Final Project: (Week 8)
In this paper, students will analyze and discuss small business growth in terms of growth strategy, business forms, short and medium term goals, financing assistance, organizational structure and staffing needs, customers and promotion, and ethics and social responsibility. Students are expected to apply business and management concepts learned in our course.
By completing this assignment, students will meet the outcome(s):
•identify the critical business functions and how they interact in order to position the organization to be effective in the current business environment;
•explain the importance of the integration of individuals and systems to organizational effectiveness;
•describe the ethical and social responsibilities that confront a business.
Required Elements of the Final Project:
•Read critically and analyze the case below, Planning for Growth;
•Review the project description listed above and review the final project grading rubric, which you will find in the Syllabus and under the Course Content area of our classroom;
•In your paper, answer the following questions:
•What steps should Kelly take to organize and prioritize her business growth strategy?
•What business form might make sense, given her expansion plans, and why?
•Focusing primarily on Kelly’s short-term goals, what kind of financial assistance might be available to Kelly? Which options would you recommend, and why?
•How might Kelly’s staffing needs change? What kind of organizational structure do you think Kelly’s expanded business should have, and what is the best way for her to organize, orient, and train her restaurant staff (e.g., functional categories, units, teams, flat or vertical hierarchy) to meet the needs of her new business?
•How should Kelly deal with her current customers in regard to the change? What kind of promotion should she consider in attracting customers to her new location?
•What are the ethical issues and potential social responsibilities highlighted by this change? (Consider customers, employees, the current and new communities, and other stakeholders.) How might these issues be dealt with most appropriately?
Required Formatting of Paper:
•This report should be double spaced, 12-point font, and four to five pages in length excluding the title page and reference page;
•Format in Microsoft Word or Rich Text Format (rtf);
•Title page;
•Follow this format for your paper (based on elements detailed above)
◦Title page
◦Introduction
◦Body, in paragraph form. Use the following section headings:
◦Growth Strategy
◦Business Form
◦Financial Assistance
◦Organizational Structure and Staffing Needs
◦Customers and Promotion
◦Ethical Issues and Social Responsibility
◦Summary paragraph
◦Reference page formatted according to APA requirements. Include at least three
•This paper is to be written in the third person. There should be no words in the paper such as “I and we;”
In-text citations from the course material. ...
The name of the company is South west airlinei chose action pla.docxdennisa15
The name of the company is South west airline
i chose action plan and evaluative plan
Final Project: Final Paper, Presentation, and Peer Assessment
This assignment is a group project. Students will be placed into groups consisting of groups of four or five students each. Groups will be assigned early, and the expectation is that the groups will work on the various parts of the assignment as relevant material is covered throughout the course. The group will act as a self-directed team, and will therefore determine its own timetable, task list, guidelines for communication, goals, and so forth. As an individual, you are expected to participate fully in the project. Everyone in your group will receive the same grade for the project.
Your group will create a strategic plan and present the plan in a professional manner. The plan requires a paper turn in to the Assignment Folder and a PowerPoint presentation that is presented in the last week of class.
All students in the group will receive the same grade for the final paper and the presentation.
However, if a student fails to contribute to the project, the student will earn a zero for the assignment and/or PowerPoint presentation.
By completing this assignment, students will meet the outcome(s):
examine the impact of ethical decision making, social responsibility, stakeholder analysis, and corporate governance on organizations and society
formulate and evaluate an organization's vision and mission statement, and develop long-term objectives
analyze and synthesize strengths, weaknesses, opportunities, and threats (SWOT) to generate, prioritize, and implement alternative strategies in order to write and present a strategic plan
evaluate the outcomes of selected strategies to determine their success and impact on the achievement of an organization's vision and mission
Required Elements to include in Applied Final Project:
The strategic plan should include:
Ø vision and mission
Ø background organization
Ø industry analysis
Ø competitive analysis
Ø financial analysis
Ø technique analysis (using one technique from chapter 6)
Ø alternative strategy generation
Ø SWOT analysis
Ø strategy and prioritization selection
Ø action plan
Ø evaluative plan
Identify strategies
Discuss strategies used at the corporate, business and function levels using the concepts learned in the course.
Demonstrate critical thinking in the assessment.
Required Formatting of Paper:
This report should be double spaced, 12-point font, 20 - 25 pages in length excluding the title page and reference page;
This paper should be written in the third person. No script should contain the words “I or we;”
Title page with your name, the course name, the date, and instructor’s name;
Include a reference page;
Use APA formatting for in-text citations and reference page. You are expected to paraphrase and not use quotes. Deductions will be taken when quotes are used and found to be unnecessary;
Submit the paper in the Assignment Folder.
The name of the company is south air lineFinal Project Fi.docxirened6
The name of the company is south air line
Final Project: Final Paper, Presentation, and Peer Assessment
This assignment is a group project. Students will be placed into groups consisting of groups of four or five students each. Groups will be assigned early, and the expectation is that the groups will work on the various parts of the assignment as relevant material is covered throughout the course. The group will act as a self-directed team, and will therefore determine its own timetable, task list, guidelines for communication, goals, and so forth. As an individual, you are expected to participate fully in the project. Everyone in your group will receive the same grade for the project.
Your group will create a strategic plan and present the plan in a professional manner. The plan requires a paper turn in to the Assignment Folder and a PowerPoint presentation that is presented in the last week of class.
All students in the group will receive the same grade for the final paper and the presentation.
However, if a student fails to contribute to the project, the student will earn a zero for the assignment and/or PowerPoint presentation.
By completing this assignment, students will meet the outcome(s):
examine the impact of ethical decision making, social responsibility, stakeholder analysis, and corporate governance on organizations and society
formulate and evaluate an organization's vision and mission statement, and develop long-term objectives
analyze and synthesize strengths, weaknesses, opportunities, and threats (SWOT) to generate, prioritize, and implement alternative strategies in order to write and present a strategic plan
evaluate the outcomes of selected strategies to determine their success and impact on the achievement of an organization's vision and mission
Required Elements to include in Applied Final Project:
The strategic plan should include:
Ø vision and mission
Ø background organization
Ø industry analysis
Ø competitive analysis
Ø financial analysis
Ø technique analysis (using one technique from chapter 6)
Ø alternative strategy generation
Ø SWOT analysis
Ø strategy and prioritization selection
Ø action plan
Ø evaluative plan
Identify strategies
Discuss strategies used at the corporate, business and function levels using the concepts learned in the course.
Demonstrate critical thinking in the assessment.
Required Formatting of Paper:
This report should be double spaced, 12-point font, 20 - 25 pages in length excluding the title page and reference page;
This paper should be written in the third person. No script should contain the words “I or we;”
Title page with your name, the course name, the date, and instructor’s name;
Include a reference page;
Use APA formatting for in-text citations and reference page. You are expected to paraphrase and not use quotes. Deductions will be taken when quotes are used and found to be unnecessary;
Submit the paper in the Assignment Folder.
Required Formatting of PowerPoint Present.
Assignment 1 FIN101Course Name Principles of FinanceStude.docxbraycarissa250
Assignment 1 FIN101
Course Name: Principles of Finance
Student’s Name:
Course Code: FIN101
Student’s ID Number:
Semester: 2nd
CRN:
Academic Year: 1440/1441 H
For Instructor’s Use only
Instructor’s Name:
Students’ Grade: / 5
Level of Marks: High/Middle/Low
Instructions:
· This Assignment must be submitted on Blackboard (WORD format only) via the allocated folder.
· Email submission will not be accepted.
· You are advised to make your work clear and well-presented; marks may be reduced for poor presentation. This includes filling your information on the cover page.
· Assignment will be evaluated through BB Safe Assign tool.
· Late submission will result in ZERO marks being awarded.
· The work should be your own, copying from students or other resources will result in ZERO marks.
· Use Times New Roman font 12 for all your answers.
Assignment Questions
Q1 (2 marks)
Altamimi Company’s net income for the year 2000, is $3,700,214. The company had an EBITDA of $ 10,125,300, and its depreciation and amortization expense was equal to $2,543,790. The company's average tax rate is 35 percent.
a. What is the amount of interest expenses for the firm? (Show the details of your calculations).
b. Prepare a common sized Income Statement if sales equal $12,000,000.
Q2. (2 Marks)
The following are accounts balance (in thousands) for Malak Company. Prepare a balance sheet, and Income statement using intermediate steps t=35% for the year ended December 31, 2018.
Net property and equipment
$ 2,000
Accounts receivable
$3,000
Notes payable
$37,000
Revenues
$ 983,000
Supply expenses
$ 255,000
Depreciation expenses
$ 35,000
Labor expense
$300,000
Interest Expenses
$11,000
Stockholders’ Equity
$61,500
Cash & cash equivalents
$97,000
Long-term debt
$3,500
Q3. Why secondary markets are so important to raise capital? (1 mark)
Criteria Levels of Achievement
Content 70% Advanced Proficient Developing Not present
Content and
development
40 to 36 Points
Information clearly relates to
the main topic. It includes
several supporting details
and/or examples. All topics
are thoroughly addressed
and/or all questions are
answered. Minimum word
count is reached.
35 to 28 points
Information clearly relates to
the main topic. No details
and/or examples are given.
All or most topics are
generally but not
comprehensively addressed
and all or most questions are
answered. Minimum word
count is reached.
27 to 1 points
Assignment is missing key
elements; lacks contextual
presentation and the central
thesis of the project is unclear.
Information has little or no
relation to the main topic. Topics
and/or questions were not
addressed satisfactorily.
Minimum word count is not
reached.
0 points
No assignment submitted.
Depth and
Organization
30 to 27 points
The introduction provides
sufficient background on the
topic and previews major
points. Ideas flow in a logical
sequence. The structure of the
paper i ...
Assessment Task 1 Leadership Development ReportThis assessmen.docxdavezstarr61655
Assessment Task 1: Leadership Development Report
This assessment task is a REPORT.
This requires you to use a particular style of writing which involves both the way the report is structured and the way that you acknowledge other people’s ideas used in your work.
Your second step should be mastering the art of referencing. There are many styles of referencing in use in different disciplines and geographical locations.
HARVARD REFERENCING is required.
Remember: this current assessment task is a REPORT not an ESSAY.
The critical thinking element
We want you to be very comfortable with questioning everything you read and hear.
Anyone can remember facts and state other people’s views but a far more useful skill is to critically review what you read and hear and decide for yourself how reliable, accurate, applicable, contemporary, objective and fair it is.
In this report, your assessor will value the fact that you are able to see both benefits and deficiencies in a particular theory. Make sure you look through the critical thinking exercises in the course site to get a clear understanding of critical thinking!
How many references should I cite?
There is no right answer to this question because it all depends on what you write in your report. Some statements you make in your report will certainly need a reference to support them.
So, to determine how many references you need to cite, first (as described in the report writing tutorial) draw a mind map of ideas to go into your report and for each idea try to link it to a reference source.
How will the report be marked?
Your lecturers have already created a marking rubric that will be used to award you a mark out of 50 as the report comprises 50 of the overall 100 marks available in this course.
The rubric is reproduced over the page and will be used as a way of providing feedback to you on how you performed.
The most important thing about the rubric is that it DEFINES what you will be marked on. If you include additional material that is not mentioned in the rubric it will not attract any marks, if you forget to write about something listed in the rubric, you’ll lose marks.
So the rubric is like a “contract” between you and your lecturer. Following the rubric clearly is your best strategy for a good result
THE TASK
1. Explore the Central Michigan University competencies model (5 clusters eg. Self-Management, Leading others, Task management, Innovation and Social Responsibility)
2. Identify your current strengths and weaknesses as a leader (or potential leader) within the context of the CMU (eg. Create a clear vision of yourself in approx. 5-10 years time – only then will you be able to identify your strengths and weaknesses)
3. Review the leadership theories explored in this course and describe how they relate to you and your leadership development (again in the context of the CMU model eg. Blake and Mouton model grid)
4. Create a leadership development plan (*Starting point – Acti.
Assessment Task 1 Leadership Development ReportThis assessmen.docxfredharris32
Assessment Task 1: Leadership Development Report
This assessment task is a REPORT.
This requires you to use a particular style of writing which involves both the way the report is structured and the way that you acknowledge other people’s ideas used in your work.
Your second step should be mastering the art of referencing. There are many styles of referencing in use in different disciplines and geographical locations.
HARVARD REFERENCING is required.
Remember: this current assessment task is a REPORT not an ESSAY.
The critical thinking element
We want you to be very comfortable with questioning everything you read and hear.
Anyone can remember facts and state other people’s views but a far more useful skill is to critically review what you read and hear and decide for yourself how reliable, accurate, applicable, contemporary, objective and fair it is.
In this report, your assessor will value the fact that you are able to see both benefits and deficiencies in a particular theory. Make sure you look through the critical thinking exercises in the course site to get a clear understanding of critical thinking!
How many references should I cite?
There is no right answer to this question because it all depends on what you write in your report. Some statements you make in your report will certainly need a reference to support them.
So, to determine how many references you need to cite, first (as described in the report writing tutorial) draw a mind map of ideas to go into your report and for each idea try to link it to a reference source.
How will the report be marked?
Your lecturers have already created a marking rubric that will be used to award you a mark out of 50 as the report comprises 50 of the overall 100 marks available in this course.
The rubric is reproduced over the page and will be used as a way of providing feedback to you on how you performed.
The most important thing about the rubric is that it DEFINES what you will be marked on. If you include additional material that is not mentioned in the rubric it will not attract any marks, if you forget to write about something listed in the rubric, you’ll lose marks.
So the rubric is like a “contract” between you and your lecturer. Following the rubric clearly is your best strategy for a good result
THE TASK
1. Explore the Central Michigan University competencies model (5 clusters eg. Self-Management, Leading others, Task management, Innovation and Social Responsibility)
2. Identify your current strengths and weaknesses as a leader (or potential leader) within the context of the CMU (eg. Create a clear vision of yourself in approx. 5-10 years time – only then will you be able to identify your strengths and weaknesses)
3. Review the leadership theories explored in this course and describe how they relate to you and your leadership development (again in the context of the CMU model eg. Blake and Mouton model grid)
4. Create a leadership development plan (*Starting point – Acti ...
Page 1 of 8
School of Management
—
BUSM4551 CID/Innovation Management
Assessment 3: Reflective piece
Assessment type: Essay Word limit: 1,000 (+/- 10%)
The word count excludes
the cover page, reference
list, and any appendices
that you may wish to
include.
Due Date: On or before Monday of Week 13 @
23:59 (Singapore time)
Weighting: 20%
Overview
You are required to engage in creative writing of a reflective essay consisting of an academic
analysis of your own learning experiences through self-reflection.
The purpose of writing a reflective essay is to provide you with a platform to not only recount a
particular life experience, but to also explore how you have changed or learned from those
experiences. Essays should be authored individually; all ideas and words should be your own.
Assessment criteria (100 marks equate to 20% of overall course assessment)
This assessment will measure your ability to:
• Introduce the context, background, scope and purpose of your essay (10 marks)
• Provide a quality encounter of your learning (15 marks)
• Reflect at a level that reveals deep insights (20 marks)
• Evaluate the significance and impact of your learning (20 marks)
• Implicate the significance of your learning to your future career (15 marks)
• Draw a meaningful conclusion (10 marks)
• Professionally present your encounter (10 marks)
Learning outcomes
Course Learning Outcomes related to this assessment are:
Page 2 of 8
CLO1 Explain the relationship between creativity, innovation and entrepreneurship and how
it impacts business growth, sustainability and wealth creation
CLO2
Investigate factors that inhibit creativity in individuals and innovation within teams and
organisations, and recommend strategies and tactics to encourage entrepreneurial
behaviour
CLO3 Identify and critique organisational models of innovation management
CLO4 Work individually, and collaboratively with others in applying a range of tools that assist
the creative front end of innovation that leads to problem solving
CLO5 Evaluate the characteristics that make innovative organisations successful and discuss
how a business might emulate these traits
CLO6 Demonstrate learning through presentation and communication skills in a variety of
business and professional contexts
The Program Learning Outcomes related to this assessment are:
PLO1 Explain their role as a local, national and global citizen and be able to apply these
perspectives in business contexts.
PLO4
Reflect on and continuously progress their own professional development, enhancing
their intellectual agility and adaptability as tools for success in ever-changing business
contexts.
Assessment details
This assessment requires you to look back on your learning and experiences in this course and
provide a personal reflection of what you learned from the course and how you have both used and
will use this learning in the futu ...
The name of the company is South west airlinei chose action pla.docxdennisa15
The name of the company is South west airline
i chose action plan and evaluative plan
Final Project: Final Paper, Presentation, and Peer Assessment
This assignment is a group project. Students will be placed into groups consisting of groups of four or five students each. Groups will be assigned early, and the expectation is that the groups will work on the various parts of the assignment as relevant material is covered throughout the course. The group will act as a self-directed team, and will therefore determine its own timetable, task list, guidelines for communication, goals, and so forth. As an individual, you are expected to participate fully in the project. Everyone in your group will receive the same grade for the project.
Your group will create a strategic plan and present the plan in a professional manner. The plan requires a paper turn in to the Assignment Folder and a PowerPoint presentation that is presented in the last week of class.
All students in the group will receive the same grade for the final paper and the presentation.
However, if a student fails to contribute to the project, the student will earn a zero for the assignment and/or PowerPoint presentation.
By completing this assignment, students will meet the outcome(s):
examine the impact of ethical decision making, social responsibility, stakeholder analysis, and corporate governance on organizations and society
formulate and evaluate an organization's vision and mission statement, and develop long-term objectives
analyze and synthesize strengths, weaknesses, opportunities, and threats (SWOT) to generate, prioritize, and implement alternative strategies in order to write and present a strategic plan
evaluate the outcomes of selected strategies to determine their success and impact on the achievement of an organization's vision and mission
Required Elements to include in Applied Final Project:
The strategic plan should include:
Ø vision and mission
Ø background organization
Ø industry analysis
Ø competitive analysis
Ø financial analysis
Ø technique analysis (using one technique from chapter 6)
Ø alternative strategy generation
Ø SWOT analysis
Ø strategy and prioritization selection
Ø action plan
Ø evaluative plan
Identify strategies
Discuss strategies used at the corporate, business and function levels using the concepts learned in the course.
Demonstrate critical thinking in the assessment.
Required Formatting of Paper:
This report should be double spaced, 12-point font, 20 - 25 pages in length excluding the title page and reference page;
This paper should be written in the third person. No script should contain the words “I or we;”
Title page with your name, the course name, the date, and instructor’s name;
Include a reference page;
Use APA formatting for in-text citations and reference page. You are expected to paraphrase and not use quotes. Deductions will be taken when quotes are used and found to be unnecessary;
Submit the paper in the Assignment Folder.
The name of the company is south air lineFinal Project Fi.docxirened6
The name of the company is south air line
Final Project: Final Paper, Presentation, and Peer Assessment
This assignment is a group project. Students will be placed into groups consisting of groups of four or five students each. Groups will be assigned early, and the expectation is that the groups will work on the various parts of the assignment as relevant material is covered throughout the course. The group will act as a self-directed team, and will therefore determine its own timetable, task list, guidelines for communication, goals, and so forth. As an individual, you are expected to participate fully in the project. Everyone in your group will receive the same grade for the project.
Your group will create a strategic plan and present the plan in a professional manner. The plan requires a paper turn in to the Assignment Folder and a PowerPoint presentation that is presented in the last week of class.
All students in the group will receive the same grade for the final paper and the presentation.
However, if a student fails to contribute to the project, the student will earn a zero for the assignment and/or PowerPoint presentation.
By completing this assignment, students will meet the outcome(s):
examine the impact of ethical decision making, social responsibility, stakeholder analysis, and corporate governance on organizations and society
formulate and evaluate an organization's vision and mission statement, and develop long-term objectives
analyze and synthesize strengths, weaknesses, opportunities, and threats (SWOT) to generate, prioritize, and implement alternative strategies in order to write and present a strategic plan
evaluate the outcomes of selected strategies to determine their success and impact on the achievement of an organization's vision and mission
Required Elements to include in Applied Final Project:
The strategic plan should include:
Ø vision and mission
Ø background organization
Ø industry analysis
Ø competitive analysis
Ø financial analysis
Ø technique analysis (using one technique from chapter 6)
Ø alternative strategy generation
Ø SWOT analysis
Ø strategy and prioritization selection
Ø action plan
Ø evaluative plan
Identify strategies
Discuss strategies used at the corporate, business and function levels using the concepts learned in the course.
Demonstrate critical thinking in the assessment.
Required Formatting of Paper:
This report should be double spaced, 12-point font, 20 - 25 pages in length excluding the title page and reference page;
This paper should be written in the third person. No script should contain the words “I or we;”
Title page with your name, the course name, the date, and instructor’s name;
Include a reference page;
Use APA formatting for in-text citations and reference page. You are expected to paraphrase and not use quotes. Deductions will be taken when quotes are used and found to be unnecessary;
Submit the paper in the Assignment Folder.
Required Formatting of PowerPoint Present.
Assignment 1 FIN101Course Name Principles of FinanceStude.docxbraycarissa250
Assignment 1 FIN101
Course Name: Principles of Finance
Student’s Name:
Course Code: FIN101
Student’s ID Number:
Semester: 2nd
CRN:
Academic Year: 1440/1441 H
For Instructor’s Use only
Instructor’s Name:
Students’ Grade: / 5
Level of Marks: High/Middle/Low
Instructions:
· This Assignment must be submitted on Blackboard (WORD format only) via the allocated folder.
· Email submission will not be accepted.
· You are advised to make your work clear and well-presented; marks may be reduced for poor presentation. This includes filling your information on the cover page.
· Assignment will be evaluated through BB Safe Assign tool.
· Late submission will result in ZERO marks being awarded.
· The work should be your own, copying from students or other resources will result in ZERO marks.
· Use Times New Roman font 12 for all your answers.
Assignment Questions
Q1 (2 marks)
Altamimi Company’s net income for the year 2000, is $3,700,214. The company had an EBITDA of $ 10,125,300, and its depreciation and amortization expense was equal to $2,543,790. The company's average tax rate is 35 percent.
a. What is the amount of interest expenses for the firm? (Show the details of your calculations).
b. Prepare a common sized Income Statement if sales equal $12,000,000.
Q2. (2 Marks)
The following are accounts balance (in thousands) for Malak Company. Prepare a balance sheet, and Income statement using intermediate steps t=35% for the year ended December 31, 2018.
Net property and equipment
$ 2,000
Accounts receivable
$3,000
Notes payable
$37,000
Revenues
$ 983,000
Supply expenses
$ 255,000
Depreciation expenses
$ 35,000
Labor expense
$300,000
Interest Expenses
$11,000
Stockholders’ Equity
$61,500
Cash & cash equivalents
$97,000
Long-term debt
$3,500
Q3. Why secondary markets are so important to raise capital? (1 mark)
Criteria Levels of Achievement
Content 70% Advanced Proficient Developing Not present
Content and
development
40 to 36 Points
Information clearly relates to
the main topic. It includes
several supporting details
and/or examples. All topics
are thoroughly addressed
and/or all questions are
answered. Minimum word
count is reached.
35 to 28 points
Information clearly relates to
the main topic. No details
and/or examples are given.
All or most topics are
generally but not
comprehensively addressed
and all or most questions are
answered. Minimum word
count is reached.
27 to 1 points
Assignment is missing key
elements; lacks contextual
presentation and the central
thesis of the project is unclear.
Information has little or no
relation to the main topic. Topics
and/or questions were not
addressed satisfactorily.
Minimum word count is not
reached.
0 points
No assignment submitted.
Depth and
Organization
30 to 27 points
The introduction provides
sufficient background on the
topic and previews major
points. Ideas flow in a logical
sequence. The structure of the
paper i ...
Assessment Task 1 Leadership Development ReportThis assessmen.docxdavezstarr61655
Assessment Task 1: Leadership Development Report
This assessment task is a REPORT.
This requires you to use a particular style of writing which involves both the way the report is structured and the way that you acknowledge other people’s ideas used in your work.
Your second step should be mastering the art of referencing. There are many styles of referencing in use in different disciplines and geographical locations.
HARVARD REFERENCING is required.
Remember: this current assessment task is a REPORT not an ESSAY.
The critical thinking element
We want you to be very comfortable with questioning everything you read and hear.
Anyone can remember facts and state other people’s views but a far more useful skill is to critically review what you read and hear and decide for yourself how reliable, accurate, applicable, contemporary, objective and fair it is.
In this report, your assessor will value the fact that you are able to see both benefits and deficiencies in a particular theory. Make sure you look through the critical thinking exercises in the course site to get a clear understanding of critical thinking!
How many references should I cite?
There is no right answer to this question because it all depends on what you write in your report. Some statements you make in your report will certainly need a reference to support them.
So, to determine how many references you need to cite, first (as described in the report writing tutorial) draw a mind map of ideas to go into your report and for each idea try to link it to a reference source.
How will the report be marked?
Your lecturers have already created a marking rubric that will be used to award you a mark out of 50 as the report comprises 50 of the overall 100 marks available in this course.
The rubric is reproduced over the page and will be used as a way of providing feedback to you on how you performed.
The most important thing about the rubric is that it DEFINES what you will be marked on. If you include additional material that is not mentioned in the rubric it will not attract any marks, if you forget to write about something listed in the rubric, you’ll lose marks.
So the rubric is like a “contract” between you and your lecturer. Following the rubric clearly is your best strategy for a good result
THE TASK
1. Explore the Central Michigan University competencies model (5 clusters eg. Self-Management, Leading others, Task management, Innovation and Social Responsibility)
2. Identify your current strengths and weaknesses as a leader (or potential leader) within the context of the CMU (eg. Create a clear vision of yourself in approx. 5-10 years time – only then will you be able to identify your strengths and weaknesses)
3. Review the leadership theories explored in this course and describe how they relate to you and your leadership development (again in the context of the CMU model eg. Blake and Mouton model grid)
4. Create a leadership development plan (*Starting point – Acti.
Assessment Task 1 Leadership Development ReportThis assessmen.docxfredharris32
Assessment Task 1: Leadership Development Report
This assessment task is a REPORT.
This requires you to use a particular style of writing which involves both the way the report is structured and the way that you acknowledge other people’s ideas used in your work.
Your second step should be mastering the art of referencing. There are many styles of referencing in use in different disciplines and geographical locations.
HARVARD REFERENCING is required.
Remember: this current assessment task is a REPORT not an ESSAY.
The critical thinking element
We want you to be very comfortable with questioning everything you read and hear.
Anyone can remember facts and state other people’s views but a far more useful skill is to critically review what you read and hear and decide for yourself how reliable, accurate, applicable, contemporary, objective and fair it is.
In this report, your assessor will value the fact that you are able to see both benefits and deficiencies in a particular theory. Make sure you look through the critical thinking exercises in the course site to get a clear understanding of critical thinking!
How many references should I cite?
There is no right answer to this question because it all depends on what you write in your report. Some statements you make in your report will certainly need a reference to support them.
So, to determine how many references you need to cite, first (as described in the report writing tutorial) draw a mind map of ideas to go into your report and for each idea try to link it to a reference source.
How will the report be marked?
Your lecturers have already created a marking rubric that will be used to award you a mark out of 50 as the report comprises 50 of the overall 100 marks available in this course.
The rubric is reproduced over the page and will be used as a way of providing feedback to you on how you performed.
The most important thing about the rubric is that it DEFINES what you will be marked on. If you include additional material that is not mentioned in the rubric it will not attract any marks, if you forget to write about something listed in the rubric, you’ll lose marks.
So the rubric is like a “contract” between you and your lecturer. Following the rubric clearly is your best strategy for a good result
THE TASK
1. Explore the Central Michigan University competencies model (5 clusters eg. Self-Management, Leading others, Task management, Innovation and Social Responsibility)
2. Identify your current strengths and weaknesses as a leader (or potential leader) within the context of the CMU (eg. Create a clear vision of yourself in approx. 5-10 years time – only then will you be able to identify your strengths and weaknesses)
3. Review the leadership theories explored in this course and describe how they relate to you and your leadership development (again in the context of the CMU model eg. Blake and Mouton model grid)
4. Create a leadership development plan (*Starting point – Acti ...
Page 1 of 8
School of Management
—
BUSM4551 CID/Innovation Management
Assessment 3: Reflective piece
Assessment type: Essay Word limit: 1,000 (+/- 10%)
The word count excludes
the cover page, reference
list, and any appendices
that you may wish to
include.
Due Date: On or before Monday of Week 13 @
23:59 (Singapore time)
Weighting: 20%
Overview
You are required to engage in creative writing of a reflective essay consisting of an academic
analysis of your own learning experiences through self-reflection.
The purpose of writing a reflective essay is to provide you with a platform to not only recount a
particular life experience, but to also explore how you have changed or learned from those
experiences. Essays should be authored individually; all ideas and words should be your own.
Assessment criteria (100 marks equate to 20% of overall course assessment)
This assessment will measure your ability to:
• Introduce the context, background, scope and purpose of your essay (10 marks)
• Provide a quality encounter of your learning (15 marks)
• Reflect at a level that reveals deep insights (20 marks)
• Evaluate the significance and impact of your learning (20 marks)
• Implicate the significance of your learning to your future career (15 marks)
• Draw a meaningful conclusion (10 marks)
• Professionally present your encounter (10 marks)
Learning outcomes
Course Learning Outcomes related to this assessment are:
Page 2 of 8
CLO1 Explain the relationship between creativity, innovation and entrepreneurship and how
it impacts business growth, sustainability and wealth creation
CLO2
Investigate factors that inhibit creativity in individuals and innovation within teams and
organisations, and recommend strategies and tactics to encourage entrepreneurial
behaviour
CLO3 Identify and critique organisational models of innovation management
CLO4 Work individually, and collaboratively with others in applying a range of tools that assist
the creative front end of innovation that leads to problem solving
CLO5 Evaluate the characteristics that make innovative organisations successful and discuss
how a business might emulate these traits
CLO6 Demonstrate learning through presentation and communication skills in a variety of
business and professional contexts
The Program Learning Outcomes related to this assessment are:
PLO1 Explain their role as a local, national and global citizen and be able to apply these
perspectives in business contexts.
PLO4
Reflect on and continuously progress their own professional development, enhancing
their intellectual agility and adaptability as tools for success in ever-changing business
contexts.
Assessment details
This assessment requires you to look back on your learning and experiences in this course and
provide a personal reflection of what you learned from the course and how you have both used and
will use this learning in the futu ...
Assignment 1 Information InterviewsInstructionsInformationa.docxtrippettjettie
Assignment 1: Information Interviews
Instructions
Informational Interview (20%), due July 16th.
The information Interviews =two separate interviews: the first involves meeting and interviewing an entrepreneur or business ownerto gather information as to their business experience, strategy, and operations.
The second consists of interviewing a commercial banker or other financial professional, to obtain information
as to the bank loan requirement and approval process, and/or investment requirements and strategy, as well as critical factors needed for a banker or investor presentable business plan.
You should not wait until the due date to prepare, as meetings may be difficult to arrange at short notice. While face-to-face interviews are preferable, if your work schedule inhibits such preparation, you may conduct the interviews by telephone or via online/e-mail format.
Required Elements to include in the Informational Interview Write Up:
Students are responsible for developing questions that will garner the responses necessary to address the key elements of the assignment.
Include all of the following elements in your interview report:
· Provide a brief description of the business which includes the business form the nature of the business, how many years in business, and whether the business is local in nature, national, or international in scope;
· Why did the person decide to go into business, and what was the biggest obstacle they had to overcome in the early stages of the business;
· Did the owner develop a Business Plan before starting the business, why or why not;
· Discuss what makes the business unique and different from its competition and what is its value proposition;
· Does the company have a clearly defined strategy, what do you believe it is;
· Discuss the owners marketing and sales strategy for gaining and maintaining new business opportunities;
· What core business functions if any did the business decide to outsource and why;
· Discuss the hiring process and the core values that have been established for the organization;
· Discuss the financial management tools and metrics that the business owner depends on too manage growth and profitability;
· Discuss keys to success, from the owner's perspective;
· What the person would do differently if he/she had it to do all over again.
· Critically assess the current status of the business based on concepts presented in class. What would you say is the future for this business? Would you invest in this business? Why or why not?
· Interview questions must be included as an addendum to the assignment; however, these should not be counted toward the length requirement of the paper.
·
For the financial report, consisting of an interview with a commercial banker, investor, or financial professional, the content should include discussing the loan origination and approval process if interviewing a banker, or the investor analysis, decision making, and due diligence process if inte ...
Fiinal Project (35)In the final project, the saga of Joseph.docxMalikPinckney86
Fiinal Project (35%)
In the final project, the saga of Joseph Dunn’s leadership at Dunn’s Ski Emporium and The Deli continues. Students will analyze a case study and then write a consultancy report applying concepts and ideas learned throughout the course.
Students are expected to effectively use a wide range of the course readings in completing the paper, which means the course readings are used to support ideas and reasoning rather than as stand-alone statements.
Note: A report is not written like a paper. Please use the
Outline for the Consultancy Report
The purpose of this project is two-fold. First, students will learn how to write a consultancy report and second, students will link the concepts of Dunn as a social architect, change agent, and individual to Dunn as a relationship builder. Think of a relationship builder as a leader who aligns people to his or her vision.
Students will act as a consultant hired to help Dunn address his role as a relationship builder. Interface the plan you created in Assignment #1- The Role of a Leader, with a plan for Dunn’s need to address the potential threats to workforce harmony. Emphasize his role as leader and what he can do to build his relationship with his employees so that he empowers his managers and workforce to implement his vision for the company.
Students are expected to be realistic in applying the concepts from the course to expand Dunn’s environment and leadership role.
Remember that in order to determine strategic direction, the leader must look inward, outward, forward and beyond.
In writing this paper, it is necessary to perform an analysis in terms of
how and why
Dunn will take a certain course of action related to the questions below. Students are not covering the topics superficially but are required to use the course readings to explain the detail:
Students will create a Consultancy Report:
Using the leadership plan (Paper #1); explain all the changes that Dunn might consider in keeping his business expansion going strong;
Discuss how Dunn should address cultural diversity within the organization;
Examine and explain the areas in the original plan that would require change to accommodate Dunn’s role as a relationship builder;
Discuss the leadership challenges that Dunn himself must address in the areas of personal skills, leading change, diversity, knowledge management, office politics and empowerment;
Discuss how Dunn can use John’s knowledge of The Deli business to his advantage.
Required Formatting of the Consultancy Report:
This report can be single spaced with double space between paragraph;
Use 12-point font, and six to eight pages in length;
Use headings such as those provided in the Outline for the Consultancy Report;
Writing is expected to be clear and concise;
Write in the third person;
Outside resources may be used but the majority of the support will come from the course readings with a wide array of readings used;
Use APA formatting for i.
APUS Assignment Rubric Undergraduate Level
EXEMPLARY
LEVEL
4
ACCOMPLISHED
LEVEL
3
DEVELOPING
LEVEL
2
BEGINNING
LEVEL
1
POINTS
FOCUS/THESIS
Student exhibits a clear understanding of the assignment. Work is clearly defined to help guide the reader throughout the assignment. Student builds upon the assignment with well-documented and exceptional supporting facts, figures, and/or statements.
Establishes a good comprehension of topic and in the building of the thesis. Student demonstrates an effective presentation of thesis, with most support statements helping to support the key focus of assignment
Student exhibits a basic understanding of the intended assignment, but the formatting and grammar is not supported throughout the assignment. The reader may have some difficulty in seeing linkages between thoughts. Student has limited the quality of the assignment.
Exhibits a limited understanding of the assignment. Reader is unable to follow the logic used for the thesis and development of key themes. Assignment instructions were not followed. Student’s writing is weak in the inclusion of supporting facts or statements. Paper includes more than 25% quotes, which renders it unoriginal.
4
SUBJECT KNOWLEDGE
Student demonstrates proficient command of the subject matter in the assignment. Assignment shows an impressive level of depth of student’s ability to relate course content to practical examples and applications. Student provides comprehensive analysis of details, facts, and concepts in a logical sequence.
Student exhibits above average usage of subject matter in assignment. Student provides above average ability in relating course content in examples given. Details and facts presented provide an adequate presentation of student’s current level of subject matter knowledge.
The assignment reveals that the student has a general, fundamental understanding of the course material. Whereas, there are areas of some concerning in the linkages provided between facts and supporting statements. Student generally explains concepts, but only meets the minimum requirements in this area.
Student tries to explain some concepts, but overlooks critical details. Assignment appears vague or incomplete in various segments. Student presents concepts in isolation, and does not perceive to have a logical sequencing of ideas.
4
CRITICAL THINKING
Student demonstrates a higher-level of critical thinking necessary for undergraduate level work. Learner provides a strategic approach in presenting examples of problem solving or critical thinking, while drawing logical conclusions which are not immediately obvious. Student provides well-supported ideas and reflection with a variety of current and/or world views in the assignment
Student exhibits a good command of critical thinking skills in the presentation of material and supporting statements. Assignment demonstrates the student’s above average use of relating concepts by using a variety of factors. Overall, student provides ade.
APUS Assignment Rubric Undergraduate Level
EXEMPLARY
LEVEL
4
ACCOMPLISHED
LEVEL
3
DEVELOPING
LEVEL
2
BEGINNING
LEVEL
1
POINTS
FOCUS/THESIS
Student exhibits a clear understanding of the assignment. Work is clearly defined to help guide the reader throughout the assignment. Student builds upon the assignment with well-documented and exceptional supporting facts, figures, and/or statements.
Establishes a good comprehension of topic and in the building of the thesis. Student demonstrates an effective presentation of thesis, with most support statements helping to support the key focus of assignment
Student exhibits a basic understanding of the intended assignment, but the formatting and grammar is not supported throughout the assignment. The reader may have some difficulty in seeing linkages between thoughts. Student has limited the quality of the assignment.
Exhibits a limited understanding of the assignment. Reader is unable to follow the logic used for the thesis and development of key themes. Assignment instructions were not followed. Student’s writing is weak in the inclusion of supporting facts or statements. Paper includes more than 25% quotes, which renders it unoriginal.
4
SUBJECT KNOWLEDGE
Student demonstrates proficient command of the subject matter in the assignment. Assignment shows an impressive level of depth of student’s ability to relate course content to practical examples and applications. Student provides comprehensive analysis of details, facts, and concepts in a logical sequence.
Student exhibits above average usage of subject matter in assignment. Student provides above average ability in relating course content in examples given. Details and facts presented provide an adequate presentation of student’s current level of subject matter knowledge.
The assignment reveals that the student has a general, fundamental understanding of the course material. Whereas, there are areas of some concerning in the linkages provided between facts and supporting statements. Student generally explains concepts, but only meets the minimum requirements in this area.
Student tries to explain some concepts, but overlooks critical details. Assignment appears vague or incomplete in various segments. Student presents concepts in isolation, and does not perceive to have a logical sequencing of ideas.
4
CRITICAL THINKING
Student demonstrates a higher-level of critical thinking necessary for undergraduate level work. Learner provides a strategic approach in presenting examples of problem solving or critical thinking, while drawing logical conclusions which are not immediately obvious. Student provides well-supported ideas and reflection with a variety of current and/or world views in the assignment
Student exhibits a good command of critical thinking skills in the presentation of material and supporting statements. Assignment demonstrates the student’s above average use of relating concepts by using a variety of factors. Overall, student provides ade.
Assignment 2 Audit Planning and ControlDue Week 8 and worth 280.docxsherni1
Assignment 2: Audit Planning and Control
Due Week 8 and worth 280 points
It is common industry knowledge that an audit plan provides the specific guidelines auditors must follow when conducting an external audit. External public accounting firms conduct external audits to ensure outside stakeholders that the company’s financial statements are prepared in accordance with generally accepted accounting principles (GAAP) or International Financial Reporting Standards (IFRS) standards.
Use the Internet to select a public accounting company that appeals to you. Imagine that you are a senior partner in a public accounting firm hired to complete an audit for the chosen public company.
Write a four to six (4-6) page paper in which you:
1. Outline the critical steps inherent in planning an audit and designing an effective audit program. Based upon the type of company selected, provide specific details of the actions that the company should undertake during planning and designing the audit program.
1. Examine at least two (2) performance ratios that you would use in order to determine which analytical tests to perform. Identify the accounts that you would test, and select at least three (3) analytical procedures that you would use in your audit.
1. Analyze the balance sheet and income statement of the company that you have selected, and outline your method for evidence collection which should include, but not be limited to, the type of evidence to collect and the manner in which you would determine the sufficiency of the evidence.
1. Discuss the audit risk model, and ascertain which sampling or non-sampling techniques you would use in order to establish your preliminary judgment about materiality. Justify your response.
1. Assuming that the end result is an unqualified audit report, outline the primary responsibilities of the audit firm after it issues the report in question.
1. Use at least two (2) quality academic resources in this assignment. Note: Wikipedia and other Websites do not qualify as academic resources.
Your assignment must follow these formatting requirements:
1. Be typed, double spaced, using Times New Roman font (size 12), with one-inch margins on all sides; citations and references must follow APA or school-specific format. Check with your professor for any additional instructions.
1. Include a cover page containing the title of the assignment, the student’s name, the professor’s name, the course title, and the date. The cover page and the reference page are not included in the required assignment page length.
The specific course learning outcomes associated with this assignment are:
1. Plan and design a generalized audit program.
1. Determine the nature and extent of evidence accumulated to conduct an audit after considering the unique circumstances of an engagement.
1. Evaluate a company’s various risk factors and the related impact to the audit process.
1. Evaluate effective internal controls that minimize audit risk and pote ...
Please use the grading rubric to create an outline of your assig.docxblazelaj2
Please use the grading rubric to create an outline of your assignment. Each section of the rubric should be a section of your final paper and could become the headings. Your assignment will be graded based on each element of the rubric. Compare each section of your paper with the rubric to ensure all elements are covered. Then, include an introduction and conclusion to tie the paper together. If you have any questions regarding the assignment please contact your instructor using the Course Help forum.
As a nursing leader you will have the opportunity to implement many proposals. This is an exercise to help you learn the processes or steps you will need for implementation. Utilizing assignment one choose one of the program outcomes and develop a quality assurance/capstone project that you believe would be beneficial to your area of employment, or the profession of nursing in general.
Topic: Enhance professional nursing practice through the use of research and evidence-based practice, a quality assurance project that will benefit emergency room care.
In assignment 2 you will address the following points.
the capstone project topic.
review of the literature to validate the importance of the project.
Location for the proposed plan
three outcomes you plan to achieve.
how the project will impact your workplace and your institution
how the project will impact your nursing practice, your workplace and nursing as a profession
However, please note that there is no expectation that you will implement this plan. If you are using a plan from a previous course, you must make significant changes to your paper or cite yourself. Using previously graded work is self-plagiarism.
Grading Rubric
Competency
20 points
12 points
7 points
0 points
Total Points
Develops a well-organized discussion of the capstone project and reviews the literature to support the validity of the project.
Develops a well-organized discussion of the capstone project and reviews the literature to support the validity of the project.
Discussion of capstone project minimally describes the importance of the project and/or literature does not support the validity of the project
Discussion of capstone project is poorly stated and/or the literature review is missing or poorly supports the validity of the project.
No paper submitted or content missing.
/20
Provides a detailed summary of the location and key players (stakeholders) necessary for success of the project.
Provides a detailed summary of the location and key players (stakeholders) necessary for success of the project.
Provides a summary and discussion of the location as well as key players for the project but content is missing or not in-depth enough
Provides vague and poorly presented discussion of the location and key stakeholders for the project and/or content is missing
Does not describes the proposed plan or no paper .
FINC20018 Managerial Finance T1 2019
Assessment 2 – Practical and Written Assessment
Group Assignment
Due date: Week 10, Friday 24 May 2019 @ 11:55pm
Weighting: 30%
Group formation
For on-campus students, the group means 2 students per group.
For distant learning (FLEX) students, while a group of 1 is likely to be more practical groups of 2 are
optional.
The task
The assignment is designed to assess your understanding of business finance theories and explores a
number of areas within the course by applying your learning to a real company. Through this project,
you need to be able to demonstrate critical and analytical skills in academic writing, various research
synthesising skills and be able to communicate clearly and effectively.
Please note this is a finance assignment for real business, so make sure you have the appropriate
combination of quantitative and qualitative analysis.
Format and referencing
Response to case study must be in Report Format and include an executive summary, table of
contents, introduction, body with suitable headings and sub-headings, conclusion and wide variety of
references.
Report fonts must be either Arial or Times Roman 12 pt and 1.5 spacing for narrative, 16 pt bold for
major headings and 14 pt bold for sub-headings.
Word count is 2,000 words maximum (excluding tables, formulae, reference list and appendices)
Inclusion of diagrams and tables to support the response is strongly encouraged.
Proper referencing of all content including figures, tables and narrative using APA Reference system.
Demonstrations of using your initiative and supporting your answers with interesting references to
contemporary issues from newspapers, journals, professional publications, web resources i.e. extracts
from podcasts, financial institutional websites etc. Wikipedia and Investopedia are not recommended
to be used as sources.
Submission method
Online submission, must be submitted as a word document. PDF submissions will not be accepted.
For on-campus students this is a group assignment, only one member of the group will submit the
assignment online by uploading to the Moodle (DO NOT use turnitin to check similarity for the
draft work, and the second person in the group submit the final assignment - this will result in
a very high similarity score and penalty will apply)
Issues that will affect your marks include:
Create your own cover sheet with the names of the students in the group clearly indicated.
Do not include the marking criteria or rubrics or marking sheet in your assessment. Your grader will
include a separate feedback and marking sheet after they have graded your assessment in Moodle.
The word limit is approx 2000 words in total, 5% leeway above or below is acceptable, if you exceed
the word limit significantly marks will be deducted.
Turnitin will be used to check percent.
Directions essay 3 Write a post-session summary based on the com.docxmariona83
Directions essay 3
Write a post-session summary based on the completed experience. Include the following:
1. Explain the two learning disciplines that you examined for this assessment: team learning and systems thinking.
2. Team exercise plan:
. Outline the schedule for your team development session. Include the job titles or roles of the team members participating in the session. List the scheduled meeting date and time.
. Describe the problem or issue you chose as the intended purpose for your team development session.
. Identify the learning discipline that you chose to focus on for your team exercise. Explain the process used to select that learning discipline, the rationale for its selection, and the team development exercise that you used with your team.
· Post-session summary:
. Describe your team development experience in a narrative format.
. Explain the successful and unsuccessful aspects of the team development exercise.
. Explain the lessons learned for team facilitation, including both planned and unplanned journeys that resulted.
. Explain the lessons learned for your chosen discipline, and its potential for helping a group examine itself, choose new direction, and commit to that direction.
DDDEEEHHH 111888000000 DDDeeennntttaaalll HHHyyygggiii eeennn eee 111
Informative Poster Research Paper Peer Evaluation Form
At the conclusion of each group project, please rate yourself and your team colleagues on regarding the relative
contributions that were made in preparing, submitting, and presenting your group project. Please be honest,
objective, constructive, and fair in your evaluation of yourself and your colleagues. Your ratings will not be
disclosed to other students. In rating yourself and your peers, using the following five-point scale, where:
5 = Always 4 = Most of the time 3 = Sometimes 2 = Seldom 1 = Never
Project or Paper Title: _________________________________________________________________
*Insert YOUR NAME IN THE FIRST COLUMN and those of your peers’ in the other spaces. (One name at the top of each column).
Names __________ __________ __________ __________ __________
Participated in discussions or
meetings
Contributed thoughtful research
germane to topic
Helped keep the group on the
task
Contributed useful ideas
Quantity of work done
Quality of work done
Shared equally in the work
Cooperated with colleagues
Made fair, considered decisions
re: direction of project and work
Deliverables on time, as promised
= = = = =
Total Score
Please take a moment to reflect, and answer the following questions.
1. Would you want to work with this group again? Why or why not?
2. In one sentence each; describe each team member’s contribution toward the project reaching completion?
Dental Hygiene 1 Informative Poster Research Paper Rubric for Evaluation (100 points poss.)
Qualities and C.
1
BUSS215 – Management Principles
Portfolio Project Directions and Rubric
This Assessment is worth 20% of your grade.
Completing this Assessment will help you to:
Course Outcomes:
• Explain various motivational techniques and rewards designed to improve employee
satisfaction.
• Apply the five primary functions of management; staffing, planning, organizing,
controlling and leading.
• Develop and demonstrate an understanding of how strategic planning meets the
organizational and departmental business objectives.
• Create and present a research paper that includes the basic functions of management that
defends your management and leadership decision-making process using Multimedia.
Program Outcomes:
• Recognize management and leadership skills.
• Identify and apply the basice functions of management such as staffing, planning,
organizing, controlling, and leading to the decision-making process.
Institutional Outcomes:
• Information Literacy and Communication - Utilize apporopriate current technology
and resources to locate and evaluate information needed to accomplish a goal, and then
communicate findings in visual, written and/or oral formats.
• Relational Learning - Transfer knowledge, skills and behaviors acquired through formal
and informal learning and life experiences to new situations.
• Community and Career - Participate in social, learning, and professional communities
for personal and career growth.
Deadlines
Timeline Activity Grading
Due Week 6 by Wednesday
at 11:59 pm, ET.
Submit your rough draft for
peer review.
This will count for 20% of
your overall Portfolio
Project grade.
Due Week 7 by Saturday at
11:59 pm, ET.
Upload your Portfolio Project to
Upload to your ePortfolio.
This will count for 80% of
your overall Portfolio
Project grade.
BUSS215 – Portfolio Project 2
Directions:
You will have the opportunity to write a Portfolio Project in which you explore a business
concept that is interesting to you and relate the ideas covered in this course which you may then
connect to your life and your future career interests.
Using your information literacy skills, you will research the information necessary to write your
Portfolio Project on a concept in business that we have covered in this course (please see below
for the approved topic list). The main objective of this Portfolio Project is to explore a business
concept, summarize the concept, and analyze the main points of experts in the field. In the
project you will provide a summary of the topic along with how it relates to what you have
learned in this course as well as to your role as a professional.
It is an expectation for this course that all written projects will follow the standards for fair use of
information, including the avoidance of all intentional and unintentional plagiarism, and
incorporating appropriate usage according to the conventions of the APA citatio ...
BUSM 4194 Leading for ChangeSemester 1, 2014Assessment Tas.docxhumphrieskalyn
BUSM 4194 Leading for Change
Semester 1, 2014
Assessment Task 1: Leadership Development Report
Writing instructions and Marking Rubric
This assessment task is a REPORT.
The RMIT College of Business requires you to use a particular style of writing which involves both the way the report is structured and the way that you acknowledge other people’s ideas used in your work.
The structuring of a report is very clearly described in the RMIT Study and Learning Centre Report Writing Skills Online Tutorial available on the BUSM4194 course Blackboard site
Your first step in preparing for this assessment task should be to complete this tutorial.
Investing time before you start writing will result in a better report.
Your second step should be mastering the art of referencing. There are many styles of referencing in use in different disciplines and geographical locations. You are required to use the RMIT Business Referencing System. This is available to you via the Library website, in your course site on myRMIT and is uploaded to the assessments folder in the BUSM 4194 course site. This is a 50 page document but reading it through will be enormously helpful for you in this and future assessment tasks.
Make sure that you can clearly distinguish the difference between an essay (page 28 of the document) and a report (page 36).
Remember: this current assessment task is a REPORT not an ESSAY.
The critical thinking element
We want you to be very comfortable with questioning everything you read and hear.
Anyone can remember facts and state other people’s views but a far more useful skill is to critically review what you read and hear and decide for yourself how reliable, accurate, applicable, contemporary, objective and fair it is.
In this report, your assessor will value the fact that you are able to see both benefits and deficiencies in a particular theory. Make sure you look through the critical thinking exercises in the course site to get a clear understanding of critical thinking!
How many references should I cite?
There is no right answer to this question because it all depends on what you write in your report. Some statements you make in your report will certainly need a reference to support them.
So, to determine how many references you need to cite, first (as described in the report writing tutorial) draw a mind map of ideas to go into your report and for each idea try to link it to a reference source.
How will the report be marked?
Your lecturers have already created a marking rubric that will be used to award you a mark out of 50 as the report comprises 50 of the overall 100 marks available in this course.
The rubric is reproduced over the page and will be used as a way of providing feedback to you on how you performed.
The most important thing about the rubric is that it DEFINES what you will be marked on. If you include additional material that is not mentioned in the rubric it will not attract any marks, if you forget to w ...
HOLMES INSTITUTE FACULTY OF HIGHER EDUCATION .docxShiraPrater50
HOLMES INSTITUTE
FACULTY OF
HIGHER EDUCATION
INSERT UNIT CODE & NAME AND ASSIGNMENT NAME
Assessment Details and Submission Guidelines
Trimester T2 2019
Unit Code HC1010
Unit Title Accounting for Business
Assessment Type Individual Assignment
Assessment Title Accounting for business decisions
Purpose of the
assessment (with ULO
Mapping)
Students are required to apply knowledge learned in class and perform independent
research of the key topics.
Learning Outcomes:
• Familiar with and readily able to access (refer to) and integrate across:
o The social role and purpose of accounting
o The accounting equation and how it shapes the financial statements
o General Purpose Financial Statements
o Special Purpose Financial Statements
• Understand how to analyse and interpret financial ratios from GPFS
• Obtain and contextualise business information for business accounting to explain
and apply to business decisions
• Demonstrate the ability to apply, analyse, synthesise and evaluate information
from multiple sources to make decisions about the financial performance of entities
including assets, liabilities, owner’s equity, revenue and expenses
• Apply concepts and theories discussed on a weekly basis
• Use transaction data and financial statement analysis for data-driven decision-
making
• Demonstrate the ability to communicate accounting information writing to a
professional standard
Weight 20% of the total assessments
Total Marks 20 marks
Word limit 1000 words
Due Date 11.59pm Friday, Week 8 (This due date is only for Block mode 1, i.e., Week 1-5 & 12
class)
Submission
Guidelines
• All work must be submitted on Blackboard by the due date along with a completed
Assignment Cover Page.
• The assignment must be in MS Word format, single spacing, 12-pt Arial font and 2
cm margins on all four sides of your page with appropriate section headings and
page numbers.
• Reference sources must be cited in the text of the report and listed appropriately at
the end in a reference list using Harvard referencing style.
HOLMES INSTITUTE
FACULTY OF
HIGHER EDUCATION
Page 2 of 6
HC1010 Accounting for Business
HC1010 Assignment Specifications
Purpose:
This assignment aims to reinforce and extend students’ knowledge and understanding of key topics in this
course (HC1010) including: Overview of Accounting, Organisational Structure & the Reporting Environment,
Statement of Financial Position, Statement of Financial Performance, Cash Flow Statement, Financial
Statement Analysis, Accounting for Business Transactions, Cost Concepts & Behaviour, Preparation of Budgets,
and Cost-Volume-Profit-Analysis through independent research and application of knowledge and skills.
Assignment details:
Your friend Tim is from Darwin and he wants to start a business of his own. He is thinking of buying a
delicatessen in Sydney. The shop has been there for several ...
How to develop and create a Domain Model1. Primary list of obj.docxpooleavelina
How to develop and create a Domain Model
1. Primary list of objects:
Faculty
Students
Projects
Class
Administrator
Login Level
Department
Courses
rubric
self-assessment
peer-assessment
feedback
Reports
Average
Team
individual
Comments
2. Eliminates duplicated and unnecessary items
a. Classes vs courses
b. Feedback vs comments
c. Team vs Students
3. Create a domain model and only group classes having aggregation relationship.
4. Identify further domain objects that weren’t in the requirements
5. Building generalization relationships in the domain model.
PADM 501
Essay Rubric
Criteria
Levels of Achievement
Content
(70%)
Advanced
92-100%
Proficient
84-91%
Developing
1-83%
Not Present
Total
Research Purpose
32.5 to 35.0 Points:
The essay question is clearly identified and retains focus throughout the paper. Introduction provides sufficient background on the topic and previews major points. All necessary aspects of the assignment described in the instructions are clearly identifiable. Organization emphasizes the central theme or purpose.
Grading feedback and lessons from applicable modules/weeks are fully addressed/incorporated.
29.5 to 32.0 Points:
The essay question may require some clarification and/or greater prominence throughout the paper. Introduction may not provide adequate background on the topic and preview major points. Most necessary aspects of the assignment described in the instructions are clearly identifiable and sufficiently addressed. Organization may not sufficiently emphasize the central theme or purpose.
Grading feedback and lessons from applicable modules/weeks are generally addressed/ incorporated.
1.0 To 29.00 Points:
The research question requires significant clarification and prominence throughout the paper. Introduction may be missing or ambiguous. Some necessary aspects of the assignment described in the instructions are clearly identifiable, but others may require clarification or development. Organization may require significant improvement.
Grading feedback and lessons from applicable modules/weeks are insufficiently addressed/incorporated.
0 points
Not present
Reasoned Analysis
32.5 to 35.0 Points:
Major points are stated clearly and are supported by valid evidence and logical reasoning. Objective, reasoned analysis is employed. Opposing viewpoints are sufficiently acknowledged and critically evaluated. The conclusion logically derives from the paper’s ideas. An authoritative, persuasive, and statesmanlike voice is used (first/second person perspective avoided).
Grading feedback and lessons from applicable modules/weeks are fully addressed/incorporated.
29.5 to 32.0 Points:
Most major points are stated clearly and supported by valid evidence and logical reasoning, but some points may require clarification or greater support. Opposing viewpoints are acknowledged but may require greater evaluation. The conclusion does not fully derive from the paper’s ideas. Some improvements to objective t ...
College-Level Writing RUBRIC
C
ri
te
ri
a
Performance
Indicators
Target/
High Proficiency
15
Proficiency
12
Acceptable
9
Needs Improvement
6
Unacceptable
3
C
o
v
e
ra
g
e
&
O
rg
a
n
iz
a
ti
o
n
Content‐Specific
Assignment Criteriai
∙Writing meets all
assignment content
∙Writing meets most
assignment content
∙Writing meets minimum
assignment content
∙Writing meets
some/few assignment
∙Writing does not
meet assignment
as per Instructor
Guidelines
requirements. requirements. requirements. content requirements. content
requirements.
∙Writing is clear and ∙Writing is generally clear and ∙Writing is adequate in ∙Writing may be unclear ∙Writing is
appropriate for the appropriate for the purpose of terms of clarity and and/or inappropriate unclear and
Purpose purpose of the the assignment—with some appropriateness for the for the purpose of the inappropriate for
& assignment. exceptions. purpose of the assignment. the purpose of
Support ∙All evidence and ∙Evidence and examples are assignment. ∙Evidence and examples the assignment.
examples are generally effective, specific ∙Evidence and examples may require further ∙Evidence and
effective, specific and and relevant—with some meet basic requirements development to be examples are not
relevant. exceptions. for being effective, adequately effective, effective, specific
specific and relevant. specific and relevant. and/or relevant.
∙Ideas are coherently ∙Organization of ideas is ∙Organization of ideas ∙Organization of ideas ∙Ideas are
and logically generally coherent and logical. meets the minimum does not meet the incoherent and
Structure & organized with well‐ ∙In addition, most paragraphs requirement for being minimum requirement illogically
Development developed paragraphs are well‐developed and use coherent and logical. for coherent and logical. organized.
and effective effective transitions. ∙Some paragraphs may ∙Paragraphs lack ∙Paragraphs are
transitions. be well‐developed and development and/or fail undeveloped
use effective transitions to employ transitions and need
while others do not. effectively. transitions.
∙All sources are
critically reviewediii,
∙Most sources are critically
reviewed and documented
∙Sources meet the
minimum requirements
∙Sources do not meet
the minimum
∙Insufficient
sources and/or
Documentation of documented and following standard practices of for being critically requirements for being insufficient
Sources formatted following the field (APA, MLA, Turabian, reviewed and critically reviewed and quality, critical
standard practices of CMS, etc.). documented following documented following review and
the field (APA, MLA, standard practices of the standard practices of documentation.
Turabian, CMS, etc.). field (APA, MLA, the field (APA, MLA, Standard
Turabian, CMS, etc.). Turabian, CMS, etc.). practices of the
field are not ...
Final Written Assignment 3InstructionsRequirements include,.docxhoundsomeminda
Final Written Assignment 3
Instructions
Requirements include,
Cover Page with Name, Date, and Title of Assignment
Use headings to separate the sections of the paper (use the Questions selected)
Page numbers
Double-spacing
Times New Roman, size 12
Use a minimum of four sources (from the past four years) for each response
In-text citations in APA style and 5 to 6 pages
Reference page using APA style
Select any four of these six topics for your Final Written Assignment:
1.
It has been said that "a company that deserves a union gets one," suggesting that if proper leadership and motivation techniques are employed and desirable policies devised, the workers will not want to unionize. Either agree or disagree with this philosophy. Support your position and explain what a company could do to create an environment where workers will not want to unionize.
2.
Some means of resolving negotiations impasses involve economic weapons (e.g. strikes and lockouts). There are other means of impasse resolution that do not involve the use of economic weapons (e.g. fact finding, mediation, med/arb/interest arb, etc.). Select two (2) non- economic means of impasse resolution, 1) explain how each one functions and 2) discuss the relative pros and cons of each.
3.
Unions have declined as a percentage of the workforce in the private sector. With this decline, have career and workplace dissatisfaction and alienation increased? If so, why is this so? If not, why not? Support your position.
4.
List and discuss some of the advantages and disadvantages in using seniority as a factor to determine shift preference or overtime assignments.
5.
Identify two different steps a company should take to prepare for its first round of bargaining with the union pre-negotiation activities. Explain why each of the steps you have identified is critical to achieving an initial successful collective bargaining agreement with the union.
6.
Identify and explain the major ways in which the government is an important participant in the labor relations.
RUBRIC FOR FINAL WRITTEN ASSIGNMENT 3
Criteria 1
Exceeds Expectations
5 points
Meets Expectations
4 points
Meets Some Expectations
3 points
Does Not Meet Expectations
2 points
Not Included
0 points
Organization
(maximum of 5 points)
Arranges ideas clearly and logically to support the purpose or argument; ideas flow smoothly and are effectively linked; reader can follow the line of reasoning
Arranges ideas adequately to support the purpose or argument; links between ideas are generally clear; reader can follow the line of reasoning for the most part
Arranges ideas adequately, in general, although ideas sometimes fail to make sense together; reader remains fairly clear about what writer intends
Arranges ideas illogically; ideas frequently fail to make sense together; reader cannot identify a line of reasoning and becomes frustrated or loses interest
Criteria 2
Exceeds Expectations
15 points
Meets Expectations
12 points
Meets.
Assignment Grading Rubric Course GB520 Unit 2 Po.docxrock73
Assignment Grading Rubric
Course: GB520 Unit: 2 Points: 100
Copyright Kaplan University
Assignment 2 Instructions
Review the SHRM case, “The Reyes Fitness Centers, Inc: The Strategic HR Opportunity.”
Prepare a 4–6 page case analysis on the topic of strategic management and why it is critical to the success of
an organization in meeting its goals and mission. In your analysis respond to the following question: What is
strategic management and why is it critical to the success of an organization in meeting its goals and mission?
Your analysis of this case and your written submission should reflect an understanding of the critical issues of
the case, integrating the material covered in the text, and present concise and well-reasoned justifications for
the stance that you take.
Case analysis criteria: Your case analysis should consist of:
• A brief analysis of the situation and pending decision problem, as presented in the case, and as
relevant to your answer. This should be exceptionally brief and you should assume the person reading
the Assignment is familiar with the details of the case.
• Identification of the major issues surrounding the organization or individuals involved with the
organization.
• Identification of alternate courses of action to address the issues identified.
• The decision or recommendation for action, with the appropriate supporting arguments.
• The case question is designed to guide the direction of your analysis in the case. Your analysis should
address and ultimately answer the question.
You may discuss your case analysis Assignment with the class, but you must submit your own original work.
Case analysis tips: Avoid common errors in case analyses, such as:
• Focusing too heavily on minor issues.
• Lamenting because of insufficient data in the case and ignoring creative alternatives.
• Rehashing of case data — you should assume the reader knows the case.
• Not appropriately evaluating the quality of the case's data.
• Obscuring the quantitative analysis or making it difficult to understand.
Typical “minus (–)” grades result from submissions that:
• Are late.
• Are not well integrated and lack clarity.
• Do not address timing issues.
• Do not recognize the cost implications or are not practical.
• Get carried away with personal biases and are not pertinent to the key issues.
• Are not thoroughly proofread and corrected.
Assignment submission: Before you submit your Assignment, you should save your work on your computer
in a location that you will remember. Save the document using the naming convention:
Username_Unit2_Assignment.doc.
http://extmedia.kaplan.edu/business/GB520/GB520_1505D/GB520_Unit02_Case_Study.pdf
Assignment Grading Rubric
Course: GB520 Unit: 2 Points: 100
Copyright Kaplan University
Make sure your document includes:
• Your name
• Date
• Course name and section number
• Unit number
• Case name
• Page numbers
The cas ...
Scoring Guide for Rhetorical Analysis (10 of grade; 100 po.docxaryan532920
Scoring Guide for Rhetorical Analysis (10% of grade; 100 points)
The scoring guide helps you and your instructor see some of the specific ways your writing is matching expectations. No rubric can encompass everything a piece of writing can or
needs to accomplish, so your instructor will comment both about and beyond these categories to help you understand how this piece of writing is effective and how it (or future pieces)
could be more effective. Your grade will be determined by your instructor’s overall evaluation of this piece of writing and the revision process it enjoyed, with the top three categories
carrying more weight than the bottom three. Note: If for any category, the piece does not meet “Developing” standards, your instructor will assign no credit for that category.
KHO/16
Categories Excellent (A) Effective (B) Adequate (C) Developing (D)
Invention and
Purpose
Provides exceptional detail, depth,
and clarity about the effects of one or
two specific elements (e.g., patterns,
rhetorical strategies, audience,
purpose); interesting, sophisticated
argument develops through the paper
Provides solid detail, depth, and clarity
about the the effects of one or two
specific elements (e.g., patterns,
rhetorical strategies, audience,
purpose); solid argument develops as
the paper progresses
Provides some detail and clarity about
the effects of one or two specific
elements (e.g., patterns, rhetorical
strategies, audience, author, purpose);
consistent argument
Provides little detail, depth, or clarity
about the effects of specific elements,
may attempt to discuss many
elements without depth; may use
terms inaccurately; confusing, vague,
or inconsistent argument
Arrangement
and Audience
Awareness
Arrangement enhances the central
idea; intro intrigues readers, provides
helpful context, and prepares readers
well; sophisticated transitions guide
readers; conclusion refines thesis,
provides a satisfying resolution
Arrangement supports the central idea
and its development; intro provides
context and prepares readers well;
effective transitions guide readers;
conclusion recasts thesis and provides
a satisfying resolution
Arrangement mostly supports the
central idea; intro provides limited
context or reader preparation;
transitions formulaic or not always
effective; conclusion merely repeats
thesis or provides little resolution
Arrangement doesn’t consistently
support the central idea; intro provides
little context or reader preparation;
transitions missing or ineffective;
relationship among ideas unclear;
conclusion off-topic or underdeveloped
Ethos and
Evidence
Evidence and overall content easily
convince the reader that the author is
credible and that the analysis is valid;
evidence fully supports or enhances
writer’s claims
Evidence and overall content convince
the reader that the author is credible
and that the analysis is valid; evidence
supports writ ...
CSIA 413 Cybersecurity Policy, Plans, and Programs.docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and Programs
June 2, 2019
Executive Summary
The Red Clay Renovations Employee Handbook is to give general rules about its strategies. The Employee Handbook will fill in as a guide for workers to get comfortable with Red Clay Renovations strategies for "Acceptable Use Policy for Information Technology", "Bring Your Own Device Policy " and "Digital Media Sanitization, Reuse, and Destruction Policy". Red Clay Renovations maintains whatever authority is needed to adjust the Employee Handbook to best suit the organization whenever with no earlier warning to its representatives.
Red Clay Renovations "Acceptable Use Policy for Information Technology" will characterize in subtleties what Acceptable Use is and what it's most certainly not. Every Employee will get his/her duty of the framework accounts, processing resources, organize utilization and will sign and consent to the approach before access is conceded to the system.
Red Clay Renovations "Bring Your Own Device Policy or BYOD" will name every one of the gadgets that are satisfactory as BYOD and the administration of the use of such gadgets. Every worker's gadgets must satisfy the arrangement guideline before actualizing the gadgets into Red Clay Renovation Company.
Red Clay Renovations "Digital Media Sanitization, Reuse, and Destruction Policy" will ensure that any worker of Red Clay Renovation who marked for the BYOD approach has/should sign this arrangement also. Workers need to comprehend the techniques the organization will use to clean off the BYOD.
Acceptable Use Policy
Introduction
This Acceptable Use Policy is for all Red Clay Renovation workers and supplants every single past version. All workers are liable to the terms and states of the Policy. The approach will build up satisfactory and inadmissible utilization of defending the security of information, secure and ensure PC and PCs, the use of system condition and servers, the utilization of electronic correspondences. Additionally Red Clay Renovation gathers, keeps up, and stores individual data to incorporate Mastercard’s, credit checks, building plans and illustrations, customers restorative and wellbeing information.
Red Clay Renovation must be in consistence with the accompanying: HIPPA Privacy and Security Rule, Freedom of Information Act (FOIA), PCI DSS, Privacy Act of 1977, Building Codes and Regulations. It is to the greatest advantage of the organization for all workers to comprehend the Acceptable Use Policy to settle on trustworthy choices before participating in inadmissible utilization of the approach. Any offense with the Acceptable Use Policy could conceivably cause Red Clay Renovation considerable loss of its business and its notorieties. On the off chance that any worker needs more data with this arrangement, they can reach out to the IT department directly.
Policy Content
Utilization of IT Systems
Red Clay Renovation possesses the property rights to all informati.
CSIS 100CSIS 100 - Discussion Board Topic #1One of the object.docxmydrynan
CSIS 100
CSIS 100 - Discussion Board Topic #1:
One of the objectives of this course is to enable students to differentiate between the disciplines of Information Systems, Information Technology, and Computer Science. Oftentimes, these areas overlap and are difficult to distinguish – even among professionals within the industries.
There are some distinctions that become evident, but all too frequently, people do not understand these distinctions until they are already deep within their programs of study. Consequently, many decide that it is too late to pursue a different avenue in the computing world without losing valuable time and money spent on courses that may or may not apply to a different major.
Given the importance of achieving effective planning from the beginning, your first assignment in this course is to delve into the broad areas of Information Systems, Information Technology, and Computer Science and write about your career choice in a discussion board post. This should be your thought process:
· First, define each field (i.e. IS, IT, CS). Understand the similarities and differences.
· Second, determine what jobs are available in each area.
· Third, look at the degree completion plans for each of these programs.
· Fourth, assess your own skills (e.g. Are you good in math? Do you like business? Do you like algorithms? Are you gifted at problem-solving? Do you like learning about new technology? Do you enjoy working hands-on with equipment/hardware/wires?)
· Fifth, (and most importantly) ask God what He wants you to pursue based on your talents, interests, and abilities.
· Sixth, based on your analysis above, what career do you hope to obtain after graduation, and what degree will you pursue to achieve this goal?
To facilitate your research, there are four videos in your Reading & Study folder that will help you understand the differences between the computing fields and become familiar with the job opportunities in each area. Be sure to view these videos first.
The LU Registrar’s home page has information on degree completion plans. Here is a link to all of the currently available ones in the university:
http://www.liberty.edu/academics/registrar/index.cfm?PID=2981
Be sure to look at all of the ones listed for Information Systems and Information Technology. At the time of this writing, Computer Science is only listed under residential degree plans. That does not mean that you should rule out Computer Science as a potential major. You must consider all options and listen to God’s calling upon your life. With God, all things are possible.
Discussion Board Deliverables
Main Post:
In a minimum of 300 words, create a thread in Module 1’s discussion board forum that describes the following:
1. Your desired career upon graduation
2. Why you chose this career
3. Your intended major
4. Your strengths, weaknesses, and interests
5. How the major supports your chosen career
6. How God has led you to reach your decision
7. A Bib.
More Related Content
Similar to Final Project (Week 8) In this paper, students w.docx
Assignment 1 Information InterviewsInstructionsInformationa.docxtrippettjettie
Assignment 1: Information Interviews
Instructions
Informational Interview (20%), due July 16th.
The information Interviews =two separate interviews: the first involves meeting and interviewing an entrepreneur or business ownerto gather information as to their business experience, strategy, and operations.
The second consists of interviewing a commercial banker or other financial professional, to obtain information
as to the bank loan requirement and approval process, and/or investment requirements and strategy, as well as critical factors needed for a banker or investor presentable business plan.
You should not wait until the due date to prepare, as meetings may be difficult to arrange at short notice. While face-to-face interviews are preferable, if your work schedule inhibits such preparation, you may conduct the interviews by telephone or via online/e-mail format.
Required Elements to include in the Informational Interview Write Up:
Students are responsible for developing questions that will garner the responses necessary to address the key elements of the assignment.
Include all of the following elements in your interview report:
· Provide a brief description of the business which includes the business form the nature of the business, how many years in business, and whether the business is local in nature, national, or international in scope;
· Why did the person decide to go into business, and what was the biggest obstacle they had to overcome in the early stages of the business;
· Did the owner develop a Business Plan before starting the business, why or why not;
· Discuss what makes the business unique and different from its competition and what is its value proposition;
· Does the company have a clearly defined strategy, what do you believe it is;
· Discuss the owners marketing and sales strategy for gaining and maintaining new business opportunities;
· What core business functions if any did the business decide to outsource and why;
· Discuss the hiring process and the core values that have been established for the organization;
· Discuss the financial management tools and metrics that the business owner depends on too manage growth and profitability;
· Discuss keys to success, from the owner's perspective;
· What the person would do differently if he/she had it to do all over again.
· Critically assess the current status of the business based on concepts presented in class. What would you say is the future for this business? Would you invest in this business? Why or why not?
· Interview questions must be included as an addendum to the assignment; however, these should not be counted toward the length requirement of the paper.
·
For the financial report, consisting of an interview with a commercial banker, investor, or financial professional, the content should include discussing the loan origination and approval process if interviewing a banker, or the investor analysis, decision making, and due diligence process if inte ...
Fiinal Project (35)In the final project, the saga of Joseph.docxMalikPinckney86
Fiinal Project (35%)
In the final project, the saga of Joseph Dunn’s leadership at Dunn’s Ski Emporium and The Deli continues. Students will analyze a case study and then write a consultancy report applying concepts and ideas learned throughout the course.
Students are expected to effectively use a wide range of the course readings in completing the paper, which means the course readings are used to support ideas and reasoning rather than as stand-alone statements.
Note: A report is not written like a paper. Please use the
Outline for the Consultancy Report
The purpose of this project is two-fold. First, students will learn how to write a consultancy report and second, students will link the concepts of Dunn as a social architect, change agent, and individual to Dunn as a relationship builder. Think of a relationship builder as a leader who aligns people to his or her vision.
Students will act as a consultant hired to help Dunn address his role as a relationship builder. Interface the plan you created in Assignment #1- The Role of a Leader, with a plan for Dunn’s need to address the potential threats to workforce harmony. Emphasize his role as leader and what he can do to build his relationship with his employees so that he empowers his managers and workforce to implement his vision for the company.
Students are expected to be realistic in applying the concepts from the course to expand Dunn’s environment and leadership role.
Remember that in order to determine strategic direction, the leader must look inward, outward, forward and beyond.
In writing this paper, it is necessary to perform an analysis in terms of
how and why
Dunn will take a certain course of action related to the questions below. Students are not covering the topics superficially but are required to use the course readings to explain the detail:
Students will create a Consultancy Report:
Using the leadership plan (Paper #1); explain all the changes that Dunn might consider in keeping his business expansion going strong;
Discuss how Dunn should address cultural diversity within the organization;
Examine and explain the areas in the original plan that would require change to accommodate Dunn’s role as a relationship builder;
Discuss the leadership challenges that Dunn himself must address in the areas of personal skills, leading change, diversity, knowledge management, office politics and empowerment;
Discuss how Dunn can use John’s knowledge of The Deli business to his advantage.
Required Formatting of the Consultancy Report:
This report can be single spaced with double space between paragraph;
Use 12-point font, and six to eight pages in length;
Use headings such as those provided in the Outline for the Consultancy Report;
Writing is expected to be clear and concise;
Write in the third person;
Outside resources may be used but the majority of the support will come from the course readings with a wide array of readings used;
Use APA formatting for i.
APUS Assignment Rubric Undergraduate Level
EXEMPLARY
LEVEL
4
ACCOMPLISHED
LEVEL
3
DEVELOPING
LEVEL
2
BEGINNING
LEVEL
1
POINTS
FOCUS/THESIS
Student exhibits a clear understanding of the assignment. Work is clearly defined to help guide the reader throughout the assignment. Student builds upon the assignment with well-documented and exceptional supporting facts, figures, and/or statements.
Establishes a good comprehension of topic and in the building of the thesis. Student demonstrates an effective presentation of thesis, with most support statements helping to support the key focus of assignment
Student exhibits a basic understanding of the intended assignment, but the formatting and grammar is not supported throughout the assignment. The reader may have some difficulty in seeing linkages between thoughts. Student has limited the quality of the assignment.
Exhibits a limited understanding of the assignment. Reader is unable to follow the logic used for the thesis and development of key themes. Assignment instructions were not followed. Student’s writing is weak in the inclusion of supporting facts or statements. Paper includes more than 25% quotes, which renders it unoriginal.
4
SUBJECT KNOWLEDGE
Student demonstrates proficient command of the subject matter in the assignment. Assignment shows an impressive level of depth of student’s ability to relate course content to practical examples and applications. Student provides comprehensive analysis of details, facts, and concepts in a logical sequence.
Student exhibits above average usage of subject matter in assignment. Student provides above average ability in relating course content in examples given. Details and facts presented provide an adequate presentation of student’s current level of subject matter knowledge.
The assignment reveals that the student has a general, fundamental understanding of the course material. Whereas, there are areas of some concerning in the linkages provided between facts and supporting statements. Student generally explains concepts, but only meets the minimum requirements in this area.
Student tries to explain some concepts, but overlooks critical details. Assignment appears vague or incomplete in various segments. Student presents concepts in isolation, and does not perceive to have a logical sequencing of ideas.
4
CRITICAL THINKING
Student demonstrates a higher-level of critical thinking necessary for undergraduate level work. Learner provides a strategic approach in presenting examples of problem solving or critical thinking, while drawing logical conclusions which are not immediately obvious. Student provides well-supported ideas and reflection with a variety of current and/or world views in the assignment
Student exhibits a good command of critical thinking skills in the presentation of material and supporting statements. Assignment demonstrates the student’s above average use of relating concepts by using a variety of factors. Overall, student provides ade.
APUS Assignment Rubric Undergraduate Level
EXEMPLARY
LEVEL
4
ACCOMPLISHED
LEVEL
3
DEVELOPING
LEVEL
2
BEGINNING
LEVEL
1
POINTS
FOCUS/THESIS
Student exhibits a clear understanding of the assignment. Work is clearly defined to help guide the reader throughout the assignment. Student builds upon the assignment with well-documented and exceptional supporting facts, figures, and/or statements.
Establishes a good comprehension of topic and in the building of the thesis. Student demonstrates an effective presentation of thesis, with most support statements helping to support the key focus of assignment
Student exhibits a basic understanding of the intended assignment, but the formatting and grammar is not supported throughout the assignment. The reader may have some difficulty in seeing linkages between thoughts. Student has limited the quality of the assignment.
Exhibits a limited understanding of the assignment. Reader is unable to follow the logic used for the thesis and development of key themes. Assignment instructions were not followed. Student’s writing is weak in the inclusion of supporting facts or statements. Paper includes more than 25% quotes, which renders it unoriginal.
4
SUBJECT KNOWLEDGE
Student demonstrates proficient command of the subject matter in the assignment. Assignment shows an impressive level of depth of student’s ability to relate course content to practical examples and applications. Student provides comprehensive analysis of details, facts, and concepts in a logical sequence.
Student exhibits above average usage of subject matter in assignment. Student provides above average ability in relating course content in examples given. Details and facts presented provide an adequate presentation of student’s current level of subject matter knowledge.
The assignment reveals that the student has a general, fundamental understanding of the course material. Whereas, there are areas of some concerning in the linkages provided between facts and supporting statements. Student generally explains concepts, but only meets the minimum requirements in this area.
Student tries to explain some concepts, but overlooks critical details. Assignment appears vague or incomplete in various segments. Student presents concepts in isolation, and does not perceive to have a logical sequencing of ideas.
4
CRITICAL THINKING
Student demonstrates a higher-level of critical thinking necessary for undergraduate level work. Learner provides a strategic approach in presenting examples of problem solving or critical thinking, while drawing logical conclusions which are not immediately obvious. Student provides well-supported ideas and reflection with a variety of current and/or world views in the assignment
Student exhibits a good command of critical thinking skills in the presentation of material and supporting statements. Assignment demonstrates the student’s above average use of relating concepts by using a variety of factors. Overall, student provides ade.
Assignment 2 Audit Planning and ControlDue Week 8 and worth 280.docxsherni1
Assignment 2: Audit Planning and Control
Due Week 8 and worth 280 points
It is common industry knowledge that an audit plan provides the specific guidelines auditors must follow when conducting an external audit. External public accounting firms conduct external audits to ensure outside stakeholders that the company’s financial statements are prepared in accordance with generally accepted accounting principles (GAAP) or International Financial Reporting Standards (IFRS) standards.
Use the Internet to select a public accounting company that appeals to you. Imagine that you are a senior partner in a public accounting firm hired to complete an audit for the chosen public company.
Write a four to six (4-6) page paper in which you:
1. Outline the critical steps inherent in planning an audit and designing an effective audit program. Based upon the type of company selected, provide specific details of the actions that the company should undertake during planning and designing the audit program.
1. Examine at least two (2) performance ratios that you would use in order to determine which analytical tests to perform. Identify the accounts that you would test, and select at least three (3) analytical procedures that you would use in your audit.
1. Analyze the balance sheet and income statement of the company that you have selected, and outline your method for evidence collection which should include, but not be limited to, the type of evidence to collect and the manner in which you would determine the sufficiency of the evidence.
1. Discuss the audit risk model, and ascertain which sampling or non-sampling techniques you would use in order to establish your preliminary judgment about materiality. Justify your response.
1. Assuming that the end result is an unqualified audit report, outline the primary responsibilities of the audit firm after it issues the report in question.
1. Use at least two (2) quality academic resources in this assignment. Note: Wikipedia and other Websites do not qualify as academic resources.
Your assignment must follow these formatting requirements:
1. Be typed, double spaced, using Times New Roman font (size 12), with one-inch margins on all sides; citations and references must follow APA or school-specific format. Check with your professor for any additional instructions.
1. Include a cover page containing the title of the assignment, the student’s name, the professor’s name, the course title, and the date. The cover page and the reference page are not included in the required assignment page length.
The specific course learning outcomes associated with this assignment are:
1. Plan and design a generalized audit program.
1. Determine the nature and extent of evidence accumulated to conduct an audit after considering the unique circumstances of an engagement.
1. Evaluate a company’s various risk factors and the related impact to the audit process.
1. Evaluate effective internal controls that minimize audit risk and pote ...
Please use the grading rubric to create an outline of your assig.docxblazelaj2
Please use the grading rubric to create an outline of your assignment. Each section of the rubric should be a section of your final paper and could become the headings. Your assignment will be graded based on each element of the rubric. Compare each section of your paper with the rubric to ensure all elements are covered. Then, include an introduction and conclusion to tie the paper together. If you have any questions regarding the assignment please contact your instructor using the Course Help forum.
As a nursing leader you will have the opportunity to implement many proposals. This is an exercise to help you learn the processes or steps you will need for implementation. Utilizing assignment one choose one of the program outcomes and develop a quality assurance/capstone project that you believe would be beneficial to your area of employment, or the profession of nursing in general.
Topic: Enhance professional nursing practice through the use of research and evidence-based practice, a quality assurance project that will benefit emergency room care.
In assignment 2 you will address the following points.
the capstone project topic.
review of the literature to validate the importance of the project.
Location for the proposed plan
three outcomes you plan to achieve.
how the project will impact your workplace and your institution
how the project will impact your nursing practice, your workplace and nursing as a profession
However, please note that there is no expectation that you will implement this plan. If you are using a plan from a previous course, you must make significant changes to your paper or cite yourself. Using previously graded work is self-plagiarism.
Grading Rubric
Competency
20 points
12 points
7 points
0 points
Total Points
Develops a well-organized discussion of the capstone project and reviews the literature to support the validity of the project.
Develops a well-organized discussion of the capstone project and reviews the literature to support the validity of the project.
Discussion of capstone project minimally describes the importance of the project and/or literature does not support the validity of the project
Discussion of capstone project is poorly stated and/or the literature review is missing or poorly supports the validity of the project.
No paper submitted or content missing.
/20
Provides a detailed summary of the location and key players (stakeholders) necessary for success of the project.
Provides a detailed summary of the location and key players (stakeholders) necessary for success of the project.
Provides a summary and discussion of the location as well as key players for the project but content is missing or not in-depth enough
Provides vague and poorly presented discussion of the location and key stakeholders for the project and/or content is missing
Does not describes the proposed plan or no paper .
FINC20018 Managerial Finance T1 2019
Assessment 2 – Practical and Written Assessment
Group Assignment
Due date: Week 10, Friday 24 May 2019 @ 11:55pm
Weighting: 30%
Group formation
For on-campus students, the group means 2 students per group.
For distant learning (FLEX) students, while a group of 1 is likely to be more practical groups of 2 are
optional.
The task
The assignment is designed to assess your understanding of business finance theories and explores a
number of areas within the course by applying your learning to a real company. Through this project,
you need to be able to demonstrate critical and analytical skills in academic writing, various research
synthesising skills and be able to communicate clearly and effectively.
Please note this is a finance assignment for real business, so make sure you have the appropriate
combination of quantitative and qualitative analysis.
Format and referencing
Response to case study must be in Report Format and include an executive summary, table of
contents, introduction, body with suitable headings and sub-headings, conclusion and wide variety of
references.
Report fonts must be either Arial or Times Roman 12 pt and 1.5 spacing for narrative, 16 pt bold for
major headings and 14 pt bold for sub-headings.
Word count is 2,000 words maximum (excluding tables, formulae, reference list and appendices)
Inclusion of diagrams and tables to support the response is strongly encouraged.
Proper referencing of all content including figures, tables and narrative using APA Reference system.
Demonstrations of using your initiative and supporting your answers with interesting references to
contemporary issues from newspapers, journals, professional publications, web resources i.e. extracts
from podcasts, financial institutional websites etc. Wikipedia and Investopedia are not recommended
to be used as sources.
Submission method
Online submission, must be submitted as a word document. PDF submissions will not be accepted.
For on-campus students this is a group assignment, only one member of the group will submit the
assignment online by uploading to the Moodle (DO NOT use turnitin to check similarity for the
draft work, and the second person in the group submit the final assignment - this will result in
a very high similarity score and penalty will apply)
Issues that will affect your marks include:
Create your own cover sheet with the names of the students in the group clearly indicated.
Do not include the marking criteria or rubrics or marking sheet in your assessment. Your grader will
include a separate feedback and marking sheet after they have graded your assessment in Moodle.
The word limit is approx 2000 words in total, 5% leeway above or below is acceptable, if you exceed
the word limit significantly marks will be deducted.
Turnitin will be used to check percent.
Directions essay 3 Write a post-session summary based on the com.docxmariona83
Directions essay 3
Write a post-session summary based on the completed experience. Include the following:
1. Explain the two learning disciplines that you examined for this assessment: team learning and systems thinking.
2. Team exercise plan:
. Outline the schedule for your team development session. Include the job titles or roles of the team members participating in the session. List the scheduled meeting date and time.
. Describe the problem or issue you chose as the intended purpose for your team development session.
. Identify the learning discipline that you chose to focus on for your team exercise. Explain the process used to select that learning discipline, the rationale for its selection, and the team development exercise that you used with your team.
· Post-session summary:
. Describe your team development experience in a narrative format.
. Explain the successful and unsuccessful aspects of the team development exercise.
. Explain the lessons learned for team facilitation, including both planned and unplanned journeys that resulted.
. Explain the lessons learned for your chosen discipline, and its potential for helping a group examine itself, choose new direction, and commit to that direction.
DDDEEEHHH 111888000000 DDDeeennntttaaalll HHHyyygggiii eeennn eee 111
Informative Poster Research Paper Peer Evaluation Form
At the conclusion of each group project, please rate yourself and your team colleagues on regarding the relative
contributions that were made in preparing, submitting, and presenting your group project. Please be honest,
objective, constructive, and fair in your evaluation of yourself and your colleagues. Your ratings will not be
disclosed to other students. In rating yourself and your peers, using the following five-point scale, where:
5 = Always 4 = Most of the time 3 = Sometimes 2 = Seldom 1 = Never
Project or Paper Title: _________________________________________________________________
*Insert YOUR NAME IN THE FIRST COLUMN and those of your peers’ in the other spaces. (One name at the top of each column).
Names __________ __________ __________ __________ __________
Participated in discussions or
meetings
Contributed thoughtful research
germane to topic
Helped keep the group on the
task
Contributed useful ideas
Quantity of work done
Quality of work done
Shared equally in the work
Cooperated with colleagues
Made fair, considered decisions
re: direction of project and work
Deliverables on time, as promised
= = = = =
Total Score
Please take a moment to reflect, and answer the following questions.
1. Would you want to work with this group again? Why or why not?
2. In one sentence each; describe each team member’s contribution toward the project reaching completion?
Dental Hygiene 1 Informative Poster Research Paper Rubric for Evaluation (100 points poss.)
Qualities and C.
1
BUSS215 – Management Principles
Portfolio Project Directions and Rubric
This Assessment is worth 20% of your grade.
Completing this Assessment will help you to:
Course Outcomes:
• Explain various motivational techniques and rewards designed to improve employee
satisfaction.
• Apply the five primary functions of management; staffing, planning, organizing,
controlling and leading.
• Develop and demonstrate an understanding of how strategic planning meets the
organizational and departmental business objectives.
• Create and present a research paper that includes the basic functions of management that
defends your management and leadership decision-making process using Multimedia.
Program Outcomes:
• Recognize management and leadership skills.
• Identify and apply the basice functions of management such as staffing, planning,
organizing, controlling, and leading to the decision-making process.
Institutional Outcomes:
• Information Literacy and Communication - Utilize apporopriate current technology
and resources to locate and evaluate information needed to accomplish a goal, and then
communicate findings in visual, written and/or oral formats.
• Relational Learning - Transfer knowledge, skills and behaviors acquired through formal
and informal learning and life experiences to new situations.
• Community and Career - Participate in social, learning, and professional communities
for personal and career growth.
Deadlines
Timeline Activity Grading
Due Week 6 by Wednesday
at 11:59 pm, ET.
Submit your rough draft for
peer review.
This will count for 20% of
your overall Portfolio
Project grade.
Due Week 7 by Saturday at
11:59 pm, ET.
Upload your Portfolio Project to
Upload to your ePortfolio.
This will count for 80% of
your overall Portfolio
Project grade.
BUSS215 – Portfolio Project 2
Directions:
You will have the opportunity to write a Portfolio Project in which you explore a business
concept that is interesting to you and relate the ideas covered in this course which you may then
connect to your life and your future career interests.
Using your information literacy skills, you will research the information necessary to write your
Portfolio Project on a concept in business that we have covered in this course (please see below
for the approved topic list). The main objective of this Portfolio Project is to explore a business
concept, summarize the concept, and analyze the main points of experts in the field. In the
project you will provide a summary of the topic along with how it relates to what you have
learned in this course as well as to your role as a professional.
It is an expectation for this course that all written projects will follow the standards for fair use of
information, including the avoidance of all intentional and unintentional plagiarism, and
incorporating appropriate usage according to the conventions of the APA citatio ...
BUSM 4194 Leading for ChangeSemester 1, 2014Assessment Tas.docxhumphrieskalyn
BUSM 4194 Leading for Change
Semester 1, 2014
Assessment Task 1: Leadership Development Report
Writing instructions and Marking Rubric
This assessment task is a REPORT.
The RMIT College of Business requires you to use a particular style of writing which involves both the way the report is structured and the way that you acknowledge other people’s ideas used in your work.
The structuring of a report is very clearly described in the RMIT Study and Learning Centre Report Writing Skills Online Tutorial available on the BUSM4194 course Blackboard site
Your first step in preparing for this assessment task should be to complete this tutorial.
Investing time before you start writing will result in a better report.
Your second step should be mastering the art of referencing. There are many styles of referencing in use in different disciplines and geographical locations. You are required to use the RMIT Business Referencing System. This is available to you via the Library website, in your course site on myRMIT and is uploaded to the assessments folder in the BUSM 4194 course site. This is a 50 page document but reading it through will be enormously helpful for you in this and future assessment tasks.
Make sure that you can clearly distinguish the difference between an essay (page 28 of the document) and a report (page 36).
Remember: this current assessment task is a REPORT not an ESSAY.
The critical thinking element
We want you to be very comfortable with questioning everything you read and hear.
Anyone can remember facts and state other people’s views but a far more useful skill is to critically review what you read and hear and decide for yourself how reliable, accurate, applicable, contemporary, objective and fair it is.
In this report, your assessor will value the fact that you are able to see both benefits and deficiencies in a particular theory. Make sure you look through the critical thinking exercises in the course site to get a clear understanding of critical thinking!
How many references should I cite?
There is no right answer to this question because it all depends on what you write in your report. Some statements you make in your report will certainly need a reference to support them.
So, to determine how many references you need to cite, first (as described in the report writing tutorial) draw a mind map of ideas to go into your report and for each idea try to link it to a reference source.
How will the report be marked?
Your lecturers have already created a marking rubric that will be used to award you a mark out of 50 as the report comprises 50 of the overall 100 marks available in this course.
The rubric is reproduced over the page and will be used as a way of providing feedback to you on how you performed.
The most important thing about the rubric is that it DEFINES what you will be marked on. If you include additional material that is not mentioned in the rubric it will not attract any marks, if you forget to w ...
HOLMES INSTITUTE FACULTY OF HIGHER EDUCATION .docxShiraPrater50
HOLMES INSTITUTE
FACULTY OF
HIGHER EDUCATION
INSERT UNIT CODE & NAME AND ASSIGNMENT NAME
Assessment Details and Submission Guidelines
Trimester T2 2019
Unit Code HC1010
Unit Title Accounting for Business
Assessment Type Individual Assignment
Assessment Title Accounting for business decisions
Purpose of the
assessment (with ULO
Mapping)
Students are required to apply knowledge learned in class and perform independent
research of the key topics.
Learning Outcomes:
• Familiar with and readily able to access (refer to) and integrate across:
o The social role and purpose of accounting
o The accounting equation and how it shapes the financial statements
o General Purpose Financial Statements
o Special Purpose Financial Statements
• Understand how to analyse and interpret financial ratios from GPFS
• Obtain and contextualise business information for business accounting to explain
and apply to business decisions
• Demonstrate the ability to apply, analyse, synthesise and evaluate information
from multiple sources to make decisions about the financial performance of entities
including assets, liabilities, owner’s equity, revenue and expenses
• Apply concepts and theories discussed on a weekly basis
• Use transaction data and financial statement analysis for data-driven decision-
making
• Demonstrate the ability to communicate accounting information writing to a
professional standard
Weight 20% of the total assessments
Total Marks 20 marks
Word limit 1000 words
Due Date 11.59pm Friday, Week 8 (This due date is only for Block mode 1, i.e., Week 1-5 & 12
class)
Submission
Guidelines
• All work must be submitted on Blackboard by the due date along with a completed
Assignment Cover Page.
• The assignment must be in MS Word format, single spacing, 12-pt Arial font and 2
cm margins on all four sides of your page with appropriate section headings and
page numbers.
• Reference sources must be cited in the text of the report and listed appropriately at
the end in a reference list using Harvard referencing style.
HOLMES INSTITUTE
FACULTY OF
HIGHER EDUCATION
Page 2 of 6
HC1010 Accounting for Business
HC1010 Assignment Specifications
Purpose:
This assignment aims to reinforce and extend students’ knowledge and understanding of key topics in this
course (HC1010) including: Overview of Accounting, Organisational Structure & the Reporting Environment,
Statement of Financial Position, Statement of Financial Performance, Cash Flow Statement, Financial
Statement Analysis, Accounting for Business Transactions, Cost Concepts & Behaviour, Preparation of Budgets,
and Cost-Volume-Profit-Analysis through independent research and application of knowledge and skills.
Assignment details:
Your friend Tim is from Darwin and he wants to start a business of his own. He is thinking of buying a
delicatessen in Sydney. The shop has been there for several ...
How to develop and create a Domain Model1. Primary list of obj.docxpooleavelina
How to develop and create a Domain Model
1. Primary list of objects:
Faculty
Students
Projects
Class
Administrator
Login Level
Department
Courses
rubric
self-assessment
peer-assessment
feedback
Reports
Average
Team
individual
Comments
2. Eliminates duplicated and unnecessary items
a. Classes vs courses
b. Feedback vs comments
c. Team vs Students
3. Create a domain model and only group classes having aggregation relationship.
4. Identify further domain objects that weren’t in the requirements
5. Building generalization relationships in the domain model.
PADM 501
Essay Rubric
Criteria
Levels of Achievement
Content
(70%)
Advanced
92-100%
Proficient
84-91%
Developing
1-83%
Not Present
Total
Research Purpose
32.5 to 35.0 Points:
The essay question is clearly identified and retains focus throughout the paper. Introduction provides sufficient background on the topic and previews major points. All necessary aspects of the assignment described in the instructions are clearly identifiable. Organization emphasizes the central theme or purpose.
Grading feedback and lessons from applicable modules/weeks are fully addressed/incorporated.
29.5 to 32.0 Points:
The essay question may require some clarification and/or greater prominence throughout the paper. Introduction may not provide adequate background on the topic and preview major points. Most necessary aspects of the assignment described in the instructions are clearly identifiable and sufficiently addressed. Organization may not sufficiently emphasize the central theme or purpose.
Grading feedback and lessons from applicable modules/weeks are generally addressed/ incorporated.
1.0 To 29.00 Points:
The research question requires significant clarification and prominence throughout the paper. Introduction may be missing or ambiguous. Some necessary aspects of the assignment described in the instructions are clearly identifiable, but others may require clarification or development. Organization may require significant improvement.
Grading feedback and lessons from applicable modules/weeks are insufficiently addressed/incorporated.
0 points
Not present
Reasoned Analysis
32.5 to 35.0 Points:
Major points are stated clearly and are supported by valid evidence and logical reasoning. Objective, reasoned analysis is employed. Opposing viewpoints are sufficiently acknowledged and critically evaluated. The conclusion logically derives from the paper’s ideas. An authoritative, persuasive, and statesmanlike voice is used (first/second person perspective avoided).
Grading feedback and lessons from applicable modules/weeks are fully addressed/incorporated.
29.5 to 32.0 Points:
Most major points are stated clearly and supported by valid evidence and logical reasoning, but some points may require clarification or greater support. Opposing viewpoints are acknowledged but may require greater evaluation. The conclusion does not fully derive from the paper’s ideas. Some improvements to objective t ...
College-Level Writing RUBRIC
C
ri
te
ri
a
Performance
Indicators
Target/
High Proficiency
15
Proficiency
12
Acceptable
9
Needs Improvement
6
Unacceptable
3
C
o
v
e
ra
g
e
&
O
rg
a
n
iz
a
ti
o
n
Content‐Specific
Assignment Criteriai
∙Writing meets all
assignment content
∙Writing meets most
assignment content
∙Writing meets minimum
assignment content
∙Writing meets
some/few assignment
∙Writing does not
meet assignment
as per Instructor
Guidelines
requirements. requirements. requirements. content requirements. content
requirements.
∙Writing is clear and ∙Writing is generally clear and ∙Writing is adequate in ∙Writing may be unclear ∙Writing is
appropriate for the appropriate for the purpose of terms of clarity and and/or inappropriate unclear and
Purpose purpose of the the assignment—with some appropriateness for the for the purpose of the inappropriate for
& assignment. exceptions. purpose of the assignment. the purpose of
Support ∙All evidence and ∙Evidence and examples are assignment. ∙Evidence and examples the assignment.
examples are generally effective, specific ∙Evidence and examples may require further ∙Evidence and
effective, specific and and relevant—with some meet basic requirements development to be examples are not
relevant. exceptions. for being effective, adequately effective, effective, specific
specific and relevant. specific and relevant. and/or relevant.
∙Ideas are coherently ∙Organization of ideas is ∙Organization of ideas ∙Organization of ideas ∙Ideas are
and logically generally coherent and logical. meets the minimum does not meet the incoherent and
Structure & organized with well‐ ∙In addition, most paragraphs requirement for being minimum requirement illogically
Development developed paragraphs are well‐developed and use coherent and logical. for coherent and logical. organized.
and effective effective transitions. ∙Some paragraphs may ∙Paragraphs lack ∙Paragraphs are
transitions. be well‐developed and development and/or fail undeveloped
use effective transitions to employ transitions and need
while others do not. effectively. transitions.
∙All sources are
critically reviewediii,
∙Most sources are critically
reviewed and documented
∙Sources meet the
minimum requirements
∙Sources do not meet
the minimum
∙Insufficient
sources and/or
Documentation of documented and following standard practices of for being critically requirements for being insufficient
Sources formatted following the field (APA, MLA, Turabian, reviewed and critically reviewed and quality, critical
standard practices of CMS, etc.). documented following documented following review and
the field (APA, MLA, standard practices of the standard practices of documentation.
Turabian, CMS, etc.). field (APA, MLA, the field (APA, MLA, Standard
Turabian, CMS, etc.). Turabian, CMS, etc.). practices of the
field are not ...
Final Written Assignment 3InstructionsRequirements include,.docxhoundsomeminda
Final Written Assignment 3
Instructions
Requirements include,
Cover Page with Name, Date, and Title of Assignment
Use headings to separate the sections of the paper (use the Questions selected)
Page numbers
Double-spacing
Times New Roman, size 12
Use a minimum of four sources (from the past four years) for each response
In-text citations in APA style and 5 to 6 pages
Reference page using APA style
Select any four of these six topics for your Final Written Assignment:
1.
It has been said that "a company that deserves a union gets one," suggesting that if proper leadership and motivation techniques are employed and desirable policies devised, the workers will not want to unionize. Either agree or disagree with this philosophy. Support your position and explain what a company could do to create an environment where workers will not want to unionize.
2.
Some means of resolving negotiations impasses involve economic weapons (e.g. strikes and lockouts). There are other means of impasse resolution that do not involve the use of economic weapons (e.g. fact finding, mediation, med/arb/interest arb, etc.). Select two (2) non- economic means of impasse resolution, 1) explain how each one functions and 2) discuss the relative pros and cons of each.
3.
Unions have declined as a percentage of the workforce in the private sector. With this decline, have career and workplace dissatisfaction and alienation increased? If so, why is this so? If not, why not? Support your position.
4.
List and discuss some of the advantages and disadvantages in using seniority as a factor to determine shift preference or overtime assignments.
5.
Identify two different steps a company should take to prepare for its first round of bargaining with the union pre-negotiation activities. Explain why each of the steps you have identified is critical to achieving an initial successful collective bargaining agreement with the union.
6.
Identify and explain the major ways in which the government is an important participant in the labor relations.
RUBRIC FOR FINAL WRITTEN ASSIGNMENT 3
Criteria 1
Exceeds Expectations
5 points
Meets Expectations
4 points
Meets Some Expectations
3 points
Does Not Meet Expectations
2 points
Not Included
0 points
Organization
(maximum of 5 points)
Arranges ideas clearly and logically to support the purpose or argument; ideas flow smoothly and are effectively linked; reader can follow the line of reasoning
Arranges ideas adequately to support the purpose or argument; links between ideas are generally clear; reader can follow the line of reasoning for the most part
Arranges ideas adequately, in general, although ideas sometimes fail to make sense together; reader remains fairly clear about what writer intends
Arranges ideas illogically; ideas frequently fail to make sense together; reader cannot identify a line of reasoning and becomes frustrated or loses interest
Criteria 2
Exceeds Expectations
15 points
Meets Expectations
12 points
Meets.
Assignment Grading Rubric Course GB520 Unit 2 Po.docxrock73
Assignment Grading Rubric
Course: GB520 Unit: 2 Points: 100
Copyright Kaplan University
Assignment 2 Instructions
Review the SHRM case, “The Reyes Fitness Centers, Inc: The Strategic HR Opportunity.”
Prepare a 4–6 page case analysis on the topic of strategic management and why it is critical to the success of
an organization in meeting its goals and mission. In your analysis respond to the following question: What is
strategic management and why is it critical to the success of an organization in meeting its goals and mission?
Your analysis of this case and your written submission should reflect an understanding of the critical issues of
the case, integrating the material covered in the text, and present concise and well-reasoned justifications for
the stance that you take.
Case analysis criteria: Your case analysis should consist of:
• A brief analysis of the situation and pending decision problem, as presented in the case, and as
relevant to your answer. This should be exceptionally brief and you should assume the person reading
the Assignment is familiar with the details of the case.
• Identification of the major issues surrounding the organization or individuals involved with the
organization.
• Identification of alternate courses of action to address the issues identified.
• The decision or recommendation for action, with the appropriate supporting arguments.
• The case question is designed to guide the direction of your analysis in the case. Your analysis should
address and ultimately answer the question.
You may discuss your case analysis Assignment with the class, but you must submit your own original work.
Case analysis tips: Avoid common errors in case analyses, such as:
• Focusing too heavily on minor issues.
• Lamenting because of insufficient data in the case and ignoring creative alternatives.
• Rehashing of case data — you should assume the reader knows the case.
• Not appropriately evaluating the quality of the case's data.
• Obscuring the quantitative analysis or making it difficult to understand.
Typical “minus (–)” grades result from submissions that:
• Are late.
• Are not well integrated and lack clarity.
• Do not address timing issues.
• Do not recognize the cost implications or are not practical.
• Get carried away with personal biases and are not pertinent to the key issues.
• Are not thoroughly proofread and corrected.
Assignment submission: Before you submit your Assignment, you should save your work on your computer
in a location that you will remember. Save the document using the naming convention:
Username_Unit2_Assignment.doc.
http://extmedia.kaplan.edu/business/GB520/GB520_1505D/GB520_Unit02_Case_Study.pdf
Assignment Grading Rubric
Course: GB520 Unit: 2 Points: 100
Copyright Kaplan University
Make sure your document includes:
• Your name
• Date
• Course name and section number
• Unit number
• Case name
• Page numbers
The cas ...
Scoring Guide for Rhetorical Analysis (10 of grade; 100 po.docxaryan532920
Scoring Guide for Rhetorical Analysis (10% of grade; 100 points)
The scoring guide helps you and your instructor see some of the specific ways your writing is matching expectations. No rubric can encompass everything a piece of writing can or
needs to accomplish, so your instructor will comment both about and beyond these categories to help you understand how this piece of writing is effective and how it (or future pieces)
could be more effective. Your grade will be determined by your instructor’s overall evaluation of this piece of writing and the revision process it enjoyed, with the top three categories
carrying more weight than the bottom three. Note: If for any category, the piece does not meet “Developing” standards, your instructor will assign no credit for that category.
KHO/16
Categories Excellent (A) Effective (B) Adequate (C) Developing (D)
Invention and
Purpose
Provides exceptional detail, depth,
and clarity about the effects of one or
two specific elements (e.g., patterns,
rhetorical strategies, audience,
purpose); interesting, sophisticated
argument develops through the paper
Provides solid detail, depth, and clarity
about the the effects of one or two
specific elements (e.g., patterns,
rhetorical strategies, audience,
purpose); solid argument develops as
the paper progresses
Provides some detail and clarity about
the effects of one or two specific
elements (e.g., patterns, rhetorical
strategies, audience, author, purpose);
consistent argument
Provides little detail, depth, or clarity
about the effects of specific elements,
may attempt to discuss many
elements without depth; may use
terms inaccurately; confusing, vague,
or inconsistent argument
Arrangement
and Audience
Awareness
Arrangement enhances the central
idea; intro intrigues readers, provides
helpful context, and prepares readers
well; sophisticated transitions guide
readers; conclusion refines thesis,
provides a satisfying resolution
Arrangement supports the central idea
and its development; intro provides
context and prepares readers well;
effective transitions guide readers;
conclusion recasts thesis and provides
a satisfying resolution
Arrangement mostly supports the
central idea; intro provides limited
context or reader preparation;
transitions formulaic or not always
effective; conclusion merely repeats
thesis or provides little resolution
Arrangement doesn’t consistently
support the central idea; intro provides
little context or reader preparation;
transitions missing or ineffective;
relationship among ideas unclear;
conclusion off-topic or underdeveloped
Ethos and
Evidence
Evidence and overall content easily
convince the reader that the author is
credible and that the analysis is valid;
evidence fully supports or enhances
writer’s claims
Evidence and overall content convince
the reader that the author is credible
and that the analysis is valid; evidence
supports writ ...
Similar to Final Project (Week 8) In this paper, students w.docx (20)
CSIA 413 Cybersecurity Policy, Plans, and Programs.docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and Programs
June 2, 2019
Executive Summary
The Red Clay Renovations Employee Handbook is to give general rules about its strategies. The Employee Handbook will fill in as a guide for workers to get comfortable with Red Clay Renovations strategies for "Acceptable Use Policy for Information Technology", "Bring Your Own Device Policy " and "Digital Media Sanitization, Reuse, and Destruction Policy". Red Clay Renovations maintains whatever authority is needed to adjust the Employee Handbook to best suit the organization whenever with no earlier warning to its representatives.
Red Clay Renovations "Acceptable Use Policy for Information Technology" will characterize in subtleties what Acceptable Use is and what it's most certainly not. Every Employee will get his/her duty of the framework accounts, processing resources, organize utilization and will sign and consent to the approach before access is conceded to the system.
Red Clay Renovations "Bring Your Own Device Policy or BYOD" will name every one of the gadgets that are satisfactory as BYOD and the administration of the use of such gadgets. Every worker's gadgets must satisfy the arrangement guideline before actualizing the gadgets into Red Clay Renovation Company.
Red Clay Renovations "Digital Media Sanitization, Reuse, and Destruction Policy" will ensure that any worker of Red Clay Renovation who marked for the BYOD approach has/should sign this arrangement also. Workers need to comprehend the techniques the organization will use to clean off the BYOD.
Acceptable Use Policy
Introduction
This Acceptable Use Policy is for all Red Clay Renovation workers and supplants every single past version. All workers are liable to the terms and states of the Policy. The approach will build up satisfactory and inadmissible utilization of defending the security of information, secure and ensure PC and PCs, the use of system condition and servers, the utilization of electronic correspondences. Additionally Red Clay Renovation gathers, keeps up, and stores individual data to incorporate Mastercard’s, credit checks, building plans and illustrations, customers restorative and wellbeing information.
Red Clay Renovation must be in consistence with the accompanying: HIPPA Privacy and Security Rule, Freedom of Information Act (FOIA), PCI DSS, Privacy Act of 1977, Building Codes and Regulations. It is to the greatest advantage of the organization for all workers to comprehend the Acceptable Use Policy to settle on trustworthy choices before participating in inadmissible utilization of the approach. Any offense with the Acceptable Use Policy could conceivably cause Red Clay Renovation considerable loss of its business and its notorieties. On the off chance that any worker needs more data with this arrangement, they can reach out to the IT department directly.
Policy Content
Utilization of IT Systems
Red Clay Renovation possesses the property rights to all informati.
CSIS 100CSIS 100 - Discussion Board Topic #1One of the object.docxmydrynan
CSIS 100
CSIS 100 - Discussion Board Topic #1:
One of the objectives of this course is to enable students to differentiate between the disciplines of Information Systems, Information Technology, and Computer Science. Oftentimes, these areas overlap and are difficult to distinguish – even among professionals within the industries.
There are some distinctions that become evident, but all too frequently, people do not understand these distinctions until they are already deep within their programs of study. Consequently, many decide that it is too late to pursue a different avenue in the computing world without losing valuable time and money spent on courses that may or may not apply to a different major.
Given the importance of achieving effective planning from the beginning, your first assignment in this course is to delve into the broad areas of Information Systems, Information Technology, and Computer Science and write about your career choice in a discussion board post. This should be your thought process:
· First, define each field (i.e. IS, IT, CS). Understand the similarities and differences.
· Second, determine what jobs are available in each area.
· Third, look at the degree completion plans for each of these programs.
· Fourth, assess your own skills (e.g. Are you good in math? Do you like business? Do you like algorithms? Are you gifted at problem-solving? Do you like learning about new technology? Do you enjoy working hands-on with equipment/hardware/wires?)
· Fifth, (and most importantly) ask God what He wants you to pursue based on your talents, interests, and abilities.
· Sixth, based on your analysis above, what career do you hope to obtain after graduation, and what degree will you pursue to achieve this goal?
To facilitate your research, there are four videos in your Reading & Study folder that will help you understand the differences between the computing fields and become familiar with the job opportunities in each area. Be sure to view these videos first.
The LU Registrar’s home page has information on degree completion plans. Here is a link to all of the currently available ones in the university:
http://www.liberty.edu/academics/registrar/index.cfm?PID=2981
Be sure to look at all of the ones listed for Information Systems and Information Technology. At the time of this writing, Computer Science is only listed under residential degree plans. That does not mean that you should rule out Computer Science as a potential major. You must consider all options and listen to God’s calling upon your life. With God, all things are possible.
Discussion Board Deliverables
Main Post:
In a minimum of 300 words, create a thread in Module 1’s discussion board forum that describes the following:
1. Your desired career upon graduation
2. Why you chose this career
3. Your intended major
4. Your strengths, weaknesses, and interests
5. How the major supports your chosen career
6. How God has led you to reach your decision
7. A Bib.
CSI Paper Grading Rubric- (worth a possible 100 points) .docxmydrynan
CSI Paper Grading Rubric- (worth a possible 100 points)
1. INTRODUCTION (10%): Identifies/summarizes the paper’s topic and states an informed
judgment about the topic.
1 2.5 5 7.5 10
DEVELOPING……………………………………................................................................DEVELOPED
Lacks an introduction that takes an overview and that states the
objectives of the paper. A brief statement of the crime and the
criminological theories that can help explain it is absent,
unfocused or very weak.
Begins with a strong introduction that lays out the crime and
its context, as well as theories that can help understand the
circumstances surrounding the crime. Also provides the
sequence of what follows clearly and concisely.
2. RESOURCES (10%): Evidence from scholarly sources and textual sources (minimum of 5 total
sources).
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………….DEVELOPED
Lists evidence but doesn’t explain how it does or doesn’t support a
point. Lacks organization or transitions. Does not completely or
correctly identify sources of information through in-text citations
and a works cited reference page.
Provides appropriate and sufficient evidence, smoothly
synthesizes evidence from sources and clearly ties it to the
point being made. Logically organizes ideas. Uses
transitions to connect one idea to the next. Correctly
identifies all sources of information through in-text
citations and a works cited reference page.
3. BODY (50%): Formulates a coherent, logical, and thoughtful sociological analysis of the crime
being investiaged. Addressed all parts of the paper assignment.
10 20 30 40 50
DEVELOPING…………………….………………………………………………………...DEVELOPED
Shows little understanding of sociological concepts and theories
used to explain the crime being investigated. No discussion at all
of any complexities or nuances related to the topic. No integration
of source information.
Identifies the circumstances of the crime with necessary
detail to perform a rigorous sociological analysis of the
crime. Shows strong understanding of the sociological
concepts and theories discussed in the paper (for example,
other perspectives and confounding factors), and discusses
how the source information is relevant.
4. CONCLUSION (10%): Identifies and assesses conclusions and implications of the sociological
analysis of your crime of the semester; sums up the importance/sociological relevance of your paper.
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………...DEVELOPED
Only restates verbatim what has already been said. Conclusion is
not related to the support in the paper or new information is
presented. Feels abrupt, unconnected, or changes the focus. Is not
persuasive.
Goes beyond summarizing your main points. Reader feels a
sense of closure in the paper and is persuaded by the
examination of your crime and use of sociological theories
to explain it. No new informati.
CSIA 413 Cybersecurity Policy, Plans, and ProgramsProject #4 IT .docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and ProgramsProject #4: IT Audit Policy and Plans Company Background & Operating Environment
Red Clay Renovations is an internationally recognized, awarding winning firm that specializes in the renovation and rehabilitation of residential buildings and dwellings. The company specializes in updating homes using “smart home” and “Internet of Things” technologies while maintaining period correct architectural characteristics. Please refer to the company profile (file posted in Week 1 > Content > CSIA 413 Red Clay Renovations Company Profile.docx) for additional background information and information about the company’s operating environment.Policy Issue & Plan of Action
The corporate board was recently briefed by the Chief Information Officer concerning the company’s IT Security Program and how this program contributes to the company’s risk management strategy. During the briefing, the CIO presented assessment reports and audit findings from IT security audits. These audits focused upon the technical infrastructure and the effectiveness and efficiency of the company’s implementation of security controls. During the discussion period, members of the corporate board asked about audits of policy compliance and assessments as to the degree that employees were (a) aware of IT security policies and (b) complying with these policies. The Chief Information Officer was tasked with providing the following items to the board before its next quarterly meeting:
(a) Issue Specific Policy requiring an annual compliance audit for IT security policies as documented in the company’s Policy System
(b) Audit Plan for assessing employee awareness of and compliance with IT security policies
a. Are employees aware of the IT security policies in the Employee Handbook?
b. Do employees know their responsibilities under those policies?
(c) Audit Plan for assessing the IT security policy system
a. Do required policies exist?
b. Have they been updated within the past year?
c. Are the policies being reviewed and approved by the appropriate oversight authorities (managers, IT governance board, etc.)?
Your Task Assignment
As a staff member supporting the CISO, you have been asked to research this issue (auditing IT security policy compliance) and then prepare an “approval draft” for a compliance policy. You must also research and draft two separate audit plans (a) employee compliance and (b) policy system audit. The audit policy should not exceed two typed pages in length so you will need to be concise in your writing and only include the most important elements for the policy. Make sure that you include a requirement for an assessment report to be provided to company management and the corporate board of directors.
· For the employee compliance assessment, you must use an interview strategy which includes 10 or more multiple choice questions that can be used to construct a web-based survey of all employees. The questions should be split.
CSI 170 Week 3 Assingment
Assignment 1: Cyber Computer Crime
Assignment 1: Cyber Computer Crime
Create a 15-slide presentation in which you:
1. Describe the responsibilities of the National Security Administration (NSA).
2. Identify the four critical needs at the state or local level of law enforcement in order to fight computer crime more effectively.
3. Explain how the U.S. Postal Service assists in the investigation and prosecution of cases involving child pornography.
4. Discuss how and why the Department of Homeland Security (DHS) consolidated so many federal offices.
5. Go to https://research.strayer.edu to locate at least three (3) quality references for this assignment. One of these must have been published within the last year.
4/15/2019 Auden, Musée des Beaux Arts
english.emory.edu/classes/paintings&poems/auden.html 1/1
Musee des Beaux Arts
W. H. Auden
About suffering they were never wrong,
The old Masters: how well they understood
Its human position: how it takes place
While someone else is eating or opening a window or just walking
dully along;
How, when the aged are reverently, passionately waiting
For the miraculous birth, there always must be
Children who did not specially want it to happen, skating
On a pond at the edge of the wood:
They never forgot
That even the dreadful martyrdom must run its course
Anyhow in a corner, some untidy spot
Where the dogs go on with their doggy life and the torturer's horse
Scratches its innocent behind on a tree.
In Breughel's Icarus, for instance: how everything turns away
Quite leisurely from the disaster; the ploughman may
Have heard the splash, the forsaken cry,
But for him it was not an important failure; the sun shone
As it had to on the white legs disappearing into the green
Water, and the expensive delicate ship that must have seen
Something amazing, a boy falling out of the sky,
Had somewhere to get to and sailed calmly on.
Pieter Brueghel, The Fall of Icarus
Oil-tempera, 29 inches x 44 inches.
Museum of Fine Arts, Brussels.
See also:
William Carlos Williams' "Landscape with the Fall of Icarus "
Return to the Poem Index
javascript:openwin('Icarus.jpg',530,330)
http://english.emory.edu/classes/paintings&poems/Williams.html
http://english.emory.edu/classes/paintings&poems/titlepage.html
1. Biographical information on Ibsen—Concluding sentence: Sub-thesis, his play and Nora.
2. Nora’s treatment by her father and Nora’s treatment by her husband Torvald.
3. Nora’s treatment by Krogstad.
4. Nora’s contrast with Christine
INTRO: Females in Conflict
Yet another voice to champion the cause of inequality of the sexes is Henrik Ibsen.
Writing at the end of the nineteenth century in Victorian Norway, his play A Doll House utilizes
the format of a playwright to convey through the use of evolving characters different political and
social messages. When analyzing A Doll House’s protagonist, Nora, her interactions with the
other characters.
CSE422 Section 002 – Computer Networking Fall 2018 Ho.docxmydrynan
CSE422 Section 002 – Computer Networking
Fall 2018
Homework 2 – 50 points
Sockets (10 points)
1. For a client-server application over TCP, why must the server program be executed before the
client program?
2. For a client-server application over UDP, why may the client program be executed before the
server program?
3. The UDP server shown in the course slides needed only one socket, whereas the TCP server
needed two sockets. Why?
4. If the TCP server were to support N simultaneous connections, each from a different client host,
how may sockets would the TCP server need?
5. You are creating an event logging service that will be handling event messages from multiple
remote clients. This service can suffer delays in message delivery and even the loss of some
event messages. Would you implement this using TCP or UDP? Why?
The HTTP GET message (10 Points)
Consider the figure below, where a client is sending an HTTP GET message to a web server,
gaia.cs.umass.edu.
Suppose the client-to-server HTTP GET message is the following:
GET /kurose_ross/interactive/quotation1.htm HTTP/1.1
Host: gaia.cs.umass.edu
Accept: text/plain, text/html, image/gif, image/jpeg, audio/basic,
audio/vnf.wave, video/mp4, video/wmv, application/*, */*
Accept-Language: en-us, en-gb;q=0.5, en;q=0.1, fr, fr-ch, zh, cs
If-Modified-Since: Wed, 10 Jan 2018 13:13:03 -0800
User Agent: Mozilla/5.0 (Windows NT 6.1; WOW64) AppleWebKit/535.11 (KHTML,
like Gecko) Chrome/17.0.963.56 Safari/535.11
Answer the following questions:
1. What is the name of the file that is being retrieved in this GET message?
2. What version of HTTP is the client running?
CSE422 Section 002 – Computer Networking
Fall 2018
3. What formats of text, images, audio, and video does the client browser prefer to receive?
[Note: for this and the following questions on browser media and language preferences, you
will need to do a bit of additional reading on the Web. Here is a good place to start.]
4. What do the strings "application/*" and "*/*" signify in the Accept: header?
5. What languages is the browser indicating that it is willing to accept? [Note: you can look at
your own browser preferences to get a listing of language codes.]
6. What is the meaning of the "relative quality factor," q, associated with the various version of
English? [Note: Here is a good place to start. See also [RFC 2616].]
7. What is the client's preferred version of English? What is the browser's least preferred
version of English?
8. Does the browser sending the HTTP message prefer Swiss French over traditional French?
Explain.
9. Does the client already have a (possibly out-of-date) copy of the requested file? Explain. If
so, approximately how long ago did the client receive the file, assuming the GET request has
just been issued?
10. What is the type of client browser and the client's operating system? [Note: To answer this,
you'll need to understan.
CSCI 132 Practical Unix and Programming .docxmydrynan
CSCI
132:
Practical
Unix
and
Programming
Adjunct:
Trami
Dang
Assignment
4
Fall
2018
Assignment 41
This set of exercises will strengthen your ability to write relatively simple shell scripts
using various filters. As always, your goals should be clarity, efficiency, and simplicity. It
has two parts.
1. The background context that was provided in the previous assignment is repeated here
for your convenience. A DNA string is a sequence of the letters a, c, g, and t in any
order, whose length is a multiple of three2. For example, aacgtttgtaaccagaactgt
is a DNA string of length 21. Each sequence of three consecutive letters is called a codon.
For example, in the preceding string, the codons are aac, gtt, tgt, aac, cag, aac,
and tgt.
Your task is to write a script named codonhistogram that expects a file name on the
command line. This file is supposed to be a dna textfile, which means that it contains
only a DNA string with no newline characters or white space characters of any kind; it is
a sequence of the letters a, c, g, and t of length 3n for some n. The script must count the
number of occurrences of every codon in the file, assuming the first codon starts at
position 13, and it must output the number of times each codon occurs in the file, sorted
in order of decreasing frequency. For example, if dnafile is a file containing the dna
string aacgtttgtaaccagaactgt, then the command
codonhistogram dnafile
should produce the following output:
3 aac
2 tgt
1 cag
1 gtt
because there are 3 aac codons, 2 tgt, 1 cag, and 1 gtt. Notice that frequency comes
first, then the codon name.
1
This is licensed under the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International
License. To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-sa/4.0/.
2
This is really just a simplification to make the assignment easier. In reality, it is not necessarily a
multiple of 3.
3
Tho.
CSCI 714 Software Project Planning and EstimationLec.docxmydrynan
*
CSCI 714: Software Project Planning and Estimation
Lecture 4B: Work Breakdown Structure
Gursimran Singh Walia
North Dakota State University
[email protected]
*
The Work Breakdown StructureA work breakdown structure (WBS) is an outcome-oriented analysis of the work involved in a project that defines the total scope of the projectIt is a foundation document in project management because it provides the basis for planning and managing project schedules, costs, and changes
Approaches to Developing WBSsUsing guidelines: Some organizations, like the DOD, provide guidelines for preparing WBSsThe analogy approach: It often helps to review WBSs of similar projectsThe top-down approach: Start with the largest items of the project and keep breaking them downThe bottoms-up approach: Start with the detailed tasks and roll them up
Basic Principles for Creating WBSs*
1. A unit of work should appear at only one place in the WBS.
3. A WBS item is the responsibility of only one individual, even though many people may be working on it.
4. The WBS must be consistent with the way in which work is actually going to be performed; it should serve the project team first and other purposes only if practical.
5. Project team members should be involved in developing the WBS to ensure consistency and buy-in.
6. Each WBS item must be documented to ensure accurate understanding of the scope of work included and not included in that item.
7. The WBS must be a flexible tool to accommodate inevitable changes while properly maintaining control of the work content in the project according to the scope statement. *Cleland, David I. Project Management: Strategic Design and Implementation, 1994
Good WBS Design PrinciplesThe 100% RuleThe WBS defines 100% of the work of the projectAnything that isn’t defined in the WBS is outside the scope of the project.The work content on any item is the sum of what is included under that work itemUpper Levels are Planned outcomes (deliverables), not planned actionsEnds of WBS include the activities needed to create the project deliverablesMutually-exclusive elementsWork should only appear in one place in the WBSWBS must be consistent with the way the project will be performed and controlledMust be easy to update
WBS RolePartition the major project deliverables into smaller components to improve the accuracy of cost estimatesProvide a mechanism for collecting actual costsProvide a mechanism for performance measurement and control
Why create a WBS?Cost EstimatingCost BudgetingResource PlanningRisk Management PlanningActivity Definition
SchedulingScheduling forces:Quantification of discrete effortPlacement of tasks in proper relationshipTwo most common scheduling methodologiesBar Charts (aka Gantt Charts)Critical Path Method (CPM) using Precedence Diagramming Method (PDM)
Bar / Gantt Charts Defined:Analyze and specify the basic approach in executionSegment into reasonable number of activitiesEstimate the time required.
CSCI 561Research Paper Topic Proposal and Outline Instructions.docxmydrynan
CSCI 561
Research Paper: Topic Proposal and Outline Instructions
The easiest approach for selecting a topic for your paper might be to review the various subject areas covered in the course readings (i.e., search the bibliographies of the textbooks). Although the chosen topic must relate directly to the general subject area of this course, you are not limited to the concepts, techniques, and technologies specifically covered in this course.
Each Topic Outline must include the following 3 items:
1. A brief (at least 3–4 bullets with 1–2 sentences per bullet) overview of the research topics of your paper – you will need to address these in the actual paper. This will be titled “Research Objectives”.
2. A list of at least 3 questions (in a numbered list) you intend your research to ask and hopefully answer. These must be questions that will require you to draw conclusions from your research. These must not be questions to answer your research objectives. This section will be titled “Questions”
3. At least 3 initial research sources, 1 of which is an academic journal or other peer reviewed source. These should match APA formatting of sources.
Example formats for Topic Outlines (an example, not a template):
Research Objectives
· Briefly describe the overall concept of system integration.
· Discuss the traditional approach of big-bang integration including the major advantages and disadvantages of this approach.
· Discuss the traditional approaches of top-down and bottom-up integration and their major advantages and disadvantages.
· Discuss the traditional approach of mixed integration, combining the desirable advantages from the top-down and bottom-up integration approaches.
Questions
1. Why is system integration an important step in the software development process?
2. Why has big-bang integration not survived as a useful testing method?
3. Why have top-down and bottom-up integration not been replaced by more modern methods?
4. Why would you use mixed integration all the time rather than sometimes using top-down and bottom-up integration exclusively?
References
1. Herath, T. , & Rao, H. (2012). Encouraging information security behaviors in the best organizations: Role of penalties, pressures, and potential effectiveness. Descision Support Systems, 47(2), 154-165.
2. Testing Computer Software, 2nd Edition, by Cem Kaner
3. Anderson, R. (2008). Security Engineering: A Guide to Building Dependable Distributed Systems (2nd ed.). Cambridge, MA: Wiley.
During your research, if any substantial changes to your objective(s) are necessary, or a topic change is required, communicate with your instructor via email.
The Policy Research Paper: Topic Proposal and Outline is due by 11:59 p.m. (ET) on Sunday of Module/Week 2.
The Technology Research Paper: Topic Proposal and Outline is due by 11:59 p.m. (ET) on Sunday of Module/Week 5.
Quantitative Reasoning 2 Project
Shawn Cyr
MTH/216
01/16/2019
Mr. Kim
Running head: QUANTITATIVE REASONING 2 PROJEC.
CSCI 561 DB Standardized Rubric50 PointsCriteriaLevels of .docxmydrynan
CSCI 561 DB Standardized Rubric
50 Points
Criteria
Levels of Achievement
Content
Advanced
Proficient
Developing
Not present
Thread (19 pts.)
Student effectively answers the questions with supporting material from the week’s reading with thoughtful analysis. Christian worldview integration found, supported by scripture.
19 to 17 points*
Student’s post effectively answers both questions in the discussion board by thoroughly analyzing material presented by the course readings (internal sources) as well as other academically approved sources (external). Post shows a thorough interaction with material in a thought-provoking manner to encourage class interaction.
16 points*
Student’s post effectively answers the key points of both questions in the discussion board. Post reveals interaction with course readings (internal) sources or other academically approved (external) sources. Post shows proficient interaction with material in logical manner so as to encourage class interaction.
15 to 1 points*
Student’s post answers all or most of the key points of both questions in the discussion board. Post reveals interaction with some course (internal) sources or other (external) sources. Post shows moderate interaction with material in logical manner which may or may not promote class interaction.
0 points
No post was made for this thread.
Reply 1 (8 pts)
Student commentary adds value to the ongoing conversation, supports thoughts with academic material. Christian worldview integration found, supported by scripture.
8 points*
Student’s reply adds notable depth to the ongoing conversation and encourages collaborative discussion among peers in a thought-provoking way. Student supports their thoughts with both course readings (internal sources) and other academically approved sources (external). Biblical integration found.
7 points*
Student’s reply adds some depth to the ongoing conversation and encourages collaborative discussion among peers in a proficient way. Student supports their thoughts with either course readings (internal sources) or other academically approved sources (external). Biblical integration found.
6 to 1 points*
Student’s reply adds minimal depth to the ongoing conversation among peers in a thought-provoking way. Student supports their thoughts with either course readings (internal sources) or other sources (external). Biblical integration may or may not be found.
0 points
No initial reply was made for this thread.
Reply 2 (8 pts)
Student commentary adds value to the ongoing conversation, supports thoughts with academic material. Christian worldview integration found, supported by scripture.
8 points*
Student’s reply adds notable depth to the ongoing conversation and encourages collaborative discussion among peers in a thought-provoking way. Student supports their thoughts with course readings (internal sources) or other academically approved sources (external). Biblical integration found.
7 points*
Student’s reply adds some depth to the .
CSCE 1040 Homework 2 For this assignment we are going to .docxmydrynan
CSCE 1040 Homework 2
For this assignment we are going to design a system to schedule drivers and
passengers for rides in the Mean Green EagleLift system
For this we will need the following entities, plus collections for each of the
entities: Driver, Passenger and Ride.
The data for a Driver will contain at least the following:
Driver Id (6 digits)
Driver Name (20 characters each for first and last name)
Vehicle Capacity ( integer value for number of passengers)
Handicapped Capable (Boolean)
Vehicle Type (compact 2 dr, sedan 4dr, SUV, Van, other)
Driver Rating (floating point value 0-5)
Available (Boolean)
Pets allowed (Boolean)
Notes (String – could include days and hours of operation, coverage area, etc)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
The data for a Passenger will contain at least:
Name (e.g. Fred Smith)
ID number (6 digits e.g. 123456)
Payment preference (cash, credit, debit)
Handicapped (Boolean)
Default rating required (floating point)
Has pets (Boolean)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
The data for a Ride (The transaction entity) will contain at least
the following:
Ride ID (8 digit value auto assigned)
Pickup location (string)
Pickup Time (Time value)
Drop-off location (string)
Size of party (whole number)
Includes pets (Boolean)
Drop-off time (Time value – entered at completion)
Status (Active, Completed, Cancelled)
Rating by customer (floating point value)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
For the collections of each of the 3 Entity Classes identified above you
will need to include the ability to:
Add
Edit
Delete
Search/Find based on appropriate criteria
Print a list of all entries in the specific collection
Print the details for a single entity (do a find first)
Print a list of all Rides for a particular Passenger
Print a list of all Rides for a Particular Driver
Print a list of all Active (future and current) Rides, all completed rides and all
cancelled rides
for the Rides collection when you add a Ride you will need to verify that
a. the Driver selected is available during the defined time period
b. the Driver selected has number of seats sufficient for the passengers
c. The Driver has the appropriate pet policy
d. The Driver has required Handicapped capability
e. the driver has at least the minimum rating preferred by the Passenger
Note that a particular Driver could have multiple assignments
as long as they do not conflict with dates or times. For this assignment
you do not need to worry about verifying availability based on starting and
ending locations.
You will also need to provide in the Rides collection the ability to
print an assignment schedule for a particular .
CSCE 509 – Spring 2019
Assignment 3 // updated 01May19
DUE: May 11, 2019 at 5 p.m.
• Two data sets available on Moodle
o {concaveData.npy, concaveTarget.npy}
o {testData.npy, testTarget.npy}
• Write TensorFlow code to perform DNN classification with three (3) classes
• Use concave*.npy for training
• Use test*.npy for test
• Data is the data matrix; Target is the labeled targets from {0, 1, 2}
• Do each of the following steps. For each step: Note the accuracy of the classification using
the test data set. Discuss the results.
1. Write TensorFlow code to perform DNN classification using default settings. Define your
own architecture with two hidden layers. Calculate the number of parameters in your
network. Do not let the number of parameters exceed the number of input samples in
concave*.npy
2. Use one or two additional layers compared to (1) but be sure that the number of
parameters do not exceed the number of input samples. Which has better accuracy
performance? Or are they about the same?
3. Write Python code to read in the data sets. Add a large constant (such as “509” or “5090”)
to each input feature. Write the data sets as files, to be read in as input sets. Repeat the
classification using the new input files with the architecture that has better performance
in (1) or (2). What is the accuracy performance for the same number of epochs? If the
accuracy performance is about the same, does it converge faster or slower or about the
same?
4. Use the given data sets as used in (1) and (2). Use either of the two architectures. Change
the tf.layers.dense() function initlialization to He initialization by using the
variance_scaling_initializer() function:
he_init = tf.contrib.layers.variance_scaling_initializer(factor=2.0)
hidden1 = tf.layers.dense(X, n_hidden1, activation=tf.nn.relu,
kernel_initializer=he_init, name=”hidden1”)
# do the same for other hidden layers
What is the accuracy performance? Compare to either (1) or (2).
5. Take the architecture from either (1) or (2). Replace the relu activation function by the
exponential linear unit (ELU). In the tf.layers.dense function, use
activation=tf.nn.elu
What is the accuracy performance? Compare to either (1) or (2) and to (4).
6. Perform batch normalization on either (1) or (2) as follows. We want to zero-center and
normalize the inputs to the activation function of each layer by learning the mean and
scales of the inputs for each layer. Modify the Python code as follows:
X = tf.placeholder(tf.float32, shape=(None, n_inputs), name=”X”)
training = tf.placeholder_with_default(False, shape=(), name=”training”)
Then in defining the hidden layers:
hidden1 = tf.layers.dense(X, n_hidden1, name=”hidden1”)
batchnorm1 = tf.layers.batch_normalization(hidden1, training=training,
momentum=0.9)
bn1_act = tf.nn.elu(batchnorm1)
hidden2 = tf.layers.dense(bn1_act, n_hidden2, name=”hidden2”)
batchnorm2 = tf.layers.batch_normalization.
CSCI 2033 Elementary Computational Linear Algebra(Spring 20.docxmydrynan
CSCI 2033: Elementary Computational Linear Algebra
(Spring 2020)
Assignment 1 (100 points)
Due date: February 21st, 2019 11:59pm
In this assignment, you will implement Matlab functions to perform row
operations, compute the RREF of a matrix, and use it to solve a real-world
problem that involves linear algebra, namely GPS localization.
For each function that you are asked to implement, you will need to complete
the corresponding .m file with the same name that is already provided to you in
the zip file. In the end, you will zip up all your complete .m files and upload the
zip file to the assignment submission page on Gradescope.
In this and future assignments, you may not use any of Matlab’s built-in
linear algebra functionality like rref, inv, or the linear solve function A\b,
except where explicitly permitted. However, you may use the high-level array
manipulation syntax like A(i,:) and [A,B]. See “Accessing Multiple Elements”
and “Concatenating Matrices” in the Matlab documentation for more informa-
tion. However, you are allowed to call a function you have implemented in this
assignment to use in the implementation of other functions for this assignment.
Note on plagiarism A submission with any indication of plagiarism will be
directly reported to University. Copying others’ solutions or letting another
person copy your solutions will be penalized equally. Protect your code!
1 Submission Guidelines
You will submit a zip file that contains the following .m files to Gradescope.
Your filename must be in this format: Firstname Lastname ID hw1 sol.zip
(please replace the name and ID accordingly). Failing to do so may result in
points lost.
• interchange.m
• scaling.m
• replacement.m
• my_rref.m
• gps2d.m
• gps3d.m
• solve.m
1
Ricardo
Ricardo
Ricardo
Ricardo
�
The code should be stand-alone. No credit will be given if the function does not
comply with the expected input and output.
Late submission policy: 25% o↵ up to 24 hours late; 50% o↵ up to 48 hours late;
No point for more than 48 hours late.
2 Elementary row operations (30 points)
As this may be your first experience with serious programming in Matlab,
we will ease into it by first writing some simple functions that perform the
elementary row operations on a matrix: interchange, scaling, and replacement.
In this exercise, complete the following files:
function B = interchange(A, i, j)
Input: a rectangular matrix A and two integers i and j.
Output: the matrix resulting from swapping rows i and j, i.e. performing the
row operation Ri $ Rj .
function B = scaling(A, i, s)
Input: a rectangular matrix A, an integer i, and a scalar s.
Output: the matrix resulting from multiplying all entries in row i by s, i.e. per-
forming the row operation Ri sRi.
function B = replacement(A, i, j, s)
Input: a rectangular matrix A, two integers i and j, and a scalar s.
Output: the matrix resulting from adding s times row j to row i, i.e. performing
the row operatio.
CSCE 3110 Data Structures & Algorithms Summer 2019 1 of .docxmydrynan
CSCE 3110 Data Structures & Algorithms Summer 2019
1 of 12
Project 3 – Hopscotch Hash Table
Due: 11:59 PM on Friday, June 21, 2019
PROGRAM DESCRIPTION
In this C++ program, you will implement an efficient hopscotch hash table that improves
on the classic linear probing algorithm. Specifically, you will use a TABLE_SIZE = 17
and use the single hash function ℎ(𝑥) = 𝑥 mod 𝑇𝐴𝐵𝐿𝐸_𝑆𝐼𝑍𝐸. You shall resolve
collisions using linear probing where the maximal length of the probe sequence (i.e.,
distance away from the original hash location) is bound by the hopscotch hash
algorithm where MAX_DIST = 4.
You shall support the following five operations that are menu driven:
1. Insert Value
2. Delete Value
3. Search Value
4. Output Table
5. Exit Program
All data shall be entered through the console and consist of integers. You may assume
valid data, though data may be out of range (i.e., zero, negative integers or possibly out
of range of menu options). Your algorithm to find the next available slot is bound by the
end of the table so that the linear probe sequence need not be circular. In other words,
you do not need to wrap around beyond the last element of the array to the first for
either the linear probe or the bound for the hopscotch algorithm. For example, if the
user attempts to insert 33 which hashes to index position 16 (i.e., 33 % TABLE_SIZE) in
the array, but an element already exists at that location, the insert will fail as there are
no more array locations beyond this to attempt to insert the element.
You must keep an item array containing the elements as well as an associated hop
array that indicates positions in the item array that are occupied with items that hash to
the same value. You should also provide specific feedback to the user on successful
operations or when an operation failed. The search should utilize the hash value and
then perhaps a linear probe of MAX_DIST – 1 index locations, but you should not
simply search the entire array to accomplish this operation. Be sure to handle the case
that requires multiple hops (i.e., using recursion) to get the value within the correct
range.
REQUIREMENTS
• Your code should be well documented in terms of comments. For example, good
comments in general consist of a header (with your name, course section, date,
and brief description), comments for each variable, and commented blocks of
code.
• Your program will be graded based largely on whether it works correctly on the
CSE machines (e.g., cse01, cse02, …, cse06), so you should make sure that
your program compiles and runs on a CSE machine.
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
CSCE 3110 Data Structures & Algorithms Summer 2019
2 of 12
• You should contact your instructor if there is any question about what is being
asked for.
• This is an individual programming assignment that must be the sole work of the
individual student. Any in
CSCI 340 Final Group ProjectNatalie Warden, Arturo Gonzalez, R.docxmydrynan
CSCI 340 Final Group Project
Natalie Warden, Arturo Gonzalez, Ricky Gaji
Introduction
As our world continues to rely on technology to store our information, issues concerning data storage and organization will arise
Association of Computing Machinery (ACM) has asked us to prepare a database through which they can easily and effectively access this information
In this project we have created a tier system of entities, established the relationships between them, and decreased redundancy by eliminating repeating attributes
Responsibility MatrixTask/PersonNatalieArturoRickyAnalysisMSER-DiagramSMRedundancySSSSQLMSLogical DesignMAnalysis DocMRelationships DocMReadMe DocSMDatabaseMSS
Software Used:
Analysis:
Google Docs - helped to bring the group together and organize all our information to make sure we were on the same page.
Google Slides- served as the main platform in which to come up with our presentation and visualize what we are going to do.
Draw.io- used to build our many ER diagrams
Database Design:
x10 web hosting- hosted our website and had the tools necessary to get started on the database
phpMyAdmin- here we created our database tables and made sure all the attribute’s data types and entity’s primary key, foreign keys, and attributes were correct.
mySQL Databases- used as relational database management system
generatedata.com-used to create “dummy” data to incorporate in the SQL testing
Analysis and Findings
Problems/Results
Final Decision
Decided to create entities for leadership
Took inspiration from University database setup
ER-Diagram
Tables
Tables
Building the ACM Database
Populated Tables
SQL/RESULTS
3
Name
Course
Date
Instructor
Benchmark - Gospel Essentials
In at least 150 words, complete your introductory paragraph with a thesis statement in which you will address each of the following six sections with at least one paragraph each.
God
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Humanity
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Jesus
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Restoration
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Analysis
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Reflection
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Conclusion
In at least 150 words, synthesize the main points, pulling the ideas of the paper together. Be sure to include citations.
References
Author, A. A., .
CSC-321 Final Writing Assignment In this assignment, you .docxmydrynan
CSC-321 Final Writing Assignment
In this assignment, you will write an article about a recent cybersecurity attack (of your choosing). The
article will include the following components:
1) Executive summary: a 1-page executive summary highlighting the potential impact and likelihood
of a similar attack against a fictional company XYZ. XYZ should be a company in a similar field
to the company attacked by the vulnerability.
a. Audience: A C-level business executive. Do not assume they will have any technical
knowledge but assume they are very interested in the economic impact of things.
b. Purpose: Provide a summary that they will use to make business decisions from. You
need to be convincing that the cost of security makes business sense.
2) Technical report: a 3-page technical report including the following topics: Introduction,
Vulnerability(s) exploited, financial impact (if applicable), social impact (if applicable),
technological impact (if applicable), political impact (if applicable), patches available/needed to
prevent these vulnerabilities (if applicable), human training needed (if applicable), comparison to
similar vulnerabilities in the past 20 years, assessment of how common the vulnerability is, and
recommendations for company XYZ to protect itself from similar vulnerabilities.
a. Audience: A Technical manager and his engineering staff. Assume a good knowledge of
computer science, engineering, and math but no specific security knowledge.
b. Purpose: Provides information to engineers at XYZ about the attack and how to prevent a
similar one against XYZ.
3) Press release: a 2-page article for popular consumption (think wired). This should explain the
vulnerability, protection, and potential impact to general audiences (users and share-holders).
a. Format: 2-page wired article. Be informative, objective, and entertaining
b. Audience: General public who are interested in technology but may have never taken a
computer science course and, almost certainly, have never taken a computer security
course.
c. Purpose: To express your understanding to a broad audience.
Choosing your topic
Your article must be about a recent computer security exploit with real world impacts. You must get your
topic approved in lab or by email before April 22nd.
Format: IEEE conference formatting with 12pt font. All page counts are precise. You should not go
over and should be no more than ¼ column under.
Press release (2 pages) Draft: Apr, 29 Due: May, 13
Lastly you are to write a two-page article for a national technical magazine, think Wired. This article is
intended for a general audience who is interested in technology but does not have formal technical
backgrounds. This article should explain the attack, its impact, how it is mitigated, and what (if
anything) the general audience should do. This article should be informative, objective, and entertaining.
Executive Summary (1 page) .
Cryptography is the application of algorithms to ensure the confiden.docxmydrynan
Cryptography is the application of algorithms to ensure the confidentiality, integrity, and availability of data, while it is at rest, in motion, or in use. Cryptography systems can include local encryptions at the file or disk level or databases. Cryptography systems can also extend to an enterprise-wide public key infrastructure for whole agencies or corporations.
The following are the deliverables for this project:
Deliverables
Enterprise Key Management Plan:
An eight- to 10-page double-spaced Word document with citations in APA format. The page count does not include figures, diagrams, tables, or citations.
Enterprise Key Management Policy:
A two- to three-page double-spaced Word document.
Lab Report:
A Word document sharing your lab experience along with screenshots.
There are seven steps to complete the project. Most steps of this project should take no more than two hours to complete. The entire project should take no more than one week to complete. Begin with the workplace scenario, and then continue to Step 1, “Identify Components of Key Management.”
When you submit your project, your work will be evaluated using the competencies listed below. You can use the list below to self-check your work before submission.
Step 1: Identify Components of Key Management
Key management will be an important aspect of the new electronic protected health information (e-PHI). Key management is often considered the most difficult part of designing a cryptosystem.
Choose a fictitious or an actual organization. The idea is to provide an overview of the current state of enterprise key management for Superior Health Care.
Review these authentication resources to learn about
authentication
and the characteristics of key management.
Provide a high-level, top-layer network view (diagram) of the systems in Superior Health Care. The diagram can be a bubble chart or Visio drawing of a simple network diagram with servers. Conduct independent research to identify a suitable network diagram.
Read these resources on
data at rest
, data in use, and
data in motion
.
Identify data at rest, data in use, and data in motion as it could apply to your organization. Start by focusing on where data are stored and how data are accessed.
Review these resources on insecure handling, and identify areas where
insecure handling
may be a concern for your organization.
Incorporate this information in your key management plan.
In the next step, you will consider key management capabilities.
Step 3: Identify Key Management Gaps, Risks,
Solution
s, and Challenges
In the previous step, you identified the key components of an enterprise key management system. In this step, you will conduct independent research on key management issues in existing organizations. You will use this research to help identify gaps in key management, in each of the key management areas within Superior Health Care.
Conduct independent research to identify typical gaps in key manage.
CSc3320 Assignment 6 Due on 24th April, 2013 Socket programming .docxmydrynan
CSc3320 Assignment 6 Due on 24th April, 2013
Socket programming code (server.c & client.c) demoed in class implement a server-client communication by socket. The server sets up a socket and waits for communication request from a client. The client tries to connect to server and asks user for a message to send to server after the connection established. Server then accepts the communication, reads the message, displays it and send confirmation message to the client. The client reads confirmation from server and displays it too.
Please modify the server.c such that the server can carry out the same communication with
3
clients. It creates a child process (fork()) every time a communication request from one client arrives and continues to wait to serve the next client. This child process takes care of reading message/sending confirmation from/to the corresponding client and terminates with the exit code 0. After serving all 3 clients, the server needs to accept (wait()) termination of all child processes it created. Server prints out message about the child process ID and the exit code every time it accepts the termination of a child process (eg. “A child with PID 1959 terminated with exit code 0”).
Client.c
#include
#include
#include
#include
#include
#include
#include
#include
void error(const char *msg)
{
perror(msg);
exit(0);
}
int main(int argc, char *argv[])
{
int sockfd, portno, n;
struct sockaddr_in serv_addr;
struct hostent *server;
char buffer[256];
if (argc < 3) {
fprintf(stderr,"usage %s hostname port\n", argv[0]);
exit(0);
}
portno = atoi(argv[2]);
sockfd = socket(AF_INET, SOCK_STREAM, 0);
if (sockfd < 0)
error("ERROR opening socket");
server = gethostbyname(argv[1]);
if (server == NULL) {
fprintf(stderr,"ERROR, no such host\n");
exit(0);
}
bzero((char *) &serv_addr, sizeof(serv_addr));
serv_addr.sin_family = AF_INET;
bcopy((char *)server->h_addr,
(char *)&serv_addr.sin_addr.s_addr,
server->h_length);
serv_addr.sin_port = htons(portno);
//printf("h_addr: %s\n", inet_ntoa(serv_addr.sin_addr));
if (connect(sockfd,(struct sockaddr *) &serv_addr,sizeof(serv_addr)) < 0)
error("ERROR connecting");
printf("Please enter the message: ");
bzero(buffer,256);
fgets(buffer,255,stdin);
n = write(sockfd,buffer,strlen(buffer));
if (n < 0)
error("ERROR writing to socket");
bzero(buffer,256);
n = read(sockfd,buffer,255);
if (n < 0)
error("ERROR reading from socket");
printf("%s\n",buffer);
close(sockfd);
return 0;
}
Server.c
/* A simple server in the internet domain using TCP
The port number is passed as an argument */
#include
#include
#include
#include
#include
#include
#include
#include
void error(const char *msg)
{
perror(msg);
.
Read| The latest issue of The Challenger is here! We are thrilled to announce that our school paper has qualified for the NATIONAL SCHOOLS PRESS CONFERENCE (NSPC) 2024. Thank you for your unwavering support and trust. Dive into the stories that made us stand out!
Introduction to AI for Nonprofits with Tapp NetworkTechSoup
Dive into the world of AI! Experts Jon Hill and Tareq Monaur will guide you through AI's role in enhancing nonprofit websites and basic marketing strategies, making it easy to understand and apply.
The French Revolution, which began in 1789, was a period of radical social and political upheaval in France. It marked the decline of absolute monarchies, the rise of secular and democratic republics, and the eventual rise of Napoleon Bonaparte. This revolutionary period is crucial in understanding the transition from feudalism to modernity in Europe.
For more information, visit-www.vavaclasses.com
Model Attribute Check Company Auto PropertyCeline George
In Odoo, the multi-company feature allows you to manage multiple companies within a single Odoo database instance. Each company can have its own configurations while still sharing common resources such as products, customers, and suppliers.
2024.06.01 Introducing a competency framework for languag learning materials ...Sandy Millin
http://sandymillin.wordpress.com/iateflwebinar2024
Published classroom materials form the basis of syllabuses, drive teacher professional development, and have a potentially huge influence on learners, teachers and education systems. All teachers also create their own materials, whether a few sentences on a blackboard, a highly-structured fully-realised online course, or anything in between. Despite this, the knowledge and skills needed to create effective language learning materials are rarely part of teacher training, and are mostly learnt by trial and error.
Knowledge and skills frameworks, generally called competency frameworks, for ELT teachers, trainers and managers have existed for a few years now. However, until I created one for my MA dissertation, there wasn’t one drawing together what we need to know and do to be able to effectively produce language learning materials.
This webinar will introduce you to my framework, highlighting the key competencies I identified from my research. It will also show how anybody involved in language teaching (any language, not just English!), teacher training, managing schools or developing language learning materials can benefit from using the framework.
Palestine last event orientationfvgnh .pptxRaedMohamed3
An EFL lesson about the current events in Palestine. It is intended to be for intermediate students who wish to increase their listening skills through a short lesson in power point.
The Roman Empire A Historical Colossus.pdfkaushalkr1407
The Roman Empire, a vast and enduring power, stands as one of history's most remarkable civilizations, leaving an indelible imprint on the world. It emerged from the Roman Republic, transitioning into an imperial powerhouse under the leadership of Augustus Caesar in 27 BCE. This transformation marked the beginning of an era defined by unprecedented territorial expansion, architectural marvels, and profound cultural influence.
The empire's roots lie in the city of Rome, founded, according to legend, by Romulus in 753 BCE. Over centuries, Rome evolved from a small settlement to a formidable republic, characterized by a complex political system with elected officials and checks on power. However, internal strife, class conflicts, and military ambitions paved the way for the end of the Republic. Julius Caesar’s dictatorship and subsequent assassination in 44 BCE created a power vacuum, leading to a civil war. Octavian, later Augustus, emerged victorious, heralding the Roman Empire’s birth.
Under Augustus, the empire experienced the Pax Romana, a 200-year period of relative peace and stability. Augustus reformed the military, established efficient administrative systems, and initiated grand construction projects. The empire's borders expanded, encompassing territories from Britain to Egypt and from Spain to the Euphrates. Roman legions, renowned for their discipline and engineering prowess, secured and maintained these vast territories, building roads, fortifications, and cities that facilitated control and integration.
The Roman Empire’s society was hierarchical, with a rigid class system. At the top were the patricians, wealthy elites who held significant political power. Below them were the plebeians, free citizens with limited political influence, and the vast numbers of slaves who formed the backbone of the economy. The family unit was central, governed by the paterfamilias, the male head who held absolute authority.
Culturally, the Romans were eclectic, absorbing and adapting elements from the civilizations they encountered, particularly the Greeks. Roman art, literature, and philosophy reflected this synthesis, creating a rich cultural tapestry. Latin, the Roman language, became the lingua franca of the Western world, influencing numerous modern languages.
Roman architecture and engineering achievements were monumental. They perfected the arch, vault, and dome, constructing enduring structures like the Colosseum, Pantheon, and aqueducts. These engineering marvels not only showcased Roman ingenuity but also served practical purposes, from public entertainment to water supply.
Embracing GenAI - A Strategic ImperativePeter Windle
Artificial Intelligence (AI) technologies such as Generative AI, Image Generators and Large Language Models have had a dramatic impact on teaching, learning and assessment over the past 18 months. The most immediate threat AI posed was to Academic Integrity with Higher Education Institutes (HEIs) focusing their efforts on combating the use of GenAI in assessment. Guidelines were developed for staff and students, policies put in place too. Innovative educators have forged paths in the use of Generative AI for teaching, learning and assessments leading to pockets of transformation springing up across HEIs, often with little or no top-down guidance, support or direction.
This Gasta posits a strategic approach to integrating AI into HEIs to prepare staff, students and the curriculum for an evolving world and workplace. We will highlight the advantages of working with these technologies beyond the realm of teaching, learning and assessment by considering prompt engineering skills, industry impact, curriculum changes, and the need for staff upskilling. In contrast, not engaging strategically with Generative AI poses risks, including falling behind peers, missed opportunities and failing to ensure our graduates remain employable. The rapid evolution of AI technologies necessitates a proactive and strategic approach if we are to remain relevant.
Final Project (Week 8) In this paper, students w.docx
1. Final Project: (Week 8)
In this paper, students will analyze and discuss small business
growth in terms of growth strategy, business forms, short and
medium term goals, financing assistance, organizational
structure and staffing needs, customers and promotion, and
ethics and social responsibility. Students are expected to apply
business and management concepts learned in our course.
By completing this assignment, students will meet the
outcome(s):
•identify the critical business functions and how they interact in
order to position the organization to be effective in the current
business environment;
•explain the importance of the integration of individuals and
systems to organizational effectiveness;
•describe the ethical and social responsibilities that confront a
business.
Required Elements of the Final Project:
•Read critically and analyze the case below, Planning for
Growth;
•Review the project description listed above and review the
final project grading rubric, which you will find in the Syllabus
and under the Course Content area of our classroom;
•In your paper, answer the following questions:
2. •What steps should Kelly take to organize and prioritize her
business growth strategy?
•What business form might make sense, given her expansion
plans, and why?
•Focusing primarily on Kelly’s short-term goals, what kind of
financial assistance might be available to Kelly? Which options
would you recommend, and why?
•How might Kelly’s staffing needs change? What kind of
organizational structure do you think Kelly’s expanded business
should have, and what is the best way for her to organize,
orient, and train her restaurant staff (e.g., functional categories,
units, teams, flat or vertical hierarchy) to meet the needs of her
new business?
•How should Kelly deal with her current customers in regard to
the change? What kind of promotion should she consider in
attracting customers to her new location?
•What are the ethical issues and potential social responsibilities
highlighted by this change? (Consider customers, employees,
the current and new communities, and other stakeholders.) How
might these issues be dealt with most appropriately?
Required Formatting of Paper:
•This report should be double spaced, 12-point font, and four to
3. five pages in length excluding the title page and reference page;
•Format in Microsoft Word or Rich Text Format (rtf);
•Title page;
•Follow this format for your paper (based on elements detailed
above)
◦Title page
◦Introduction
◦Body, in paragraph form. Use the following section headings:
◦Growth Strategy
◦Business Form
◦Financial Assistance
◦Organizational Structure and Staffing Needs
◦Customers and Promotion
◦Ethical Issues and Social Responsibility
◦Summary paragraph
◦Reference page formatted according to APA requirements.
Include at least three
•This paper is to be written in the third person. There should be
no words in the paper such as “I and we;”
In-text citations from the course material. If you use additional
sources from the Internet or the library, do not forget to use in-
text citations and include in the reference.
•You are expected to paraphrase and not use direct quotes.
•Submit the paper in your Assignment Folder.
Grading Rubric for Final Paper (26%)
4. Critical Thinking/Reasoning
9.1 points
demonstrates a high degree of critical thinking, is consistent in
accurately interpreting questions & material; provides solid
assumptions, reasoning & claims; thorough analysis &
evaluation with sound conclusions
7.74
points
shows good critical thinking; accurately interprets most
questions & material; usually identifies relevant
arguments/reasoning/claims; offers good analysis & evaluation
with fairly sound conclusions
6.83
points
shows occasional critical thinking; questions & material is at
times accurately interpreted; arguments/reasoning/claims are
occasionally explained; offers fair analysis & evaluation with a
conclusion
5.92
points
shows little critical thinking, misinterprets questions or
material; ignores or superficially evaluates; justifies little and
seldom explains reasoning; draws unwarranted conclusions
5.01
points
lacks critical thinking consistently offers biased interpretations;
ignores or superficially evaluates; argues using poor reasoning,
and/or unwarranted claims
Application of Concepts/Development
9.1 points
arguments or positions are well-supported with evidence from
the readings/experience; ideas go beyond the course material
and recognize implication and extensions of the material and
concepts
5. 7.74 points
arguments or positions are mostly supported by evidence from
the readings and course content; ideas presented demonstrate
student’s understanding of the material and concepts
6.83 points
arguments are more often based on opinion or unclear views
than on position grounded in the readings of material or
external sources of material
5.92 points
arguments are frequently illogical and unsubstantiated; student
may resort to ad hominem attacks on the author instead of
making meaningful application of the material
5.01 points
a meaningful attempt to explain or support ideas does not exist
Attention to Instructions
3.9 points
demonstrated full understanding of requirements; responded to
each aspect of assignment
3.32 points
demonstrated understanding of requirements; missed one minor
aspect of assignment
2.93 points
demonstrated some understanding of requirements; missed a key
element or two minor aspects of assignment
2.54 points
failed to show a firm understanding of requirements; missed two
key elements or several minor aspects of assignment
2.15 points
did not demonstrate understanding of assignment requirements
Clarity; including grammar
2.6 points
writing is clear and easy to follow; grammar and spelling are all
correct; formatting gives a professional look and adds to
readability
6. 2.21 points
most ideas are presented clearly; occasional spelling and/or
grammar issues
1.95 points
wordy; some points require rereading to understand fully; more
than an occasional spelling and/or grammar
1.69 points
unclear and difficult to understand; frequent spelling and
grammar issues
1.43 points
largely incomprehensible writing/poorly written in terms of
mechanics and structure
Adherence to APA style (6th ed.)
1.3 points
no APA style errors
1.11 points
attempts in-text citation and reference list but 1 or 2 APA style
errors are present
0.98 points
attempts in-text citation and reference list; APA style errors are
present; inconsistencies in citation usage can be found
throughout the document
0.85 points
attempts either in-text citation or reference list but omits the
other
0.72 points
no attempt at APA style