This document summarizes research on the expression of the Imp (IGF-II mRNA binding protein) gene during Drosophila spermatogenesis. Four GFP-tagged protein traps were found to express GFP in the tail ends of elongating sperm cysts and in pre-meiotic germ cells at the tip of the testis, suggesting roles for Imp in sperm elongation and early spermatogenesis. Further analysis revealed that all four protein traps contained insertions within the Imp gene. Additionally, an Imp enhancer trap line expressed β-galactosidase in the pre-meiotic cells at the tip of the testis, suggesting that Imp is transcribed in these cells. The results point to roles for Imp in both sperm

1. ©
2008LANDESBIOSCIENCE.DONOTDISTRIBUTE.
Fly 2008; Vol. 2 Issue 1
Drosophila spermatogenesis results in the production of
­sixty‑four ~2-mm spermatozoa from an individual founder cell.
Little is known, however, about the elongation of spermatids to such
an extraordinary length. In a partial screen of a GFP-tagged protein
trap collection, four insertions were uncovered that exhibit expres‑
sion toward the tail ends of spermatid cysts and within the apical
tip of the testis, suggesting that these protein traps may represent
genes involved in spermatid elongation and pre-meiotic spermato‑
genesis, respectively. Inverse PCR followed by cycle sequencing
and BLAST revealed that all four protein traps represent insertions
within Imp (IGF-IImRNA binding protein), a known translational
regulator. Testis enhancer trap analysis also reveals Imp expression
in the cells of the apical tip, suggesting transcription of Imp prior
to the primary spermatocyte stage. Taken together, these results
suggest a role for Imp in the male germline during both spermatid
elongation and premeiotic spermatogenesis.
Introduction
Cellular extension and elongation mechanisms are related processes
necessary for cellular spreading via filopodia and lamellipodia, along
with events such as the outgrowth of axonal and dendritic processes
in neurons. Both mechanisms involve the on site translation of previ-
ously localized β-actin mRNA and the subsequent polymerization of
actin microfilaments at the site of extension. While previous studies
have focused on extension and elongation mechanisms in neurons
and cultured fibroblasts, little attention has been devoted to the
mechanisms behind the extraordinary elongation of male gametes in
certain insect species. In Drosophila, spermatid maturation occurs
within a germline syncytium defined by two somatic cyst cells, where
the sperm ­elongate to a length of up to 2 mm. Thus, Drosophila
spermatogenesis may provide a model system for the study of cellular
extension ­mechanisms.
Spermatogenesis in Drosophila begins with an anchored stem cell
population. At the apical tip of the testis, stem cells are anchored to
the hub, a group of non-dividing somatic cells. Each germline stem
cell is directly flanked by two somatic stem cells, or cyst progenitor
cells (Fig. 1A). Asymmetric division of the three stem cells results in
the formation of a spermatogenic cyst comprised of two cyst cells
encasing a gonialblast (Fig. 1B). While the cyst cells no longer divide,
the gonialblast undergoes four rounds of mitosis, resulting in 16 sper-
matogonia encased by two cyst cells (Fig. 1C). The 16 spermatogonia
then differentiate into 16 primary spermatocytes, which subsequently
enter meiosis and produce a cyst of 64 haploid spermatids.1
In the post-meiotic stages of spermatogenesis, the spermatid
nuclei condense and the flagella extend to a length of ~2 mm. The
construction of the flagella occurs as the two cyst cells become
structurally distinct from one another (Fig. 1D). The head cyst
cell remains associated with the sperm heads while the tail cyst cell
elongates along with the growing sperm tails, which elongate to a
length of almost 2 mm (Fig. 1D).1 While the mechanism behind
the elongation of the cyst has not been fully elucidated, one line
of evidence points to a requirement for the conserved oligometric
Golgi complex protein 5 (Cog5) homologue encoded by four way
stop (fws).2 While fws mutant testes exhibit ovoid cysts which fail to
elongate, these cysts appear to be filled with elongated tangled sperm
tails, suggesting that proper Golgi function and vesicular trafficking
are required for the elongation of the cyst, while flagellar elongation
is achieved separately.2
Separate lines of evidence point to a role for the actin ­cytoskeleton
during the elongation phase. As spermatid elongation initiates,
fusome‑derived α-spectrin, β-spectrin and actin become localized to
the distal tips of the spermatids.3 As elongation proceeds, α-spectrin
and β-spectrin become hexagonally organized into a honeycomb-like
elongation complex (EC) responsible for membrane deposition at the
elongating end of the cyst, while F-actin becomes distributed along
the length of the flagella, extending all the way to the distal tips of the
spermatids, where it overlaps the spectrin proteins in the EC.4 When
the EC fails to form properly, as in dynein light chain (dlc1) mutants,
Allele Report
Imp (IGF-II mRNA-binding protein) is expressed during
spermatogenesis in Drosophila melanogaster
James J. Fabrizio,1,* Christina A. Hickey,2 Cecylia Stabrawa,2 Vadim Meytes,2 Jessica A. Hutter,2 Caitlin Talbert2 and
Nadine Regis2
1Biology Department; College of Mount Saint Vincent; Bronx, New York USA; 2Biology Department; Manhattan College; Bronx, New York USA
Abbreviations: Imp, IGF-II mRNA binding protein; GFP, green fluorescent protein; LacZ, β-galactosidase; IBE, Imp-binding element;
dFXR, Drosophila fragile X-related gene; ZBP, zipcode-binding protein; PCR, polymerase chain reaction
Key words: Imp, spermatogenesis, Drosophila, sperm elongation, GFP-tagged protein traps, enhancer traps
*Correspondence to: James J. Fabrizio; Biology Department; College of Mount Saint
Vincent; 6301 Riverdale Avenue; Bronx, New York 10471 USA; Tel.: 718.405.3393;
Email: James.Fabrizio@mountsaintvincent.edu
Submitted: 05/31/07; Revised: 01/11/08; Accepted: 01/31/08
Previously published online as a Fly E-publication:
http://www.landesbioscience.com/journals/fly/article/5659
[Fly 2:1, -6; January/February 2008]; ©2008 Landes Bioscience

2. Imp is expressed during spermatogenesis
www.landesbioscience.com Fly
spermatid elongation proceeds despite defective cyst elongation and
membrane deposition, indicating that the EC, and possibly F-actin,
participate in both of these processes.4 Similar defects in elongation
and membrane deposition were also observed when F-actin distribu-
tion was perturbed in the absence of the GTPase-activating protein
RnRacGAP, suggesting a role for Rac and Rho-dependent F-actin
polymerization during elongation.5 Interestingly, since Rac and
Rho are also involved in F-actin polymerization during extension of
lamellipodia and stress fibers, respectively,6 these results suggest that
the extension of cellular processes and spermatogenic cyst elongation
may be mechanistically similar.
A growing body of evidence suggests that F-actin accumulates
at the leading edge of cellular extensions by the onsite transla-
tion of β-actin mRNA localized by members of the Imp (IGF-II
mRNA-binding protein) family. In mammals, the family consists
of three members (Imp1, Imp2 and Imp3) which all possess two
RNA-recognition motifs (RRMs) and four hnRNP K homology
(KH) domains.7 All three Imp family members are cytoplasmic
and are especially concentrated in the lamellipodia of motile cells.
For example, mammalian GFP-Imp1 has been shown previously to
localize to lamellipodia in motile NIH 3T3 cells stably expressing
GFP-Imp1.8 More interesting, however, is the fact that Imp1 exhibits
95% identity to chicken zipcode-binding protein 1 (ZBP‑1),7
which is responsible for the localization of β-actin mRNA to the
lamellipodia of motile cells,9 and rat ZBP-1, which is necessary for
β-actin mRNA localization to dendrites of cultured rat hippocampal
neurons, along with proper formation of filopodia.10 Perhaps Imp1,
like ZBP-1, is localizing β-actin mRNA to lamellipodia, and onsite
translation results in the accumulation of the F-actin microfilaments
required for lamellipodial extension.
Much less is known about the one Imp gene found in Drosophila,
which possesses the four KH domains but, unlike the mammalian
Imps, is missing the RRMs.11 While Imp is known to be expressed
throughout the Drosophila central nervous system throughout neuro-
genesis,11 expression of Imp in adult tissues had not been reported
until recently, when Imp expression was detected in the developing
oocyte using both a homozygous viable and fertile GFP-Imp protein
trap12 and immunofluorescence analysis using polyclonal antibodies
against Imp.13 During oogenesis, GFP-Imp co-localizes with oskar
(osk) mRNA at the posterior pole of the oocyte, and mutagenesis
of Imp-binding elements (IBEs) within the 3' UTR of osk mRNA
suggests that the retention and translation of osk mRNA at the poste-
rior pole of the oocyte depends on Imp. However, since null mutations
in Imp did not affect on osk mRNA localization or translation during
oogenesis, a model was proposed in which the IBEs might recognize
another undefined protein that may work cooperatively with Imp to
regulate the anchorage and translation of osk mRNA.12 Consistent
with this hypothesis, Squid, Hrp48 and Imp were recently identified
as members of a protein complex that is responsible for localizing
both oskar and gurken mRNA during oogenesis.13
Here, we report a potential role for Imp in Drosophila sper-
matogenesis. Four independent GFP-tagged protein traps within
the Imp gene reveal GFP expression at the tail end of elongating
cysts, suggesting a role for Imp in spermatid elongation. Since Imp
is thought to localize and regulate the translation of β-actin mRNA
during lamellipodial extension,8,9 and since cortical Factin within
the spermatogenic cyst overlaps the EC and appears to be required
for elongation of the cyst,4,5 perhaps a similar mechanism, where
on-site translation of β-actin mRNA at the elongating end of the
cyst provides F-actin needed for elongation, is at work during sper-
matogenesis. All four Imp protein traps also exhibit expression in the
mitotically active pre-meiotic cells at the apical tip of the testis. Since
expression of Imp has been previously reported in dividing cell popu-
lations,7,8,14 this result may suggest a role for Imp during the mitotic
divisions of spermatogenesis at the apical tip of the testis.
Results and Discussion
Four GFP-tagged protein traps reveal candidate regulators of
spermatid elongation and early-stage spermatogenesis. In order
to uncover genes involved in the post-meiotic spermatid matura-
tion, a portion of the GFP-tagged protein trap collection (113/602
stocks) was screened for GFP expression in these later stages of
spermatogenesis.15 Three protein traps on the X chromosome
(G0293X, G0171X and ZCL2884X) and one protein trap docu-
mented as an insertion on the third chromosome (ZCL0310) all
exhibited strong GFP expression at the tail ends of elongated cysts
(Fig. 2, arrowheads). GFP expression is also seen in the tightly
clustered mitotically active pre-meiotic germ cells at the apical tip
of the testis (Fig. 2, arrows), which stain brightly with Hoechst
Figure 1. Drosophila spermatogenesis. (A) Spermatogenesis begins at the
hub (black), which anchors a cluster of germline stem cells (dark blue) and
twice as many somatic stem cells, or cyst progenitor cells (green). (B) Each
stem cell divides asymmetrically to produce a spermatogenic cyst consisting
of a gonialblast (light blue) surrounded by two somatic cyst cells (yellow).
(C) Exactly four rounds of mitosis produces a cyst of 16 spermatogonia (light
blue) surrounded by the same two somatic cyst cells (yellow). For simplicity,
only one maturing spermatogenic cyst is shown. (D) Following meiosis, 64
haploid spermatids (light blue, two are shown for simplicity) remain encased
by the same two somatic cyst cells (yellow) that encased the founder goni-
alblast after the first asymmetric division. As the flagella elongate, the tail
cyst cell accommodates the growing sperm tails. The spermatogenic cyst
elongates to a length of ~2 mm.

3. Imp is expressed during spermatogenesis
Fly 2008; Vol. 2 Issue 1
33258 due to their highly condensed chromatin. Since GFP
expression observed in these protein traps is thought to accurately
recapitulate endogenous protein expression,15 these four protein
traps likely represent gene products expressed during spermatid
elongation, as well as during early, pre-meiotic spermatogenesis.
The expression patterns of the four protein traps in adult testes are
indistinguishable (Fig. 2), suggesting involvement in a common
developmental pathway.
G0293X,G0171X,ZCL2884XandZCL0310IIIareall ­insertions
within the Imp gene. Inverse PCR followed by cycle sequencing were
employed to uncover neighboring genetic units from the 5' end of
each of the P-element insertions. As shown in Table 1 and Figure 3,
G0293X, G0171X, ZCL2884X and ZCL0310 are insertions in the
Imp (IGF-II mRNA binding protein) gene.16 Interestingly, G0293X
and G0171X both represent P-elements inserted at base 10700957,
while ZCL2884X and ZCL0310 both represent P-elements inserted
at base 10700921. Moreover, all four protein traps represent inser-
tions in the same orientation within 36 bases of each other, each just
5' to the first small exon of transcripts Imp-RA, Imp-RB and Imp-
RC, which begins at base 10700886 (Table 1 and Fig. 3).16,17 Our
data are consistent with previous results since 15 other P-insertions
have already been reported in this area,17 and suggest that this region
of Imp may represent a hotspot for P-element insertions.
Since for all Imp sequences obtained, between 140 and 993 bases
were sequenced that were between 96% and 100% identical to Imp
(Table 1),16 we are confident that the sequencing data presented in
this paper are accurate. Also, since BLAST did not uncover any other
sequences with significant homology to our query, we are confident
that the four GFP-tagged protein traps represent insertions in Imp,
and not a paralog or identical site elsewhere in the genome. In addi-
tion, G0171X was previously confirmed as an insertion within Imp,15
thus lending support to our conclusion. Most interesting, however,
is the finding that ZCL0310, which was previously characterized
as an insertion on the third chromosome, is in fact an insertion in
Imp.16 Given that the 993 bases sequenced were 98% identical to
Imp (Table 1), together with both an unusually high bit score of 1810
and an expression pattern indistinguishable from the other three
Imp protein traps (Fig. 2),16 we remain convinced that ZCL0310
­represents an insertion within Imp.
In these four protein traps, however, the GFP exon is in an
intron of only five of the nine Imp transcripts (Fig. 3).17 Thus, Imp
expression, as observed using these GFP-tagged protein traps, can
only recapitulate the endogenous expression pattern of these five
Imp isoforms. It is also possible that the GFP exon alters the folding
of Imp in a way that alters its localization. Additionally, since Imp
undergoes alternative splicing,17 the GFP exon may not have been
retained in each of the predicted isoforms. Taken together, the expres-
sion pattern documented in the present study awaits confirmation by
immunolocalization. It is interesting to note, however, that similar
Imp localization patterns were observed in the Drosophila ovary
using both GFP-tagged protein traps12 and ­immunolocalization,13
thus lending support to the value of protein trap data.
Imp is transcribed in the cells of the apical tip of the testis.
To begin to elucidate the pattern of Imp transcription in the testis,
a P{LacW} Imp enhancer trap line (#130, gift of S. DiNardo) was
obtained.18 While enhancer trap analysis is limited by its inability to
directly and individually detect the nine alternate transcripts of Imp
(Fig. 3), it provides an initial window into understanding the transcrip-
tional regulation of Imp. To confirm that the enhancer trap line was
indeed an insertion within Imp, inverse PCR was employed to isolate
DNA from the 5' end of the P{LacW} insertion as described above
(see Materials and Methods). Cycle sequencing results confirmed that
the enhancer trap represented an insertion within Imp (Table 1 and
Fig. 3).16,17 Since, in this enhancer trap, P{LacW} inserted 20 bases
away from both G0293X and G0171X and is oppositely oriented to
P{EP} in both protein traps (Fig. 3),17 the fact that the 20 bases of 5'
flanking sequence sequences of both G0293X and G0171X are reverse
complements of the 20 bases of isolated enhancer trap sequence
(Table 1)16 confirms our mapping data.
Sincemostproteinsexpressedduringpost-meiotic ­spermatogenesis
are translated from mRNAs that were transcribed during the
primary spermatocyte stage,1 we expected to observe LacZ expres-
sion in pre-meiotic spermatocytes. In addition, since Imp protein
expression is also seen in the pre-meiotic dividing cells of the testis
apical tip (Fig. 2, arrows), we also anticipated LacZ staining prior
to spermatocyte formation. In order to address these possibili-
ties, immunofluorescence analysis of Imp enhancer trap testes was
performed using anti-β galactosidase antibodies in conjunction with
Figure 2. Expression pattern of the four GFP-tagged protein traps. Testes from
GFP-tagged protein trap lines G0293X (A–C), G0171X (D–F), ZCL2884X
(G–I) and ZCL0310 III (J–L) were dissected, fixed, stained with Hoechst
33258, and visualized by epi-fluorescence microscopy. Intrinsic GFP expres-
sion (A, D, G and J) and DNA (B, E, H and K) were visualized separately
and together (C, F, I and L) in order to reveal instances of co-localization.
GFP expression is observed at the tail ends of elongated cysts (arrowheads)
in all four protein traps. GFP expression is also observed in the dividing cells
of the apical tip (arrows) which also stain brightly with the DNA-binding dye
Hoechst 33258. Additionally, the smaller arrows in (A–C) reveals the apical
tip of a separate G0293X testis that also possesses elongated cysts exhibit-
ing GFP expression (smaller arrowheads in A and C). Bar (A–C), (G–I),
150 μm. Bar (D–F), (J–L), 50 μm.

4. Imp is expressed during spermatogenesis
www.landesbioscience.com Fly
a DNA stain (see Materials and Methods)
in order to visualize the expression pattern
of the Imp enhancer trap. A cluster of
brightly-stained cells, visualized by the
DNA-binding dye Hoechst 33258 (Fig. 4B
and C), is indicative of the condensed
chromatin characteristic of the mitotically
active pre-meiotic germ cell population at
the apical tip (Fig. 1). All cells expressing
β-galactosidase were located at the apical
tip and stained brightly with Hoechst
33258 (Fig. 4A), suggesting that a subset
of Imp transcripts might show limited
expression only in pre-meiotic germ cells.
These results were further supported by
X-Gal activity staining in conjunction with
a DNA stain (data not shown). However,
since Hoechst 33258 does not distinguish
between somatic and germline nuclei, it
remains possible that Imp is also expressed
in the cyst cell nuclei of the apical tip.
Enhancer trap analysis performed in
this study suggests that Imp is transcribed
pre-meiotically in early-stage germ cells at
the apical end of the testis. However, since
splicing of Drosophila Imp may produce
up to nine distinct transcripts,17 perhaps
the various Imp transcripts are differentially
regulated in the testis, and the enhancer
trap reflects only a subset of Imp expres-
sion during spermatogenesis. For example, since this enhancer trap
is a P{LacW} insertion just upstream of Imp transcripts RA, RB
and RC (Fig. 3),17 it is likely that LacZ expression is under the
control of an enhancer that only governs the transcription of these
three smaller transcripts. As a result, the transcription of the larger
mRNA isoforms, whose translation is uncovered by the GFP-tagged
protein traps, may be controlled by a mechanism not uncovered
by the enhancer trap. Consistent with this reasoning, while it was
initially disturbing that LacZ expression was not detected at the
primary spermatocyte stage, perhaps the other larger Imp transcripts,
whose expression was not uncovered by the enhancer trap, might be
expressed in primary spermatocytes and later translated during sper-
matid elongation. The enhancer trap data thus await confirmation by
in situ hybridization using probes that distinguish between the nine
Imp transcripts. Future studies using appropriate molecular markers
will identify more precisely the Imp-expressing cells in the apical tip,
and will confirm that Imp is indeed expressed in the germline.
While the role of Imp in the Drosophila testis is not known, it is
not the only putative translational regulator expressed during sper-
matogenesis. The Drosophila homolog of the mammalian Fragile X
mental retardation protein (dFXR) encodes a putative translational
regulator expressed in spermatocytes and elongating spermatids
whose activity is required for proper axoneme formation in late-stage
spermatogenesis.19 Absence of dFXR results in semi-sterile males
that exhibit enlarged testes, disorganized, uncoiled elongated cysts, a
paucity of spermatozoa in the seminal vesicle, and aberrant protein
expression,19 suggesting possible phenotypes to consider in the event
an Imp male-sterile allele is generated. Like Imp1, the mammalian
homolog of dFXR (FMRP) binds both the β-actin zipcode and the
3'-UTR of FMR1 mRNA in COS-7 cells.20 Moreover, it appears that
Table 1 P-element insertions in Imp (bases 10,690,030–10,716,815) characterized in this study
Stock Nature Number of Percent identity 20 bases of sequence Location of these 20
of insertion bases sequenced to Imp 5' to P-element bases in genome*16
G0293X Protein trap 728 100% ggcgagagtcggtagccgag 10700957…10700976
G0171X Protein trap 520 100% ggcgagagtcggtagccgag 10700957…10700976
ZCL2884X Protein trap 231 96% atgtggacaaataagaattt 10700921…10700940
ZCL0310 Protein trap 993 98% atgtggacaaataagaattt 10700921…10700940
130 Enhancer trap 144 100% gctcggctaccgactctcgc 10700977…10700958
*Note that all insertions are between 10700921 and 10700977 (a 56 base pair range).
Figure 3. Mapping of P-element insertions used in this study.17 (A) Survey view of Imp showing the entire
gene span and the nine predicted transcripts. (B) Close-up view of Imp focusing on the area just 5' to the
first exons of the RA, RB and RC transcripts. Black arrowheads indicate the exact insertion sites of the indi-
cated P-elements. 5'–3' directionality is indicated by the direction of the black arrowheads. All P-element
insertions documented in this study are within the 56 base pair interval (10700921…10700977). The
nearest exon to these insertions belongs to Imp transcripts RA, RB and RC and begins at 10700886.

5. Imp is expressed during spermatogenesis
Fly 2008; Vol. 2 Issue 1
Imp1 and FMRP associate independently of RNA and can recruit
each other to target mRNAs,20 suggesting a cooperative interaction
between these two translational regulators. In the future, genetic
interaction studies may determine if these two putative ­translational
regulators interact during Drosophila spermatogenesis.
While the functional significance of Imp protein expression in
the testis remains uncertain, we hypothesize that the localization
of Imp to the elongating end of spermatid cysts and the localiza-
tion of Imp1/ZBP-1 to the leading edge of cellular processes, such
as dendrites and lamellipodia, are mechanistically comparable.
Since F‑actin is present at the elongating end of the spermatogenic
cyst in the EC,4 and since F-actin polymerization is required for
proper elongation of the cyst,5 perhaps Imp is responsible for the
localization of β-actin mRNA to the tail end of the elongating
spermatogenic cyst, and subsequent on-site translation of this pool
of mRNA provides the F-actin needed for the extension of the cyst.
In the future, in situ hybridization may uncover a localized pool of
β-actin transcripts at the tail end of the elongating cyst. Also, Imp
expression will be examined in spermatid elongation mutants to
further establish a connection between Imp protein localization and
spermatid elongation, and the P-elements from the Imp protein traps
will be mobilized in order to generate novel insertion mutants. It is
the hope that some of these novel Imp alleles will be male-sterile as a
result of spermatid elongation defects.
Materials and Methods
Fly husbandry. All Drosophila melanogaster cultures and crosses
were performed at 25°C. Flies were maintained using Carolina Blue
Formula 4–24 Instant Drosophila Medium and anesthetized using
FlyNap (Carolina). G0171X, G0293X (FBal0176095), ZCL2884X
and ZCL0310 were obtained through FlyTrap.15
Testis fixation and staining. Testes from 0–1-day-old males were
dissected in Drosophila Ringers and transferred immediately to a
tube of Ringers on ice. Testes were then fixed for 15 minutes at room
temperature in 4% formaldehyde in buffer B (16.7 mM KH2PO4/
K2HPO4 pH 6.8, 75 mM KCl, 25 mM NaCl, 3.3 mM MgCl2).
Following fixation, testes were rinsed three times in PTx (PBS + 0.1%
Triton X-100), washed for 30 minutes in PTx at room temperature,
stained with 1 μg/ml Hoechst 33258 in PTx and mounted in 90%
glycerol. Alternatively, testes were blocked in PTB (3% BSA + 0.01%
sodium azide in PTx), and incubated overnight at 4 degrees celsius
in anti-Beta-Galactosidase antibody (1:500 in PTB). Following three
rinses and two 30 minute washes in PTx, testes were incubated for
1 hour at room temperature in secondary antibody (anti-mouse
Alexa 594, Molecular Probes, 1:400 in PTB). Testes were then
rinsed, washed, stained with Hoechst, and mounted as above. Slides
were observed using a Nikon Eclipse 80i ­e­pi‑fluorescence microscope
with a digital camera attachment.
Inverse PCR and cycle sequencing of P element insertions.
Methods were performed as prescribed by Berkeley Drosophila
Genome Project Resources (http://www.fruitfly.org/about/methods/
inverse.pcr.html). Briefly, since the four GFP-tagged protein traps
used in this study (G0293X, G0171X, ZCL2884X and ZCL0310 III)
were all generated using the P{EP} element, the same primers and
reaction conditions were employed to isolate neighboring genetic
units from the 5' end of each insertion The enhancer-detector line
used in this study (#130, gift of Stephen DiNardo) was generated
using the P{LacW} element, which required different PCR primers
and reaction conditions to amplify neighboring genetic units from
its 5' end. For each insertion, total genomic DNA was isolated
and digested with Msp1 (for G0293X and G0171X), Sau3A1 (for
ZCL2884X) or HinP1 1 (for ZCL0310 and enhancer-detector line
130). Following ligation and inverse PCR, PCR products were puri-
fied and sent out for cycle sequencing, and the sequence obtained was
then BLASTed against the Drosophila genome using Flybase.16 Cycle
sequencing was performed by Genewiz, Inc. and Retrogen, Inc.
Acknowledgements
We gratefully acknowledge Stephen DiNardo and Lynn Cooley
for supplying fly stocks. The anti-Beta-Galactosidase antibody was
obtained from the Developmental Studies Hybridoma Bank at the
University of Iowa. This work was supported by N.I.H. A.R.E.A.
1R15GM072548-01.
References
1. Fuller MT. Spermatogenesis. In: Martinez Arias A, Ed. The Development of Drosophila
melanogaster, Vol. 1. Cold Spring Harbor, NY: Cold Spring Harbor Press, 1993; 71-147.
2. Farkas RM, Giansanti MG, Gatti M, Fuller MT. The Drosophila Cog5 homologue is
required for cytokinesis, cell elongation and assembly of specialized Golgi architecture dur-
ing spermatogenesis. Mol Biol Cell 2003; 14:190-200.
3. Hime GR, Brill JA, Fuller MT. Assembly of ring canals in the male germ line from structural
components of the contractile ring. J Cell Sci 1996; 109:2779-88.
4. Ghosh Roy A, Kulkarni M, Kumar V, Shirolikar S, Ray K. Cytoplasmic dynein-dynactin
complex is required for spermatid growth but not axoneme assembly in Drosophila. Mol
Biol Cell 2004; 15:2470-83.
5. Bergeret E, Pignot Paintrand I, Guichard A, Raymond K, Fauvarque MO, Cazemajor M,
Griffin Shea R. RotundRacGAP functions with Ras during spermatogenesis and retinal
differentiation in Drosophila melanogaster. Mol Cell Biol 2001; 21:6280-91.
6. Nobes CD, Hall A. Rho, rac, and cdc42 GTPases regulate the assembly of multimolecular
focal complexes associated with actin stress fibers, lamellipodia, and filopodia. Cell 1995;
81:53-62.
Figure 4. Imp is expressed in cells of the apical tip. Testes from enhancer
trap line 130 were dissected, fixed, processed for immunofluorescence using
anti-β-galactosidase (LacZ) antibodies (A), and counterstained with Hoechst
33258 to visualize DNA (B). Anti-β-galactosidase antibody stain (arrowhead
in A) is coincident with the pre-meiotic germ cells of the apical tip (arrow-
head in B). The merged image is shown in (C). Bar, 30 μm.

6. Imp is expressed during spermatogenesis
www.landesbioscience.com Fly
7. Nielsen J, Christiansen J, Lykke Andersen J, Johnsen AH, Wewer UM, Nielsen FC. A fam-
ily of Insulin-like Growth Factor II mRNA-binding Proteins represses translation in late
development. Mol Cell Biol 1999; 19:1262-70.
8. Nielsen FC, Nielsen J, Kristensen MA, Koch G Christiansen J. Cytoplasmic trafficking of
IGF-II mRNA-binding Protein by conserved KH domains. J Cell Sci 2002; 115:2087-97.
9. Ross AF, Oleynikov Y, Kislauskis EH, Taneja KL, Singer RH. Characterization of a beta-
actin mRNA zipcode-binding protein. Mol Cell Biol 1997; 17:2158-65.
10. Eom T, Antar LN, Singer RH, Bassell G. Localization of a β-actin messenger ribonucleo-
protein complex with zipcode-binding protein modulates the density of dendritic filopodia
and filopodial synapses. J Neurosci 2003; 23:10433-44.
11. Nielsen J, Nielsen FC, Jakobsen RK, Christiansen J. The biphasic expression of IMP/Vg-1-
RBP is conserved between vertebrates and Drosophila. Mech Dev 2000; 96:129-32.
12. Munro TP, Kwon S, Schnapp BJ, St. Johnston D. A repeated IMP-binding motif controls
oskar mRNA translation and anchoring independently of Drosophila IMP. J Cell Biol 2006;
172:577-88.
13. Geng C, MacDonald PM. Imp associates with squid and Hrp48 and contributes to local-
ized expression of gurken in the oocyte. Mol Cell Biol 2006; 26: 9508-16.
14. Runge S, Nielsen FC, Nielsen J, Lykke Anderson J, Wewer UM, Christiansen J. H19 RNA
binds four molecules of Insulin-like Growth Factor II mRNA-binding Protein. J Biol Chem
2000; 275:29562-9.
15. Morin X, Daneman R, Zavortink M, Chia W. A protein trap strategy to detect GFP-tagged
proteins expressed from their endogenous loci in Drosophila. Proc Natl Acad Sci 2001;
98:15050-5.
16. Celniker SE, Wheeler DA, Kronmiller B, Carlson JW, Halpern A, Patel S, Adams M,
Champe M, Dugan SP, Frise E, Hodgson A, George RA, Hoskins RA, LavertyT, Muzny DM,
Nelson CR, Pacleb JM, Park S, Pfeiffer BD, Richards S, Sodergren EJ, Svirskas R, Tabor PE,
Wan K, Stapleton M, Sutton GG, Venter C, Weinstock G, Scherer SE, Myers EW, Gibbs RA,
Rubin GM. Finishing a whole genome shotgun: Release 3 of the Drosophila melanogaster
euchromatic genome sequence. Genome Biology 2002; 3:1-14
17. Grumbling G, V. Strelets and The FlyBase Consortium FlyBase: Anatomical data, images
and queries. Nucleic Acids Research 2006; 34:D484-8; doi:10.1093/nar/gkj068.
18. Gönczy P, Viswanathan S, DiNardo S. Probing spermatogenesis in Drosophila with P-ele-
ment enhancer detectors. Development 1992; 114:89-98.
19. Zhang YQ, Matthies HJG, Mancuso J, Andrews HK, Woodruff E, Friedman D, Broadie K.
The Drosophila fragile X-related gene regulates axoneme differentiation during spermato-
genesis. Dev Biol 2004; 270:290-307.
20. Rackham O, Brown CM. Visualization of RNA-protein interactions in living cells: FMRP
and IMP1 interact on mRNAs. EMBO J 2004; 23:3346-55.