box in order to
facilitate future diagnostic investigation.
This is especially important in cases of
semi-reproducible events. These comments
become appended to the log files.
When done, remember to close the MerMade™ software by hitting the ‘STOP’
button, and when the pull-down menu appears, choose File then Exit.
3.2 Removing the manifold(s)
Open the lid, and
use the supplied wrench to
loosen the nut between the
manifold and vacuum line;
be cautious of fumes. Use
your fingers to uncouple
the nut (counter-clockwise)
and lift the vacuum
manifold upwards, holding
it horizontally. Next, hold
the manifold over the
middle waste trough, and
tip the manifold down so
that any remaining liquid in
the manifold will drip out
the vacuum line into the
waste tray.
19

20. 3.3 Closing down the synthesizer
Perform the following actions in all cases after a run completes:
• Check the gaseous argon tank to determine if reorder is needed
• Check the liquid argon dewer to determine if reorder is needed
• Close-out the controller software (as discussed previously)
• Close the synthesizer’s glass lid
• Empty chemical waste; process chemical waste if needed
• Turn off the vacuum pump
• Be sure to wash out and trash empty glass bottles
And perform the following if the synthesizer will not be used again within one week:
• Replace the amidite bottles to prevent lines clogging from the breakdown
products of the phosphoramidites:
1. Remove existing amidite bottles and properly waste them
2. Partially fill spare bottles with acetonitrile and load on the synthesizer
3. Run the amidite lines through in order to replace amidite solution in the
lines with acetonitrile (access the “Injection line check” screen by clicking
SERVICE then VALVES then INJECTION HEAD TEST)
And perform the following if the synthesizer will not be used within three or four weeks:
• Replace the reagent bottles to prevent line clogging from breakdown products of
the various compounds
1. Remove existing reagent bottles and properly waste them
2. Partially fill spare bottles with acetonitrile and load on the synthesizer
3. Run the amidite lines through in order to replace amidite solution in the
lines with acetonitrile (access the “Injection line check” screen by clicking
SERVICE then VALVES then INJECTION HEAD TEST)
• Turn the power off to the synthesizer by turning the black power switch on the
grey-colored control box on the right-side of the bottom platform. Shut the
computer as well.
20

21. 4. Chemical handling & loading
Care must be taken when handling the reagents. Protection must be extended to
the user as many of the reagents are extremely hazardous; on the other hand, protection
must also be extended to those reagents which are especially water sensitive. Specific
warnings follow below.
4.1 Chemical safety
3
3
2
C
It is suggested to don appropriate
PPE when handling most of the
‘reagent’ chemicals, including
glasses/goggles, gloves, a lab coat, and
possibly a respirator outfit with activated
charcoal. A test at our University has
metered the air during a real exercise
with human handling of the reagents,
and finds that the solvents are well
below the OSHA threshold to require a
respirator; however, you still may
choose to wear one. Pregnant and/or
nursing women who plan to use this
machine should speak to their PIs and/or
local safety officer, and/or arrange to
have labmates load the chemicals on
their behalf. This issue may be obviated
by installation of vacuum snorkels near the synthesizer. Without such a system, the end
user often will wear an activated-charcoal respirator when transferring the liquid
chemical waste and when refilling the ‘reagent’ chemicals. Most users do not feel the
need to wear a respirator to refill the acetonitrile carboy or to solvate amidites.
Regardless, employ the combination of PPE you desire for any or all steps of chemical
handling.
The combined chemical waste NFPA safety diamond is shown.
Deblock reagent is particularly corrosive, and can eat through latex
and nitrile gloves in a few seconds. It is strongly recommended to use
disposable neoprene gloves, which offer much more protection against
deblock. Neoprene is also a good choice for handling the combined waste.
In general, wear neoprene gloves for all chemical handling steps. (For
instance, VWR catalog #32916-694)
21

22. Virtually all the solvents are highly flammable. Ignition sources must not be
activated if fumes are present. This is not usually an issue, but should be brought to
attention.
4.2 Replenishing the chemical reagents
In general, the reagents are considered ‘good’ for one month after the initial
opening of a bottle. A blue sticker is provided on each bottle to mark the date of opening.
This help ensures that old, possibly water-logged reagents aren’t ever employed for
important syntheses.
When removing a partially used bottle in order to replace it with a fresh, full
bottle, always blanket the partial bottle with argon first, then tightly seal it with electrical
tape (this is used instead of parafilm as it is much less porous to moisture). Date the new
bottle that you opened. Note that you do not need to extend water sensitivity to the
oxidizer bottle, as it is formulated with 10% water.
When you open a new activator bottle, place a 5 g water trap in it. For the 10 or
20 l carboys of acetonitrile, insert a 20 g water trap. At this time, do not put the water
traps in any other of the reagent bottles. Periodically, when the acetonitrile level is low in
the carboy, be sure to remove the growing pile of water traps as accumulation of traps
can clog the intake line if the line is physically pressed against one.
4.3 Solvating and replenishing amidites
Of any chemical used in synthetic DNA synthesis, the phosphoramidites are the
most sensitive to moisture. Water quickly catalyzes the breakdown of the amidites,
which not only affect the quality of a synthesis, but are largely insoluble and can easily
clog the thin liquid tubing. To ensure a high-quality synthesis, extreme care should be
employed to prevent moisture from being introduced into the solution. Amidites are
assumed ‘good’ for 5 days after solvation at room temperature.
Generally, it is recommended to purchase amidites in lots of 5 and 10 g. Often,
the 10 g bottles are used for the bulk of a synthesis, while the 5 g bottles are used to ‘top
off’ a bottle when a 10 g would be too much. For the synthesis chemistry used on the
MerMade™, you will suspend the amidites in acetonitrile at 5 g / 100 ml. The small
bottles of ultra-low water content acetonitrile come at around 100 to 110 ml, so you
cannot simply pour an entire bottle of acetonitrile into an amidite bottle as it will
overdilute. Instead, it’s recommended to make a 100 and 200 ml ‘cheater’ bottle that you
can set next to your amidite bottle when pouring.
1. Remove the needed amidite bottles from the refrigerator, remove them from their
plastic bags, and remove the shrink-wrap surrounding the cap.
2. Take the acetonitrile diluent bottles out of the plastic bag, pull down and yank off
the gold tag, and carefully peal open the gold ring holding the stopper in place.
22

23. 3. Place the amidite bottle next to the correct-sized ‘cheater’ bottle.
4. Open the amidite bottle, and carefully pour the diluent acetonitrile into it,
matching the volume of the cheater bottle. Minimize time exposing the liquid to
air. Pour in a thin, consistent stream; don’t pour as a ‘gurgle’ or pour with lots of
splashing.
5. Into the amidite bottle, place a 2 g water trap.
6. Blanket the bottle with argon, then tightly cap.
7. Gently swirl the bottle to dissolve the amidite. Do not shake, as shaking will
ensure the solvation of any moisture remaining in the gas component. Generally,
you will swirl just a bit, and then go work on your next amidite bottle, come back
to swirl this bottle again, etc. Pay special attention to the bottom rim of the glass
bottle, which typically houses the amidite last to solvate.
8. Place a day-of-the-week sticker on each bottle so that anyone using the machine
next will know the age of the amidites.
9. Load the amidites onto the machine. If there are amidites past 5 days on the
machine, pour those into chemical waste. If they are less than 5 days, you can
pour them on top of your current bottles. After pouring, remember to reblanket
with argon.
10. When you load a bottle on the machine, screw the bottle in only partially for
about 1 minute. This facilitates argon flowing into the bottle and pushing out any
atmosphere that has entered the bottle during handling. Then, screw the bottle
completely.
11. Any remaining amidites are saved for the next day by blanketing, capping, sealing
with electrical tape, and placed in the refrigerator.
23

24. 5. Oligonucleotide postprocessing
Cleavage and deprotection are often coincidental events as they require similar
chemistry (i.e., incubation in the presence of a strong base). For synthesized DNA,
cleavage is rapid, and deprotection is (relatively) slow. Cleavage refers to cleaving the
chemical bond tethering the oligonucleotide to the control-pore glass; deprotection refers
to the removal of protection groups from the nitrogenous bases required during chemical
synthesis.
Note: because this nucleic acid is synthetic, there is no 5’ phosphate on the oligos
as is the case of enzymatically manipulated DNA. If a 5’ phosphate is required, it can be
placed on the oligos chemically at the end of a synthesis (expensive but convenient) or
enzymatically with a phosphatase (e.g., calf intestinal alkaline phosphatase; cheaper but
less convenient). 5’ phosphates are required for things like ligation reactions, but not for
other operations such as PCR or PCR-based gene assembly.
5.1 Standard cleavage with overnight deprotection
Traditionally, deprotection is performed ‘slowly’ with ammonium hydroxide, and
‘quickly’ with a mixture of ammonium hydroxide and methylamine. Rapid deprotection
can be problematic with long oligomers processed in a high-throughput manner due to
the slow thermal transfer of plastic microplates. It is easy to ‘over’-deprotect oligos on
outer wells and/or ‘under’-deprotect oligos near the center of the plate. Therefore, our
current protocol is to always perform the ‘slow’ deprotection with ammonium hydroxide
only. This slower method is highly robust.
Note that ammonium ions are extremely volatile. It is recommended that each
user keeps their own small bottle of ammonium hydroxide to ensure its freshness. A
bottle that was loosely capped will quickly decrease its concentration of ammonium and
your oligos will cleave and deprotect poorly. Cap your bottle tight, and seal with
parafilm and store in the refrigerator to minimize ammonium evaporation. Use
previously opened bottles ‘lying around’ at your own risk. The solution is approximately
30% ammonium hydroxide, 70% water. (VWR catalog # EM-AX1303-11)
1. Get a 2ml deep 96-well growth block (e.g., Phenix Research catalog #M-1810).
Label it well, and place it in the bottom of the deep aluminum vacuum manifold.
2. Unscrew the synthesis manifold top and place it over the deep vacuum manifold.
You do not need to screw these together. Take care to match synthesis column
A1 with microplate well A1.
3. Using a repeater pipettor or a multi-channel pipettor, load fresh ammonium
hydroxide into the columns to perform the cleavage. Load 100 µl to each column,
allow to incubate on the column for 15 minutes, and then open the vacuum to
drain the cleaved oligonucleotide into the microplate.
24

25. 4. Repeat the above step twice more, for a total of 300 µl. During the incubations,
do not allow your ammonium hydroxide to sit uncapped.
5. Remove the top synthesis plate; you may now hammer out the columns with the
rubber mallet and dispose them.
6. Move the microplate to the bottom aluminum deprotection chuck.
7. Tightly seal the microplate with a disposable, adhesive aluminum foil sheet.
8. Place a reusable silicon pad on top of the microplate.
9. Place the top deprotection chuck on, and then the 4 washers, and spin on the 4
wingnuts. Screw them on tight!
10. Allow the deprotection chemistry to proceed at 55°C for more than 16, but less
than 20 hours. Alternatively, the deprotection can process at room temperature
for three days. This is sometimes useful when travelling or deprotecting over a
weekend.
5.2 Alcohol precipitation
At this stage, your oligonucleotides are suspended in water and ammonium at a
very high pH, along with cleaved protection groups. These are easily purified using
alcohol precipitation, specifically 1-butanol (aka n-butanol). The water to alcohol ratio
here is much more crucial than when using ethanol as a precipitant. To ensure good
precipitation, at least 9 parts butanol must be employed with 1 part water. The oligos will
not crash out at lower alcohol ratios.
1. Allow your block to cool down to room temperature before unscrewing the
deprotection chuck in a chemical flow-hood. This ensures that you will not get a
giant puff of ammonia gas in your face.
2. Fully unscrew the chuck, remove the silicon pad, and throw away the aluminum
seal.
3. ‘Boil off’ the ammonium. Turn the plate dryer heater on, place the plate in the
heater, and lower the needles about half-way into the plate. Finally, open the air
line.
4. Incubate the plate for approximately 20 minutes if the heater was cold, or 15
minutes if the heater was already on. Basically, you are removing nearly all the
ammonium, and a bit of water as well. When the ammonium is removed, you will
not be able to smell it, or smell it faintly depending on your sense of smell (as
opposed to choking and gasping).
5. Perform an alcohol precipitation with 1-butanol (Sigma catalog #B7906). It is
assumed that after heating your plate and removing the ammonium, you are left
with approximately 200 µl of water solution. Thus, add 10 parts, or 2 mls of 1-
butanol to each well.
25

26. 6. Use a Kimwipe™ to remove any butanol on the top surface of the microplate, and
heat seal it carefully (e.g., ISC Bioexpress #T-2418-1).
7. If you tilt the plate, you will note that the water does not readily disperse into the
butanol phase. Place it on the flip-rotator for 5-10 minutes.
8. If you now tilt the plate, you should observe only one phase and the presence of
white precipitate.
9. Pellet the precipitate. Spin at 3,000 g for 5-10 minutes. Be sure that opposing
plates on the rotor are balanced.
10. Carefully remove the heat seal, and hold the plate up to the light and visually
verify the presence of pellets. If you do not have pellets, do not proceed to the
next step.
11. Slowly turn the plate up about 90 degrees, allowing the butanol solution to pour
into the sink. If you do this step slowly, you will never lose your pellets. After
pouring, you shouldn’t have more than 200 µl liquid remaining in a well.
12. Place the plate in the plate dryer until the pellets are fully dry. (Dry pellets are
stable for months.)
13. To facilitate quantification, resuspend each pellet with 300 µl of TE buffer or 10
mM Tris, pH 8.0. The pH insures complete dissolution and stability. Briefly
place the microplate on the plate shaker/vortexer to mix. Store DNA short-term at
4°C, or long-term at -20°C.
5.3 Quantification
Your oligos will be of varying concentrations, although generally they span
within a 3-fold concentration range. Regardless, quantification is absolutely necessary to
ensure robust assembly amplifications.
Take a UV-transparent microplate (Costar 3635), and fill each well with 199 µl of
water. (Generally, I will use a repeat pipettor set to 200 µl, accepting the error). Using a
multichannel pipettor, carefully dilute 1 µl of your oligo stock into the water. Shake
briefly on a microplate shaker, then read at 260 nm (e.g., on a Tecan GENios™ plate
reader). Save the data. At your computer, open your data, and also the oligo calculation
blank Excel™ spreadsheet. This file is located at Y:Fabricationoligo calc
ex-blank.xls.
Raw Bg. Sub. Adjust Dilution Ex. Coeff. stock uM ul H2O
A1 #REF! #REF! #REF! #REF! #REF!
26

27. 1. Under the Raw column, you’ll paste the actual OD values from the plate reader.
se
2.
st cell of
the column (C2) and on the text line, replace the “#REF” with a water value. For
3. d
l of sample is not 1.0 cm. This curve was empirically
determined for the GENios™ against a high linear-range spectrophotometer (e.g.,
s
4. u
these instructions, putting 1 µl of stock primer into 199/200 µl of water,
the dilution factor is 200. This value is set by the user in case stock
5.
plates in the directory to create a workup file for. The created file is written to
etc.
Copy and paste these coefficients into this column.
6.
7. The µl and H2O columns are present for manual rearraying for working plate
creation; manual rearrays are tedious and error-prone, and not recommended.
xt section for automated rearraying.
(Hint: when copying, hit Paste Special from the Edit menu, and click Transpo
to transpose the row to a column when pasting.)
The Bg. Sub, or Background Subtraction, is to subtract the value of an empty
water well. This value is always approximately 0.05. Highlight the fir
instance, if the water blank OD is found in cell B89, then replace “#REF” with
“$B$89”. The dollar signs force invariance on the reference cell ID.
The Adjust value contains a fitted curve in order to provide ‘real’ OD values an
is specific for a GENios™ plate reader. This adjusts for two phenomena. First,
the GENios™ loses linearity above OD values of 1.8 and higher. Second, the
path length of the 200 µ
a NanoDrop™). Use of another plate reader necessitates determination of it
own curve, if needed.
The Dilution is the factor of dilution that was used to create the sample. If yo
followed
concentrations are low and the user wishes to spec 2 or 5 µl of stock primer
instead.
The Ex. Coeff. is the extinction coefficient of the primer. This is calculated by
VFABMGR in a separate operation. Open your scaffold directory, and from the
“New” menu, click “Workup File”. You are then prompted for which oligo stock
username/project_name/Plates/p00001.wu, p00002.wu,
Stock µM is the calculated concentration of your oligos in micromolar.
Refer to the ne
5.4 Rearraying
We refer to the process of diluting stock primers into a working plate of uniform
concentration as “rearraying”, whether or not primer locations are moved or not.
(Although this is the case if you’ve synthesize multiple scaffold projects (dire
the same synthesizer chuck.) The purpose of rearraying is to set all the concentrations
within a stock plate to a single value. It is faster and much less error-prone to crea
ctories) on
te your
working plate in this fashion. If all the oligos in the stock plate are the same
27

28. concentration, it’s simple to use a multichannel pipettor to pipette the same volum
oligo into a row of a working plate. REARRAYER will generate a robotic script to
e of
ccomplish this, using the same setup as employed for assembly amplification.
Instructions for running REARRAYER are found in PFA Protocol #1: PFA Software Suite.
he following procedures should be performed prior to the start of a rearray; these are
sim
1.
m
etc.
2 (middle slot)
oligonucleotide plate must be placed on the robot.
5.4.2 R
y pressing the green ‘play’ button. The robot will aliquot a
specified quantity of water to each well in order to bring all the oligonucleotides to the
The
1. yed plate must be
k plate with the diluted concentration for
nths later.
3. The water trough should be covered.
a
5.4.1 Rearray run preparation
T
ilar to those listed section 6.3.
The end-user should perform basic preparation techniques necessary for any
robotic run, such as checking the system liquid level, checking the syste
waste level, loading disposable pipette tips (DiTi’s) on the worksurface,
2. A flush using the fast-pump module should be executed to remove any
bubbles that may have settled out of the lines.
3. A normal flush should be executed to ensure bubbles are removed from the
dilutors and low-volume tubing.
4. Fresh, clean Milli-Q water should be placed in trough Position
in the trough-holder.
5. The ‘stock’
earray run
Start the run b
same concentration.
5.4.3 Rearray clean-up
following procedures should be performed after completion of a run.
Prior to dilution into the ‘working plate’, the freshly-rearra
thoroughly mixed, especially due to the height of the microwells. Heat-seal the
plate, and place on a microplate shaker for 5-10 minutes.
2. Remember to physically label the stoc
easy reference. This is very useful mo
28

29. 5.4.4 Manual ‘working plate’ dilution
At this point, the user is ready to create the so-called ‘working plates’ that will be
placed on the robot’s worksurface to fuel synthetic gene assembly. The working plates
are defined as containing 1,000 µl of oligo at 1 µM concentration.
Obtain and label a 1 ml U-bottom deep-well microplate (Nalge Nunc #260252, lids
#276002).
Determine the amount of concentrated oligo to add from the stock plate. For instance, if
the stock plate concentration is 124.5 µM, then you will add 8.0 µl of each oligo. Then,
determine the water to add to each well. Continuing the example, 1,000-8 µl = 992 µl of
water. We find that rounding the values of water (e.g., 990 µl) causes no observable
difference in gene assembly.
Using a repeat pipettor or plate dispenser or multi-channel micropipettor, dispense water
to the necessary wells in the working plate.
Using a multi-channel micropipettor, dispense the concentrated oligos into the necessary
rows of the working plate. Take care to transfer row A of the stock plate to row A of the
working plate, etc.
Place the lid on the working plate, and mix well by inversion. Store the stock plate at
-20°C, and the working plate at 4°C on a short-term basis, or -20°C on a long-term
basis.
5.5 Executing the robotic assembly script (building genes)
Like the DNA synthesizer, the liquid-handling robot is an intricate, complex
device full of moving parts and electrical equipment, although more so. A trained or
experienced “laboratory roboticist” will be required to maintain the robot in healthy
working order. Despite claims from their manufacturers to the contrary, laboratory
robots are notorious for ‘drifting’ out of alignments. A well-cared for machine drifts
more slowly, but periodic revalidation of calibration values should be checked on at least
a monthly basis. This helps to ensure that a developing problem can be fixed before it
grows enough to completely stop use of the robot.
5.5.1 Assembly run preparation
The following procedures should be performed prior to the start of a run; these are
summarized in section 6.3. The below list is specific for a Tecan-brand hydraulic-based
pipetting robot (Genesis™ and Evo™ models):
29

30. 1. The end-user should perform basic preparation techniques necessary for any
robotic run, such as checking the system liquid level, checking the system waste
level, loading disposable pipette tips (DiTi’s) on the worksurface, etc.
2. A flush using the fast-pump module should be executed to remove any bubbles
that may have settled out of the lines.
3. A normal flush should be executed to ensure bubbles are removed from the
dilutors and low-volume tubing.
4. A simple protocol utilizing the solenoid pinch values should be completed. This
assesses the following: (1) that the pinch solenoids are still functioning correctly,
(2) the X- and Y-axes of the pipetting pod is still correctly calibrated. If this test
fails to dispense dye into the bottom of the wells, the robot cannot be guaranteed
to successfully assemble your alleles. This is best facilitated and determined by
pinch-dispensing 2 µl of dyed water into a PCR plate with clear wells.
5. The semi-disposable silicone pad (Bio-Rad #MSP1002) on the thermalcycler’s
heated lid must be inspected. After several hundred heat-cool cycles from PCR
cycling, the glue starts to break down, and the edges of the pad stop sticking to the
lid. When this occurs, simply replace the pad with a new one.
6. KOD Hot Start master mix (formulated from EMD Biosciences #71086) must be
aliquoted into a 2 ml (not 1.5 ml) Eppendorf tube, and placed at Position 1
(nearest the back of the robot) in the Eppendorf tube holder.
7. Fresh, clean Milli-Q water should be placed in trough Position 3 (nearest you) in
the trough-holder.
8. You must place two hard-shell, fully-skirted PCR microplates (Bio-Rad
#MSP9601) on the worksurface. The first plate will house the fragment
assemblies (ION-PCR), while the second will contain the full gene constructs
(SOE-PCR).
9. Place your rearrayed, diluted ‘working’ plates on the worksurface, with the covers
removed.
5.5.2 Assembly run
Start the run by pressing the green ‘play’ button. A short series of windows will
pop-up, prompting the end-user to double-check placement of the oligonucleotide
working plates and PCR amplification plates prior to actual pipetting. The robot will first
aliquot water, then the assembly primers, and finally the KOD master mix. The PCR
reactions are briefly mixed by repeated aspiration/dispensing, and moved into a
thermalcycler. Afterwards, the ION-PCR plate is removed and placed back on the
worksurface and diluted with water to facilitate more accurate liquid dispensing.
Next, the robot places water into the secondary PCR plate and concatenates small
aliquots of the ION-PCR reactions into the plate. Amplification (“rescue”) primers are
added along with KOD master mix, and the plate is placed into the PCR machine and
30

31. thermalcycled. For more information, refer to Cox et al., “Protein Fabrication
Automation”, 2007, Protein Sci., 16(3), 379-390.
5.5.3 Assembly clean-up
The following procedures should be performed after completion of a run; these
are summarized in section 6.3.
1. The PCR reactions should be ‘harvested’. Small portions of both plates can
be run on agarose gels for analysis, and the remaining SOE-PCR reactions can
be processed with a commercial PCR reaction clean-up kit for subsequent
downstream use in PCR reamplification and/or cloning.
2. The water trough should be covered, and the remaining KOD master mix
should be placed back in the refrigerator.
3. If necessary, the last step of the PCR program (4°C forever) must be
cancelled on the engine.
31

32. 6. Checklists
Checklists are provided to minimize operator error. Enforcing checklists with new users
is strongly recommended.
32

33. 6.1 Synthesizer run checklist
Argon
_____ Reagent pressure ok?
_____ Amidite pressure ok?
_____ Was low-argon chamber pressure ok during setup test?
_____ Was high-argon chamber pressure ok during setup test?
_____ Is the liquid dewer above ¼ full?
_____ Is the internal pressure in the gas cylinder above 500 PSI?
_____ Is the pressure out of the gas cylinder above 20, but below 25 PSI?
_____ Is the glass lid locked down on the synthesizer?
Chemicals
_____ Waste containers empty?
_____ Are all reagent and amidites bottles snuggly closed, and not venting/blanketing?
_____ Are the reagent and amidite bottles dated?
_____ Did you blanket, and seal, extra reagent bottles?
Machine & synthesis block
_____ Vacuum pump turned on?
_____ Did the wash test empty the columns in under 10 seconds? (refer to 2.13)
_____ Were the CPG columns double and triple checked during placement?
_____ Are the non-used column holes well sealed with aluminum tape?
_____ Is the liquid spill sensor status green? (refer to 2.4)
Before leaving for the night
_____ Did you remember to initiate “PAUSE AT BASE” after base zero? (refer to 2.16)
33

34. 6.2 Synthesizer finish checklist
Argon
_____ Does the liquid argon dewer need to be refilled?
_____ Does the argon gas cylinders need to be replaced?
Chemicals
_____ Did you empty all the waste into proper waste containers?
_____ Did you set the machine up for stand-by if no one is using it within the next
week? (refer to 3.3)
_____ Did you set the machine up for no power if no one is using it within the next three
weeks? (refer to 3.3)
Machine & synthesis block
_____ Did you turn off the vacuum pump?
_____ Did you close out the synthesizer software?
_____ Did you trash your columns from the synthesis chuck after cleavage?
34

35. 6.3 Robotic gene assembly checklist
Pre-run preparation
_____ Copy the robotic script file to a local drive (e.g., C:FabricationRuns)
_____ Check if system liquid dewer needs filling (more than 1/3 full)
_____ Check is system waste needs to be emptied (more than ¾ full)
_____ Place fresh water in trough in trough position 3 (nearest edge)
_____ Refill the liquid-sensing P20 tips
_____ Refill the liquid-sensing P200 tips
_____ Fill and place a 2 ml eppy with KOD master mix in position 1 of the Eppendorf-
tube holder (toward the back)
_____ Check the disposable thermalcycler silicon pad; replace if lifting at the edges
Equipment check
_____ Perform a flush, fast-wash, no pinch valves, 50 ml.
_____ Perform a flush, normal, with pinch valves, 5 ml. Visually verify no bubbles
present in the dilutors’ syringes.
_____ Reset the DiTi positions, once for the 20s, and again for the 200s.
_____ Perform the pinch test protocol (PinchTest2) to ensure correctly functioning
pinch valves. Visually verify dispense in bottom of all microwells.
Run
_____ Load your script file
_____ Place the stated oligo plates on the worksurface, as well as the primary (ION) and
secondary (SOE) reaction PCR plates.
_____ Start the run
Post-run
_____ End the thermalcycler program (4°C forever)
_____ Return unused KOD master mix to the refrigerator
_____ Cover the water trough
_____ Store your working oligo plates and PCR plates
35

36. Appendix A – Gene Building cycle file
Header
Wash
Wash
Cap
Cap
Wash
Wash
Body
Deblock
Deblock
Wash
Wash
Couple
Couple
Wash
Cap
Wash
Oxidize
Wash
Cap
Wash
Wash
Footer
Deblock
Deblock
Deblock
Wash
Wash
Wash
36

37. Appendix B – Gene Building reagent file
Values listed are for a 50 nmol synthesis.
Deblock
120 µl 50 sec 2 vacuum pulses
Capping reagents (A & B)
60 µl 45 sec 2 vacuum pulses
Oxidizer
95 µl 45 sec 2 vacuum pulses
Wash (acetonitrile)
250 µl 0 sec No pulsing
Coupling, amidite
60 µl 75 sec 2 vacuum pulses
Coincidental
Coupling, activator
80 µl 75 sec 2 vacuum pulses
37

38. Appendix C – Synthesis consumables
All consumables are ordered through BioAutomation (972-335-2525) out of Plano, TX.
Values in bold are indicated to prevent ordering of a similar reagent.
Item P/N Source Description
Deblock BIO830 EMD Biosciences dichloroacetic acid (3%) in
dichloromethane
Cap A BIO221 EMD Biosciences 2,6-lutidine (10%), acetic anhydride
(10%) in THF
Cap B BIO345 EMD Biosciences methylimidazole (16%) in THF
Oxidizer BIO420 EMD Biosciences 0.02 M iodine in THF (70%),
pyridine (20%), water (10%)
Activator BIO152 EMD Biosciences 0.25M 5-(ethylthio)-1H-tetrazole in
acetonitrile
Acetonitrile (wash) AX0151 EMD Biosciences acetonitrile, low-water
Acetonitrile (diluent) 40-4050-50 Glen Research acetonitrile, low-water
dA 10-1000 Glen Research dA-CE phosphoramidite
dC 10-1015 Glen Research Ac-dC-CE phosphoramidite
dG 10-1029 Glen Research dmf-dG-CE phosphoramidite
dT 10-1030 Glen Research dT-CE phosphoramidite
dA CPG column MM1-1000-5 Biosource 5’-DMT-dA(Bz), 1000Å, 50 nmol
dC CPG column MM1-1100A-5 Biosource 5’-DMT-dC(Ac), 1000Å, 50 nmol
dG CPG column MM1-1200F-5 Biosource 5’-DMT-dG(dmf), 1000Å, 50 nmol
dT CPG column MM1-1300-5 Biosource 5’-DMT-dT, 1000Å, 50 nmol
Water traps TP-(gram amount) ChemAssist Molecular trap pack
38