Resource Below OMeara, J. G. (2010) article in this weeks Ele.docxmackulaytoni
This document summarizes an article about Wisconsin's new compassionate release legislation. The new law expands eligibility and streamlines the process for releasing elderly or terminally ill prisoners. It shifts decision making from sentencing courts to an administrative panel. While the law aims to reduce costs, it may unintentionally burden families and communities by releasing inmates without additional support. For the law to truly serve the public interest, it must consider rehabilitation, savings, and the "compassionate" goal of reducing suffering for inmates at the end of life.
Mental Health Tribunal Powers: Final Report on Part V of Mental Health Act 1983Anselm Eldergill
This is the final report of the Tribunal, Hospital Managers and Safeguards Working Group on the Reform of Part V of the Mental Health Act 1983 (which deals with a Mental Health Tribunal's powers). I chaired the Working Group, which formed part of the Independent Review of the Mental Health Act Tribunal chaired by Sir Simon Wesseley. Some of our recommendations were accepted and found their way into the final report of the Independent Review; others did not. Perhaps the main disappointments were that two fairly straightforward recommendations were not incorporated in the report: that the tribunal's discretionary power of discharge should be restored to what was intended by Parliament, and that tribunals dealing with a restricted case should be obliged to discharge the restrictions if they are no longer necessary to protect the public from serious harm.
The document discusses the history and philosophy of probation. It begins by defining probation as a period of supervision over an offender ordered by the court as an alternative to prison time. The document then discusses the origins and development of probation in the US and UK dating back to the 19th century. It provides details on key acts and developments that established probation systems and the role of probation officers in both countries over time.
4. Medical Care Provided in State PrisonsStephen Weiss
This document provides an overview of medical care costs for prisoners in Virginia state prisons. It finds that the annual cost of prisoner medical care has risen from $155 million in 2012 to $192 million in 2016, increasing from 15.02% to 16.40% of total corrections spending. The increase is partly due to a 2014 settlement requiring improvements to medical care at Fluvanna prison. The document also reviews Virginia's mix of state-run and privately contracted medical care, finding about half of prisoners receive care from private vendors.
https://www.homeworksimple.com/downloads/cjus-320-midterm-answers/
For answers, click link above or link in the description
Liberty CJUS 320 Midterm Answers
Which is NOT one of the three most important reasons for effective jail classification systems?
During the 1900s, prisoners served set amounts of time in crowded prisons, with little emphasis on rehabilitation or preparation for release.
About how many more jails are there in the United States than prisons?
Which of the following is the process during which officials determine whether a juvenile case should be dismissed, handled informally, or referred to the juvenile court?
Crime is closely linked to which of the following?
I. Race
II. Poverty and drug use
III. Lack of opportunity for legitimate economic success
Which correctional era advocated an environment that emphasized reformation, education, and vocational programs, and focused offenders' attention on the future?
Which of the following sentencing options authorized in state penal codes requires an offender to pay a fine or do community service in exchange for a waiver on jail time?
During the 1950s, the rehabilitation of offenders replaced punishment as the penal system's primary objective.
On which model is shock probation based?
The document discusses the history and justifications of criminal punishment including retribution, deterrence, incapacitation, and rehabilitation. It then covers sentencing alternatives and factors considered in sentencing such as felony vs misdemeanor crimes, presentence reports, and truth-in-sentencing laws. Finally, it briefly outlines probation, parole, the growth of the US prison population, and characteristics of those incarcerated.
This document summarizes a study of how parole boards in Kansas, Michigan, and Wisconsin make decisions about granting or denying parole. It finds that while parole boards have near total discretion legally, in practice their decisions are influenced by prior decisions made throughout the criminal justice process, like charging, plea bargaining, and sentencing. It also discusses how parole boards consider various legal and non-legal factors in their decisions, like the probability of recidivism, the inmate's rehabilitation, and administrative constraints. The information and review available to parole boards also impacts their decision-making.
This document discusses the issue of prison overcrowding in the United States. It proposes amending laws to allow alternative rehabilitation programs for non-violent drug offenders instead of incarceration. This aims to address overcrowding by reducing prison populations. Overcrowding creates unsafe and unsanitary conditions for inmates and staff. Possible solutions mentioned include increasing funding, reforming sentencing guidelines, and programs to reduce recidivism.
Resource Below OMeara, J. G. (2010) article in this weeks Ele.docxmackulaytoni
This document summarizes an article about Wisconsin's new compassionate release legislation. The new law expands eligibility and streamlines the process for releasing elderly or terminally ill prisoners. It shifts decision making from sentencing courts to an administrative panel. While the law aims to reduce costs, it may unintentionally burden families and communities by releasing inmates without additional support. For the law to truly serve the public interest, it must consider rehabilitation, savings, and the "compassionate" goal of reducing suffering for inmates at the end of life.
Mental Health Tribunal Powers: Final Report on Part V of Mental Health Act 1983Anselm Eldergill
This is the final report of the Tribunal, Hospital Managers and Safeguards Working Group on the Reform of Part V of the Mental Health Act 1983 (which deals with a Mental Health Tribunal's powers). I chaired the Working Group, which formed part of the Independent Review of the Mental Health Act Tribunal chaired by Sir Simon Wesseley. Some of our recommendations were accepted and found their way into the final report of the Independent Review; others did not. Perhaps the main disappointments were that two fairly straightforward recommendations were not incorporated in the report: that the tribunal's discretionary power of discharge should be restored to what was intended by Parliament, and that tribunals dealing with a restricted case should be obliged to discharge the restrictions if they are no longer necessary to protect the public from serious harm.
The document discusses the history and philosophy of probation. It begins by defining probation as a period of supervision over an offender ordered by the court as an alternative to prison time. The document then discusses the origins and development of probation in the US and UK dating back to the 19th century. It provides details on key acts and developments that established probation systems and the role of probation officers in both countries over time.
4. Medical Care Provided in State PrisonsStephen Weiss
This document provides an overview of medical care costs for prisoners in Virginia state prisons. It finds that the annual cost of prisoner medical care has risen from $155 million in 2012 to $192 million in 2016, increasing from 15.02% to 16.40% of total corrections spending. The increase is partly due to a 2014 settlement requiring improvements to medical care at Fluvanna prison. The document also reviews Virginia's mix of state-run and privately contracted medical care, finding about half of prisoners receive care from private vendors.
https://www.homeworksimple.com/downloads/cjus-320-midterm-answers/
For answers, click link above or link in the description
Liberty CJUS 320 Midterm Answers
Which is NOT one of the three most important reasons for effective jail classification systems?
During the 1900s, prisoners served set amounts of time in crowded prisons, with little emphasis on rehabilitation or preparation for release.
About how many more jails are there in the United States than prisons?
Which of the following is the process during which officials determine whether a juvenile case should be dismissed, handled informally, or referred to the juvenile court?
Crime is closely linked to which of the following?
I. Race
II. Poverty and drug use
III. Lack of opportunity for legitimate economic success
Which correctional era advocated an environment that emphasized reformation, education, and vocational programs, and focused offenders' attention on the future?
Which of the following sentencing options authorized in state penal codes requires an offender to pay a fine or do community service in exchange for a waiver on jail time?
During the 1950s, the rehabilitation of offenders replaced punishment as the penal system's primary objective.
On which model is shock probation based?
The document discusses the history and justifications of criminal punishment including retribution, deterrence, incapacitation, and rehabilitation. It then covers sentencing alternatives and factors considered in sentencing such as felony vs misdemeanor crimes, presentence reports, and truth-in-sentencing laws. Finally, it briefly outlines probation, parole, the growth of the US prison population, and characteristics of those incarcerated.
This document summarizes a study of how parole boards in Kansas, Michigan, and Wisconsin make decisions about granting or denying parole. It finds that while parole boards have near total discretion legally, in practice their decisions are influenced by prior decisions made throughout the criminal justice process, like charging, plea bargaining, and sentencing. It also discusses how parole boards consider various legal and non-legal factors in their decisions, like the probability of recidivism, the inmate's rehabilitation, and administrative constraints. The information and review available to parole boards also impacts their decision-making.
This document discusses the issue of prison overcrowding in the United States. It proposes amending laws to allow alternative rehabilitation programs for non-violent drug offenders instead of incarceration. This aims to address overcrowding by reducing prison populations. Overcrowding creates unsafe and unsanitary conditions for inmates and staff. Possible solutions mentioned include increasing funding, reforming sentencing guidelines, and programs to reduce recidivism.
The document discusses prison rules and open prisons. It provides details on:
1) Prison rules that govern the administration of prisons and treatment of inmates, including requirements for record keeping, segregation of inmates, living conditions, medical care, and visitation.
2) The concept of open prisons, which aim to rehabilitate inmates through reduced security, work programs, and preparation for release.
3) The definition and origins of open prisons, tracing their development from England in the early 20th century to promote rehabilitation over punishment.
This document discusses parole, its history, and issues related to reentry of offenders. It covers topics such as the definition and types of parole, the development of parole in the US and England, characteristics of parolees, arguments around whether parole is effective, and challenges with reintegration of offenders. It also addresses related topics such as reentry courts, community policing, and debates around abolishing parole boards.
The executive order aims to phase out federal reliance on privately operated criminal detention facilities. It notes that over 2 million people are incarcerated in the US, disproportionately people of color, and that private prisons do not provide the same level of safety, security, rehabilitation or correctional services as federal facilities. The order directs the Attorney General not to renew Department of Justice contracts with private prison operators, in line with applicable law, to help reduce profit-based incentives for mass incarceration and ensure just and humane treatment of those in the criminal justice system.
The survey found that the actual costs of operating jails are higher than typically reported for three key reasons: (1) Jail budgets do not include expenses paid by other county agencies like employee benefits, medical care, and education programs for inmates; (2) Personnel costs, which make up the majority of jail spending, rise as inmate populations increase requiring more guards and staff; (3) County general funds, not just corrections budgets, ultimately pay for the full costs of incarceration in local jails. The findings provide a more accurate picture of the true taxpayer costs of incarceration to help policymakers make more informed decisions.
This document discusses community-based corrections and alternatives to incarceration in the Philippines criminal justice system. It outlines advantages of community-based corrections like keeping family units intact and reducing costs. It also describes indigenous community dispute resolution systems and the roles of various agencies in early prisoner release programs. Key concepts covered include parole, pardon, amnesty, reprieve, and communication of sentences. Eligibility requirements for different types of executive clemency are provided.
The document discusses probation as an alternative to imprisonment in India. It provides context on the historical development of probation laws and highlights some key differences between the Probation of Offenders Act and the Code of Criminal Procedure. It also outlines the procedure for probation services, benefits of probation, criticisms against it, and challenges to effective implementation in India, such as lack of supervision requirements and courts not considering probation officer reports.
The document discusses issues facing India's criminal justice system, particularly related to under-trial prisoners. It notes that 64.7% of pending criminal cases relate to under-trials, leading to overcrowded prisons and human rights violations. Suggestions are made to address ineffective identification and classification of prisoners, infrastructure inadequacies, outdated prison manuals, and issues with bail provisions. A framework is proposed focusing on logistical and procedural reforms, improving prison administration and accountability, and changing to view prisoners as humans requiring rehabilitation rather than just punishment. Overall the aim is to provide timely, expeditious justice to under-trials while respecting their fundamental rights.
The document discusses the problem of prison overcrowding in the United States and proposes abolishing mandatory minimum sentencing as a solution. It notes that prisons are overcapacity, overcrowding increases inmate stress and violence, and mandatory minimums contribute to excessive sentencing and costs. Abolishing mandatory minimums would give judges discretion over sentencing to consider individual circumstances instead of mandatory minimum punishments. This could help reduce overcrowding, costs, and racial disparities in the criminal justice system.
1) Sexual assault in prisons has been a widespread and recurring issue that was largely ignored until the passage of the Prison Rape Elimination Act (PREA) in 2003. The PREA established guidelines for preventing and responding to sexual abuse in prisons.
2) Inmates have brought lawsuits under 42 U.S.C. 1983 claiming that sexual assault violates their 8th Amendment right to be free from cruel and unusual punishment. However, obstacles created by the Prison Litigation Reform Act have made it difficult for inmates to bring these cases.
3) The National Prison Rape Elimination Commission was established to further develop guidelines around prevention, reporting, and remedies. This includes improving administrative processes and helping inmates overcome barriers
http://www.cohenoalican.com
THEUNIFORM PROBATE CODEIn Court Pt. 2 off a Series with specific Interpretation for Massachusetts Elder Law.
Presented by Steven M. Cohen, Boston Medicare Attorney, Boston, Raynham and Andover Massachusetts.
REDEFINING THECriminalJusticS Y S T E MPHYLLIS BACK,.docxsodhi3
REDEFINING THE
Criminal
Justic
S Y S T E M
PHYLLIS BACK, C J
Historically, the judicial system,
law enforcement, and corrections
have each had separate goals and visions
for achieving the united mission of safety and
justice within the criminal justice commtinity. Today,
it appears that these goals have hindered the original
intent or purpose of those goals. Progressing into the second
decade of the 21st century, the criminal justice system has realized
that to achieve its ultimate mission—public safety—for its citizens, it must
be united in redefining its goals and visions. This approach requires a profound
across-the-board collaboration in a manner that thus far has not been broached.
JANUARY i FEBRUARY 2013 AMERICANjails
The contemporary criminal justice system must
respond in a proactive rather than a reactive man-
ner to provide both the necessary and immediate
sanctions for the convicted, and at the same
time ensure that victims' needs are addressed
respectfully. One way to achieve this is
to implement a program tor the sole
\
purpose ot sharing information about
all new arrests. This information
includes:
• Family history and
background.
• Delinquent offenses.
• Previous encoun-
ters with the
law.
• Prior
convictions.
• Probation or
parole mandates.
• Work history
• Education
Stable living condifions.
The strategy is to share this
information during an inmate's entire
involvement with the criminal justice
system. For the data program assessment,
an offender would be evaluated annually and
i continuum ot care established and shared with
' every participating agency—^beginning at pretrial,
following through to the completion ot any mandated
requirements of post-release sentencing. All informa-
tion pertaining to treatment interventions, including an
offender's progress and failure with his or her treatment
plans, is entered into the data program. It an offender
relapses or reotfends, the data are updated and the con-
tinuum is reestablished to help redirect as needed.
Legislative Approaches
The criminal justice system needs legislative support
tor sentencing practices such as habilitation, rehabilita-
tion, restoration, and réintégration. Criminal sanctions
that lack intervention and prevention strategies are not
a deterrent trom future criminal activity. Creating laws
that mark people as criminals tor the remainder of their
lives denies former imnates the opporttinities available
to other citizens.
To address these issues, legislators and officials estab-
lished the Public Safety Performance Project (PSPP) in
2006. The tocus of PSPP is not only to allow ex-oftenders
to return to the community as productive members of
society, but also to improve public safety. (See "Public
Safety Performance Project.")
It laws continue to limit ottenders' opportunities tor
employment (including selt-employment), education,
and housing, the criminal justice system is only fostering
further criminal behavior. As mention ...
This case involved a class action lawsuit filed by inmate Nazareth Gates against the superintendent of the Mississippi State Penitentiary alleging unconstitutional conditions and practices at the prison in violation of the First, Eighth, and Fourteenth Amendments. An investigation by the U.S. government found evidence of racial segregation, inadequate healthcare and living conditions, and brutality against inmates. The court ruled many conditions at the prison violated inmates' constitutional rights and ordered sweeping reforms to eliminate discrimination, end harsh disciplinary practices, and improve infrastructure and living conditions.
This document discusses community sentencing and probation. It begins by outlining the benefits of community sentencing, then describes the history and current use of probation. Probation involves the conditional release of an offender into the community under court supervision. The document also discusses intermediate sanctions used as alternatives to incarceration, such as house arrest, intensive supervision, fines, forfeiture, restitution, and residential community facilities.
Roche Surety and Casualty Company is the most reliable surety bonding company in Tampa. We have Professional Bail Bond Agents and Insurance Bail Bonds.
Throughout the current period of prison history, known as the perimarilynnhoare
Throughout the current period of prison history, known as the period of mass incarceration, the United States has been “the world’s leader in incarceration with 2.2 million people currently in the nation’s prisons and jails – a 500% increase over the last forty years” (Sentencing Project, 2018). This dramatic increase in prison populations over such a short period of time, coupled with the fact that prisons have been brought out from isolation and into the public view, has created an influx of nationally recognized concerns.
Review the following short introductions to several of those concerns and select 2 concerns to address in your paper.
Adequate Medical Attention:
In Estelle V. Gamble, 429 U.S. 97 (1976), the Supreme Court ruled that all incarcerated persons have a right to receive “adequate” medical attention. The failure of the state to provide such attention constitutes a violation of the Eight Amendment; namely, the cruel and unusual punishment clause. In a short article for Health Law Perspectives, Conway (2009), examines the concept of deliberate indifference as related to Estelle. As well, he discusses the conflicts that many people feel when they, as law abiding, tax paying citizens, cannot afford health insurance or to see a medical provider when needed, yet a convicted felon is given free and frequent access to medical services often times without being charged.
Administrative Segregation:
The United States Supreme Court has not banned the use of Administrative Segregation in American prisons or other places of confinement. Rather, in general, the use of such is still at the discretion of each individual state. Many correctional administrators within those states argue that administrative segregation housing is an absolute necessity. It allows agencies to maintain safe prison systems by removing the most violent or incorrigible offenders from the general population. Thus giving those offenders who wish to take advantage of programmatic and rehabilitative services the opportunity to do so. However, recently Supreme Court Justice Kennedy began to question the constitutionality of solitary confinement and administrative segregation. Furthermore, in light of the psychological and behavioral effects often attributed to long term segregated housing, there is a growing social concern over its use as a permanent management tool.
Excessive Force:
Correctional officials are often required to use force to prevent serious and imminent harm, as well as to maintain the safety and security of the correctional facility. In Whitley v. Albers, 475 U.S. 312 (1986), the Supreme Court noted that if “force was applied in a good faith effort to maintain or restore discipline,” then it does not constitute an Eight Amendment violation of cruel and unusual punishment. In Hudson v. McMillian, 503 U.S. 1 (1992), however, the Court qualified their response to ensure that the use of excessive force is clearly recognized as unconstitutional. ...
18 FEDERAL PROBATION Volume 81 Number 2Reflecting on Paro.docxaulasnilda
18 FEDERAL PROBATION Volume 81 Number 2
Reflecting on Parole’s Abolition in
the Federal Sentencing System
Douglas A. Berman
The Ohio State University
NEARLY ALL DISCUSSIONS of the
Sentencing Reform Act of 1984 (SRA) focus
on what the landmark legislation created, and
rightly so, because the SRA created so much
that has come to define the modern federal
criminal justice system. The SRA created the
U.S. Sentencing Commission, which then
created U.S. Sentencing Guidelines, which
thereafter engendered an elaborate federal
sentencing jurisprudence. But in this essay,
I wish to reflect on what the SRA abolished,
namely parole.
With ever-growing concerns about
prison growth and about prisoner recidivism
and reentry, parole and related “back-end”
sentencing mechanisms are garnering renewed
attention. My modest goal here is to bring
some of that attention to the federal system,
even though parole was formally abolished
in this system three decades ago. After briefly
reviewing parole’s history, I will suggest how
the SRA’s complete elimination of parole may
have, at least indirectly, exacerbated some
of the most problematic aspects of modern
federal sentencing. I will then highlight a
few notable recent federal sentencing
developments that have functioned as a kind
of “parole light.” Against that backdrop, this
essay closes by suggesting that advocates for
federal sentencing reform consider whether
recreating a modest, modern form of parole
might now prove an especially efficient
and effective means to improve the federal
sentencing system.
Revisiting the Rise
and Fall of Parole
Through the latter half of the nineteenth
century, progressive criminal justice reform-
ers championed a move away from capital
and corporal punishments toward the use of
imprisonment as a primary punishment for all
offenders.1 As new prisons were constructed
from coast to coast, American criminal jus-
tice systems embraced rehabilitation as the
central punishment concern and transformed
sentencing policies and practices in numerous
ways. Most fundamentally, prison sentences
became indeterminate: sentencing judges
were now to impose imprisonment terms in
ranges with prison and parole officials subse-
quently deciding exactly how long an offender
would remain incarcerated.2 Through a system
pioneered by penologist Zebulon Brockway,
offenders sentenced to prison terms of what-
ever duration could, through good behavior
and other means of demonstrating rehabili-
tation, earn early release on parole.3 While
on parole, offenders would then be closely
supervised in the community and violations
of the terms of parole could result in a return
to prison.
Indeterminate sentencing with broad
1 See generally David Rothman, Perfecting the
Prison: United States, 1789–1865, in The Oxford
History of the Prison: The Practice of
Punishment in Western Society 100, 111–29
(Norval Morris & David Rothman eds., 1995);
Edgardo Rotm ...
CA2-LECTURE-MIDTERMNOTES FOR CRIMINOLOGY_104617.pdfGrena1
It for criminology students you has a subject of institutional correction or CA2. It tacled about facilities, agencies and other organizations who are responsible for the rehabilitation and reformation of the prisoners. It also be discuss the different types of community based instructions and how it was conducted. It will also be discuss the different types of pardon, which are the absolute and conditional pardon.
This document provides an overview and summary of Virginia's public behavioral health system challenges and opportunities presented by James M. Martinez Jr., Director of the Office of Mental Health Services at DBHDS, to the Virginia Rural Health Association on December 11, 2014. The presentation discusses the current environment of behavioral health reform in Virginia, new laws affecting behavioral healthcare in the state, and DBHDS's vision, mission and transformation process. Key points include the drivers of recent reforms, current demand and utilization of services, new laws on emergency custody, temporary detention facilities, and the psychiatric bed registry.
250 words each QuestionQuestion 1. Fundamentally jails and pr.docxvickeryr87
Jails and prisons differ in their purpose and populations. Jails house individuals awaiting trial or serving short sentences locally, dealing with a transient population. Prisons incarcerate individuals convicted of state or federal crimes requiring longer sentences. While jails focus on transporting inmates to court, prisons emphasize rehabilitation through education and counseling programs due to longer incarceration periods. Both aim to prevent crime through punishment and rehabilitation.
CSIA 413 Cybersecurity Policy, Plans, and Programs.docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and Programs
June 2, 2019
Executive Summary
The Red Clay Renovations Employee Handbook is to give general rules about its strategies. The Employee Handbook will fill in as a guide for workers to get comfortable with Red Clay Renovations strategies for "Acceptable Use Policy for Information Technology", "Bring Your Own Device Policy " and "Digital Media Sanitization, Reuse, and Destruction Policy". Red Clay Renovations maintains whatever authority is needed to adjust the Employee Handbook to best suit the organization whenever with no earlier warning to its representatives.
Red Clay Renovations "Acceptable Use Policy for Information Technology" will characterize in subtleties what Acceptable Use is and what it's most certainly not. Every Employee will get his/her duty of the framework accounts, processing resources, organize utilization and will sign and consent to the approach before access is conceded to the system.
Red Clay Renovations "Bring Your Own Device Policy or BYOD" will name every one of the gadgets that are satisfactory as BYOD and the administration of the use of such gadgets. Every worker's gadgets must satisfy the arrangement guideline before actualizing the gadgets into Red Clay Renovation Company.
Red Clay Renovations "Digital Media Sanitization, Reuse, and Destruction Policy" will ensure that any worker of Red Clay Renovation who marked for the BYOD approach has/should sign this arrangement also. Workers need to comprehend the techniques the organization will use to clean off the BYOD.
Acceptable Use Policy
Introduction
This Acceptable Use Policy is for all Red Clay Renovation workers and supplants every single past version. All workers are liable to the terms and states of the Policy. The approach will build up satisfactory and inadmissible utilization of defending the security of information, secure and ensure PC and PCs, the use of system condition and servers, the utilization of electronic correspondences. Additionally Red Clay Renovation gathers, keeps up, and stores individual data to incorporate Mastercard’s, credit checks, building plans and illustrations, customers restorative and wellbeing information.
Red Clay Renovation must be in consistence with the accompanying: HIPPA Privacy and Security Rule, Freedom of Information Act (FOIA), PCI DSS, Privacy Act of 1977, Building Codes and Regulations. It is to the greatest advantage of the organization for all workers to comprehend the Acceptable Use Policy to settle on trustworthy choices before participating in inadmissible utilization of the approach. Any offense with the Acceptable Use Policy could conceivably cause Red Clay Renovation considerable loss of its business and its notorieties. On the off chance that any worker needs more data with this arrangement, they can reach out to the IT department directly.
Policy Content
Utilization of IT Systems
Red Clay Renovation possesses the property rights to all informati.
CSIS 100CSIS 100 - Discussion Board Topic #1One of the object.docxmydrynan
CSIS 100
CSIS 100 - Discussion Board Topic #1:
One of the objectives of this course is to enable students to differentiate between the disciplines of Information Systems, Information Technology, and Computer Science. Oftentimes, these areas overlap and are difficult to distinguish – even among professionals within the industries.
There are some distinctions that become evident, but all too frequently, people do not understand these distinctions until they are already deep within their programs of study. Consequently, many decide that it is too late to pursue a different avenue in the computing world without losing valuable time and money spent on courses that may or may not apply to a different major.
Given the importance of achieving effective planning from the beginning, your first assignment in this course is to delve into the broad areas of Information Systems, Information Technology, and Computer Science and write about your career choice in a discussion board post. This should be your thought process:
· First, define each field (i.e. IS, IT, CS). Understand the similarities and differences.
· Second, determine what jobs are available in each area.
· Third, look at the degree completion plans for each of these programs.
· Fourth, assess your own skills (e.g. Are you good in math? Do you like business? Do you like algorithms? Are you gifted at problem-solving? Do you like learning about new technology? Do you enjoy working hands-on with equipment/hardware/wires?)
· Fifth, (and most importantly) ask God what He wants you to pursue based on your talents, interests, and abilities.
· Sixth, based on your analysis above, what career do you hope to obtain after graduation, and what degree will you pursue to achieve this goal?
To facilitate your research, there are four videos in your Reading & Study folder that will help you understand the differences between the computing fields and become familiar with the job opportunities in each area. Be sure to view these videos first.
The LU Registrar’s home page has information on degree completion plans. Here is a link to all of the currently available ones in the university:
http://www.liberty.edu/academics/registrar/index.cfm?PID=2981
Be sure to look at all of the ones listed for Information Systems and Information Technology. At the time of this writing, Computer Science is only listed under residential degree plans. That does not mean that you should rule out Computer Science as a potential major. You must consider all options and listen to God’s calling upon your life. With God, all things are possible.
Discussion Board Deliverables
Main Post:
In a minimum of 300 words, create a thread in Module 1’s discussion board forum that describes the following:
1. Your desired career upon graduation
2. Why you chose this career
3. Your intended major
4. Your strengths, weaknesses, and interests
5. How the major supports your chosen career
6. How God has led you to reach your decision
7. A Bib.
More Related Content
Similar to F e d e r a l S e n t e n c i n g r e p o r t e r • V o l .docx
The document discusses prison rules and open prisons. It provides details on:
1) Prison rules that govern the administration of prisons and treatment of inmates, including requirements for record keeping, segregation of inmates, living conditions, medical care, and visitation.
2) The concept of open prisons, which aim to rehabilitate inmates through reduced security, work programs, and preparation for release.
3) The definition and origins of open prisons, tracing their development from England in the early 20th century to promote rehabilitation over punishment.
This document discusses parole, its history, and issues related to reentry of offenders. It covers topics such as the definition and types of parole, the development of parole in the US and England, characteristics of parolees, arguments around whether parole is effective, and challenges with reintegration of offenders. It also addresses related topics such as reentry courts, community policing, and debates around abolishing parole boards.
The executive order aims to phase out federal reliance on privately operated criminal detention facilities. It notes that over 2 million people are incarcerated in the US, disproportionately people of color, and that private prisons do not provide the same level of safety, security, rehabilitation or correctional services as federal facilities. The order directs the Attorney General not to renew Department of Justice contracts with private prison operators, in line with applicable law, to help reduce profit-based incentives for mass incarceration and ensure just and humane treatment of those in the criminal justice system.
The survey found that the actual costs of operating jails are higher than typically reported for three key reasons: (1) Jail budgets do not include expenses paid by other county agencies like employee benefits, medical care, and education programs for inmates; (2) Personnel costs, which make up the majority of jail spending, rise as inmate populations increase requiring more guards and staff; (3) County general funds, not just corrections budgets, ultimately pay for the full costs of incarceration in local jails. The findings provide a more accurate picture of the true taxpayer costs of incarceration to help policymakers make more informed decisions.
This document discusses community-based corrections and alternatives to incarceration in the Philippines criminal justice system. It outlines advantages of community-based corrections like keeping family units intact and reducing costs. It also describes indigenous community dispute resolution systems and the roles of various agencies in early prisoner release programs. Key concepts covered include parole, pardon, amnesty, reprieve, and communication of sentences. Eligibility requirements for different types of executive clemency are provided.
The document discusses probation as an alternative to imprisonment in India. It provides context on the historical development of probation laws and highlights some key differences between the Probation of Offenders Act and the Code of Criminal Procedure. It also outlines the procedure for probation services, benefits of probation, criticisms against it, and challenges to effective implementation in India, such as lack of supervision requirements and courts not considering probation officer reports.
The document discusses issues facing India's criminal justice system, particularly related to under-trial prisoners. It notes that 64.7% of pending criminal cases relate to under-trials, leading to overcrowded prisons and human rights violations. Suggestions are made to address ineffective identification and classification of prisoners, infrastructure inadequacies, outdated prison manuals, and issues with bail provisions. A framework is proposed focusing on logistical and procedural reforms, improving prison administration and accountability, and changing to view prisoners as humans requiring rehabilitation rather than just punishment. Overall the aim is to provide timely, expeditious justice to under-trials while respecting their fundamental rights.
The document discusses the problem of prison overcrowding in the United States and proposes abolishing mandatory minimum sentencing as a solution. It notes that prisons are overcapacity, overcrowding increases inmate stress and violence, and mandatory minimums contribute to excessive sentencing and costs. Abolishing mandatory minimums would give judges discretion over sentencing to consider individual circumstances instead of mandatory minimum punishments. This could help reduce overcrowding, costs, and racial disparities in the criminal justice system.
1) Sexual assault in prisons has been a widespread and recurring issue that was largely ignored until the passage of the Prison Rape Elimination Act (PREA) in 2003. The PREA established guidelines for preventing and responding to sexual abuse in prisons.
2) Inmates have brought lawsuits under 42 U.S.C. 1983 claiming that sexual assault violates their 8th Amendment right to be free from cruel and unusual punishment. However, obstacles created by the Prison Litigation Reform Act have made it difficult for inmates to bring these cases.
3) The National Prison Rape Elimination Commission was established to further develop guidelines around prevention, reporting, and remedies. This includes improving administrative processes and helping inmates overcome barriers
http://www.cohenoalican.com
THEUNIFORM PROBATE CODEIn Court Pt. 2 off a Series with specific Interpretation for Massachusetts Elder Law.
Presented by Steven M. Cohen, Boston Medicare Attorney, Boston, Raynham and Andover Massachusetts.
REDEFINING THECriminalJusticS Y S T E MPHYLLIS BACK,.docxsodhi3
REDEFINING THE
Criminal
Justic
S Y S T E M
PHYLLIS BACK, C J
Historically, the judicial system,
law enforcement, and corrections
have each had separate goals and visions
for achieving the united mission of safety and
justice within the criminal justice commtinity. Today,
it appears that these goals have hindered the original
intent or purpose of those goals. Progressing into the second
decade of the 21st century, the criminal justice system has realized
that to achieve its ultimate mission—public safety—for its citizens, it must
be united in redefining its goals and visions. This approach requires a profound
across-the-board collaboration in a manner that thus far has not been broached.
JANUARY i FEBRUARY 2013 AMERICANjails
The contemporary criminal justice system must
respond in a proactive rather than a reactive man-
ner to provide both the necessary and immediate
sanctions for the convicted, and at the same
time ensure that victims' needs are addressed
respectfully. One way to achieve this is
to implement a program tor the sole
\
purpose ot sharing information about
all new arrests. This information
includes:
• Family history and
background.
• Delinquent offenses.
• Previous encoun-
ters with the
law.
• Prior
convictions.
• Probation or
parole mandates.
• Work history
• Education
Stable living condifions.
The strategy is to share this
information during an inmate's entire
involvement with the criminal justice
system. For the data program assessment,
an offender would be evaluated annually and
i continuum ot care established and shared with
' every participating agency—^beginning at pretrial,
following through to the completion ot any mandated
requirements of post-release sentencing. All informa-
tion pertaining to treatment interventions, including an
offender's progress and failure with his or her treatment
plans, is entered into the data program. It an offender
relapses or reotfends, the data are updated and the con-
tinuum is reestablished to help redirect as needed.
Legislative Approaches
The criminal justice system needs legislative support
tor sentencing practices such as habilitation, rehabilita-
tion, restoration, and réintégration. Criminal sanctions
that lack intervention and prevention strategies are not
a deterrent trom future criminal activity. Creating laws
that mark people as criminals tor the remainder of their
lives denies former imnates the opporttinities available
to other citizens.
To address these issues, legislators and officials estab-
lished the Public Safety Performance Project (PSPP) in
2006. The tocus of PSPP is not only to allow ex-oftenders
to return to the community as productive members of
society, but also to improve public safety. (See "Public
Safety Performance Project.")
It laws continue to limit ottenders' opportunities tor
employment (including selt-employment), education,
and housing, the criminal justice system is only fostering
further criminal behavior. As mention ...
This case involved a class action lawsuit filed by inmate Nazareth Gates against the superintendent of the Mississippi State Penitentiary alleging unconstitutional conditions and practices at the prison in violation of the First, Eighth, and Fourteenth Amendments. An investigation by the U.S. government found evidence of racial segregation, inadequate healthcare and living conditions, and brutality against inmates. The court ruled many conditions at the prison violated inmates' constitutional rights and ordered sweeping reforms to eliminate discrimination, end harsh disciplinary practices, and improve infrastructure and living conditions.
This document discusses community sentencing and probation. It begins by outlining the benefits of community sentencing, then describes the history and current use of probation. Probation involves the conditional release of an offender into the community under court supervision. The document also discusses intermediate sanctions used as alternatives to incarceration, such as house arrest, intensive supervision, fines, forfeiture, restitution, and residential community facilities.
Roche Surety and Casualty Company is the most reliable surety bonding company in Tampa. We have Professional Bail Bond Agents and Insurance Bail Bonds.
Throughout the current period of prison history, known as the perimarilynnhoare
Throughout the current period of prison history, known as the period of mass incarceration, the United States has been “the world’s leader in incarceration with 2.2 million people currently in the nation’s prisons and jails – a 500% increase over the last forty years” (Sentencing Project, 2018). This dramatic increase in prison populations over such a short period of time, coupled with the fact that prisons have been brought out from isolation and into the public view, has created an influx of nationally recognized concerns.
Review the following short introductions to several of those concerns and select 2 concerns to address in your paper.
Adequate Medical Attention:
In Estelle V. Gamble, 429 U.S. 97 (1976), the Supreme Court ruled that all incarcerated persons have a right to receive “adequate” medical attention. The failure of the state to provide such attention constitutes a violation of the Eight Amendment; namely, the cruel and unusual punishment clause. In a short article for Health Law Perspectives, Conway (2009), examines the concept of deliberate indifference as related to Estelle. As well, he discusses the conflicts that many people feel when they, as law abiding, tax paying citizens, cannot afford health insurance or to see a medical provider when needed, yet a convicted felon is given free and frequent access to medical services often times without being charged.
Administrative Segregation:
The United States Supreme Court has not banned the use of Administrative Segregation in American prisons or other places of confinement. Rather, in general, the use of such is still at the discretion of each individual state. Many correctional administrators within those states argue that administrative segregation housing is an absolute necessity. It allows agencies to maintain safe prison systems by removing the most violent or incorrigible offenders from the general population. Thus giving those offenders who wish to take advantage of programmatic and rehabilitative services the opportunity to do so. However, recently Supreme Court Justice Kennedy began to question the constitutionality of solitary confinement and administrative segregation. Furthermore, in light of the psychological and behavioral effects often attributed to long term segregated housing, there is a growing social concern over its use as a permanent management tool.
Excessive Force:
Correctional officials are often required to use force to prevent serious and imminent harm, as well as to maintain the safety and security of the correctional facility. In Whitley v. Albers, 475 U.S. 312 (1986), the Supreme Court noted that if “force was applied in a good faith effort to maintain or restore discipline,” then it does not constitute an Eight Amendment violation of cruel and unusual punishment. In Hudson v. McMillian, 503 U.S. 1 (1992), however, the Court qualified their response to ensure that the use of excessive force is clearly recognized as unconstitutional. ...
18 FEDERAL PROBATION Volume 81 Number 2Reflecting on Paro.docxaulasnilda
18 FEDERAL PROBATION Volume 81 Number 2
Reflecting on Parole’s Abolition in
the Federal Sentencing System
Douglas A. Berman
The Ohio State University
NEARLY ALL DISCUSSIONS of the
Sentencing Reform Act of 1984 (SRA) focus
on what the landmark legislation created, and
rightly so, because the SRA created so much
that has come to define the modern federal
criminal justice system. The SRA created the
U.S. Sentencing Commission, which then
created U.S. Sentencing Guidelines, which
thereafter engendered an elaborate federal
sentencing jurisprudence. But in this essay,
I wish to reflect on what the SRA abolished,
namely parole.
With ever-growing concerns about
prison growth and about prisoner recidivism
and reentry, parole and related “back-end”
sentencing mechanisms are garnering renewed
attention. My modest goal here is to bring
some of that attention to the federal system,
even though parole was formally abolished
in this system three decades ago. After briefly
reviewing parole’s history, I will suggest how
the SRA’s complete elimination of parole may
have, at least indirectly, exacerbated some
of the most problematic aspects of modern
federal sentencing. I will then highlight a
few notable recent federal sentencing
developments that have functioned as a kind
of “parole light.” Against that backdrop, this
essay closes by suggesting that advocates for
federal sentencing reform consider whether
recreating a modest, modern form of parole
might now prove an especially efficient
and effective means to improve the federal
sentencing system.
Revisiting the Rise
and Fall of Parole
Through the latter half of the nineteenth
century, progressive criminal justice reform-
ers championed a move away from capital
and corporal punishments toward the use of
imprisonment as a primary punishment for all
offenders.1 As new prisons were constructed
from coast to coast, American criminal jus-
tice systems embraced rehabilitation as the
central punishment concern and transformed
sentencing policies and practices in numerous
ways. Most fundamentally, prison sentences
became indeterminate: sentencing judges
were now to impose imprisonment terms in
ranges with prison and parole officials subse-
quently deciding exactly how long an offender
would remain incarcerated.2 Through a system
pioneered by penologist Zebulon Brockway,
offenders sentenced to prison terms of what-
ever duration could, through good behavior
and other means of demonstrating rehabili-
tation, earn early release on parole.3 While
on parole, offenders would then be closely
supervised in the community and violations
of the terms of parole could result in a return
to prison.
Indeterminate sentencing with broad
1 See generally David Rothman, Perfecting the
Prison: United States, 1789–1865, in The Oxford
History of the Prison: The Practice of
Punishment in Western Society 100, 111–29
(Norval Morris & David Rothman eds., 1995);
Edgardo Rotm ...
CA2-LECTURE-MIDTERMNOTES FOR CRIMINOLOGY_104617.pdfGrena1
It for criminology students you has a subject of institutional correction or CA2. It tacled about facilities, agencies and other organizations who are responsible for the rehabilitation and reformation of the prisoners. It also be discuss the different types of community based instructions and how it was conducted. It will also be discuss the different types of pardon, which are the absolute and conditional pardon.
This document provides an overview and summary of Virginia's public behavioral health system challenges and opportunities presented by James M. Martinez Jr., Director of the Office of Mental Health Services at DBHDS, to the Virginia Rural Health Association on December 11, 2014. The presentation discusses the current environment of behavioral health reform in Virginia, new laws affecting behavioral healthcare in the state, and DBHDS's vision, mission and transformation process. Key points include the drivers of recent reforms, current demand and utilization of services, new laws on emergency custody, temporary detention facilities, and the psychiatric bed registry.
250 words each QuestionQuestion 1. Fundamentally jails and pr.docxvickeryr87
Jails and prisons differ in their purpose and populations. Jails house individuals awaiting trial or serving short sentences locally, dealing with a transient population. Prisons incarcerate individuals convicted of state or federal crimes requiring longer sentences. While jails focus on transporting inmates to court, prisons emphasize rehabilitation through education and counseling programs due to longer incarceration periods. Both aim to prevent crime through punishment and rehabilitation.
Similar to F e d e r a l S e n t e n c i n g r e p o r t e r • V o l .docx (20)
CSIA 413 Cybersecurity Policy, Plans, and Programs.docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and Programs
June 2, 2019
Executive Summary
The Red Clay Renovations Employee Handbook is to give general rules about its strategies. The Employee Handbook will fill in as a guide for workers to get comfortable with Red Clay Renovations strategies for "Acceptable Use Policy for Information Technology", "Bring Your Own Device Policy " and "Digital Media Sanitization, Reuse, and Destruction Policy". Red Clay Renovations maintains whatever authority is needed to adjust the Employee Handbook to best suit the organization whenever with no earlier warning to its representatives.
Red Clay Renovations "Acceptable Use Policy for Information Technology" will characterize in subtleties what Acceptable Use is and what it's most certainly not. Every Employee will get his/her duty of the framework accounts, processing resources, organize utilization and will sign and consent to the approach before access is conceded to the system.
Red Clay Renovations "Bring Your Own Device Policy or BYOD" will name every one of the gadgets that are satisfactory as BYOD and the administration of the use of such gadgets. Every worker's gadgets must satisfy the arrangement guideline before actualizing the gadgets into Red Clay Renovation Company.
Red Clay Renovations "Digital Media Sanitization, Reuse, and Destruction Policy" will ensure that any worker of Red Clay Renovation who marked for the BYOD approach has/should sign this arrangement also. Workers need to comprehend the techniques the organization will use to clean off the BYOD.
Acceptable Use Policy
Introduction
This Acceptable Use Policy is for all Red Clay Renovation workers and supplants every single past version. All workers are liable to the terms and states of the Policy. The approach will build up satisfactory and inadmissible utilization of defending the security of information, secure and ensure PC and PCs, the use of system condition and servers, the utilization of electronic correspondences. Additionally Red Clay Renovation gathers, keeps up, and stores individual data to incorporate Mastercard’s, credit checks, building plans and illustrations, customers restorative and wellbeing information.
Red Clay Renovation must be in consistence with the accompanying: HIPPA Privacy and Security Rule, Freedom of Information Act (FOIA), PCI DSS, Privacy Act of 1977, Building Codes and Regulations. It is to the greatest advantage of the organization for all workers to comprehend the Acceptable Use Policy to settle on trustworthy choices before participating in inadmissible utilization of the approach. Any offense with the Acceptable Use Policy could conceivably cause Red Clay Renovation considerable loss of its business and its notorieties. On the off chance that any worker needs more data with this arrangement, they can reach out to the IT department directly.
Policy Content
Utilization of IT Systems
Red Clay Renovation possesses the property rights to all informati.
CSIS 100CSIS 100 - Discussion Board Topic #1One of the object.docxmydrynan
CSIS 100
CSIS 100 - Discussion Board Topic #1:
One of the objectives of this course is to enable students to differentiate between the disciplines of Information Systems, Information Technology, and Computer Science. Oftentimes, these areas overlap and are difficult to distinguish – even among professionals within the industries.
There are some distinctions that become evident, but all too frequently, people do not understand these distinctions until they are already deep within their programs of study. Consequently, many decide that it is too late to pursue a different avenue in the computing world without losing valuable time and money spent on courses that may or may not apply to a different major.
Given the importance of achieving effective planning from the beginning, your first assignment in this course is to delve into the broad areas of Information Systems, Information Technology, and Computer Science and write about your career choice in a discussion board post. This should be your thought process:
· First, define each field (i.e. IS, IT, CS). Understand the similarities and differences.
· Second, determine what jobs are available in each area.
· Third, look at the degree completion plans for each of these programs.
· Fourth, assess your own skills (e.g. Are you good in math? Do you like business? Do you like algorithms? Are you gifted at problem-solving? Do you like learning about new technology? Do you enjoy working hands-on with equipment/hardware/wires?)
· Fifth, (and most importantly) ask God what He wants you to pursue based on your talents, interests, and abilities.
· Sixth, based on your analysis above, what career do you hope to obtain after graduation, and what degree will you pursue to achieve this goal?
To facilitate your research, there are four videos in your Reading & Study folder that will help you understand the differences between the computing fields and become familiar with the job opportunities in each area. Be sure to view these videos first.
The LU Registrar’s home page has information on degree completion plans. Here is a link to all of the currently available ones in the university:
http://www.liberty.edu/academics/registrar/index.cfm?PID=2981
Be sure to look at all of the ones listed for Information Systems and Information Technology. At the time of this writing, Computer Science is only listed under residential degree plans. That does not mean that you should rule out Computer Science as a potential major. You must consider all options and listen to God’s calling upon your life. With God, all things are possible.
Discussion Board Deliverables
Main Post:
In a minimum of 300 words, create a thread in Module 1’s discussion board forum that describes the following:
1. Your desired career upon graduation
2. Why you chose this career
3. Your intended major
4. Your strengths, weaknesses, and interests
5. How the major supports your chosen career
6. How God has led you to reach your decision
7. A Bib.
CSI Paper Grading Rubric- (worth a possible 100 points) .docxmydrynan
CSI Paper Grading Rubric- (worth a possible 100 points)
1. INTRODUCTION (10%): Identifies/summarizes the paper’s topic and states an informed
judgment about the topic.
1 2.5 5 7.5 10
DEVELOPING……………………………………................................................................DEVELOPED
Lacks an introduction that takes an overview and that states the
objectives of the paper. A brief statement of the crime and the
criminological theories that can help explain it is absent,
unfocused or very weak.
Begins with a strong introduction that lays out the crime and
its context, as well as theories that can help understand the
circumstances surrounding the crime. Also provides the
sequence of what follows clearly and concisely.
2. RESOURCES (10%): Evidence from scholarly sources and textual sources (minimum of 5 total
sources).
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………….DEVELOPED
Lists evidence but doesn’t explain how it does or doesn’t support a
point. Lacks organization or transitions. Does not completely or
correctly identify sources of information through in-text citations
and a works cited reference page.
Provides appropriate and sufficient evidence, smoothly
synthesizes evidence from sources and clearly ties it to the
point being made. Logically organizes ideas. Uses
transitions to connect one idea to the next. Correctly
identifies all sources of information through in-text
citations and a works cited reference page.
3. BODY (50%): Formulates a coherent, logical, and thoughtful sociological analysis of the crime
being investiaged. Addressed all parts of the paper assignment.
10 20 30 40 50
DEVELOPING…………………….………………………………………………………...DEVELOPED
Shows little understanding of sociological concepts and theories
used to explain the crime being investigated. No discussion at all
of any complexities or nuances related to the topic. No integration
of source information.
Identifies the circumstances of the crime with necessary
detail to perform a rigorous sociological analysis of the
crime. Shows strong understanding of the sociological
concepts and theories discussed in the paper (for example,
other perspectives and confounding factors), and discusses
how the source information is relevant.
4. CONCLUSION (10%): Identifies and assesses conclusions and implications of the sociological
analysis of your crime of the semester; sums up the importance/sociological relevance of your paper.
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………...DEVELOPED
Only restates verbatim what has already been said. Conclusion is
not related to the support in the paper or new information is
presented. Feels abrupt, unconnected, or changes the focus. Is not
persuasive.
Goes beyond summarizing your main points. Reader feels a
sense of closure in the paper and is persuaded by the
examination of your crime and use of sociological theories
to explain it. No new informati.
CSIA 413 Cybersecurity Policy, Plans, and ProgramsProject #4 IT .docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and ProgramsProject #4: IT Audit Policy and Plans Company Background & Operating Environment
Red Clay Renovations is an internationally recognized, awarding winning firm that specializes in the renovation and rehabilitation of residential buildings and dwellings. The company specializes in updating homes using “smart home” and “Internet of Things” technologies while maintaining period correct architectural characteristics. Please refer to the company profile (file posted in Week 1 > Content > CSIA 413 Red Clay Renovations Company Profile.docx) for additional background information and information about the company’s operating environment.Policy Issue & Plan of Action
The corporate board was recently briefed by the Chief Information Officer concerning the company’s IT Security Program and how this program contributes to the company’s risk management strategy. During the briefing, the CIO presented assessment reports and audit findings from IT security audits. These audits focused upon the technical infrastructure and the effectiveness and efficiency of the company’s implementation of security controls. During the discussion period, members of the corporate board asked about audits of policy compliance and assessments as to the degree that employees were (a) aware of IT security policies and (b) complying with these policies. The Chief Information Officer was tasked with providing the following items to the board before its next quarterly meeting:
(a) Issue Specific Policy requiring an annual compliance audit for IT security policies as documented in the company’s Policy System
(b) Audit Plan for assessing employee awareness of and compliance with IT security policies
a. Are employees aware of the IT security policies in the Employee Handbook?
b. Do employees know their responsibilities under those policies?
(c) Audit Plan for assessing the IT security policy system
a. Do required policies exist?
b. Have they been updated within the past year?
c. Are the policies being reviewed and approved by the appropriate oversight authorities (managers, IT governance board, etc.)?
Your Task Assignment
As a staff member supporting the CISO, you have been asked to research this issue (auditing IT security policy compliance) and then prepare an “approval draft” for a compliance policy. You must also research and draft two separate audit plans (a) employee compliance and (b) policy system audit. The audit policy should not exceed two typed pages in length so you will need to be concise in your writing and only include the most important elements for the policy. Make sure that you include a requirement for an assessment report to be provided to company management and the corporate board of directors.
· For the employee compliance assessment, you must use an interview strategy which includes 10 or more multiple choice questions that can be used to construct a web-based survey of all employees. The questions should be split.
CSI 170 Week 3 Assingment
Assignment 1: Cyber Computer Crime
Assignment 1: Cyber Computer Crime
Create a 15-slide presentation in which you:
1. Describe the responsibilities of the National Security Administration (NSA).
2. Identify the four critical needs at the state or local level of law enforcement in order to fight computer crime more effectively.
3. Explain how the U.S. Postal Service assists in the investigation and prosecution of cases involving child pornography.
4. Discuss how and why the Department of Homeland Security (DHS) consolidated so many federal offices.
5. Go to https://research.strayer.edu to locate at least three (3) quality references for this assignment. One of these must have been published within the last year.
4/15/2019 Auden, Musée des Beaux Arts
english.emory.edu/classes/paintings&poems/auden.html 1/1
Musee des Beaux Arts
W. H. Auden
About suffering they were never wrong,
The old Masters: how well they understood
Its human position: how it takes place
While someone else is eating or opening a window or just walking
dully along;
How, when the aged are reverently, passionately waiting
For the miraculous birth, there always must be
Children who did not specially want it to happen, skating
On a pond at the edge of the wood:
They never forgot
That even the dreadful martyrdom must run its course
Anyhow in a corner, some untidy spot
Where the dogs go on with their doggy life and the torturer's horse
Scratches its innocent behind on a tree.
In Breughel's Icarus, for instance: how everything turns away
Quite leisurely from the disaster; the ploughman may
Have heard the splash, the forsaken cry,
But for him it was not an important failure; the sun shone
As it had to on the white legs disappearing into the green
Water, and the expensive delicate ship that must have seen
Something amazing, a boy falling out of the sky,
Had somewhere to get to and sailed calmly on.
Pieter Brueghel, The Fall of Icarus
Oil-tempera, 29 inches x 44 inches.
Museum of Fine Arts, Brussels.
See also:
William Carlos Williams' "Landscape with the Fall of Icarus "
Return to the Poem Index
javascript:openwin('Icarus.jpg',530,330)
http://english.emory.edu/classes/paintings&poems/Williams.html
http://english.emory.edu/classes/paintings&poems/titlepage.html
1. Biographical information on Ibsen—Concluding sentence: Sub-thesis, his play and Nora.
2. Nora’s treatment by her father and Nora’s treatment by her husband Torvald.
3. Nora’s treatment by Krogstad.
4. Nora’s contrast with Christine
INTRO: Females in Conflict
Yet another voice to champion the cause of inequality of the sexes is Henrik Ibsen.
Writing at the end of the nineteenth century in Victorian Norway, his play A Doll House utilizes
the format of a playwright to convey through the use of evolving characters different political and
social messages. When analyzing A Doll House’s protagonist, Nora, her interactions with the
other characters.
CSE422 Section 002 – Computer Networking Fall 2018 Ho.docxmydrynan
CSE422 Section 002 – Computer Networking
Fall 2018
Homework 2 – 50 points
Sockets (10 points)
1. For a client-server application over TCP, why must the server program be executed before the
client program?
2. For a client-server application over UDP, why may the client program be executed before the
server program?
3. The UDP server shown in the course slides needed only one socket, whereas the TCP server
needed two sockets. Why?
4. If the TCP server were to support N simultaneous connections, each from a different client host,
how may sockets would the TCP server need?
5. You are creating an event logging service that will be handling event messages from multiple
remote clients. This service can suffer delays in message delivery and even the loss of some
event messages. Would you implement this using TCP or UDP? Why?
The HTTP GET message (10 Points)
Consider the figure below, where a client is sending an HTTP GET message to a web server,
gaia.cs.umass.edu.
Suppose the client-to-server HTTP GET message is the following:
GET /kurose_ross/interactive/quotation1.htm HTTP/1.1
Host: gaia.cs.umass.edu
Accept: text/plain, text/html, image/gif, image/jpeg, audio/basic,
audio/vnf.wave, video/mp4, video/wmv, application/*, */*
Accept-Language: en-us, en-gb;q=0.5, en;q=0.1, fr, fr-ch, zh, cs
If-Modified-Since: Wed, 10 Jan 2018 13:13:03 -0800
User Agent: Mozilla/5.0 (Windows NT 6.1; WOW64) AppleWebKit/535.11 (KHTML,
like Gecko) Chrome/17.0.963.56 Safari/535.11
Answer the following questions:
1. What is the name of the file that is being retrieved in this GET message?
2. What version of HTTP is the client running?
CSE422 Section 002 – Computer Networking
Fall 2018
3. What formats of text, images, audio, and video does the client browser prefer to receive?
[Note: for this and the following questions on browser media and language preferences, you
will need to do a bit of additional reading on the Web. Here is a good place to start.]
4. What do the strings "application/*" and "*/*" signify in the Accept: header?
5. What languages is the browser indicating that it is willing to accept? [Note: you can look at
your own browser preferences to get a listing of language codes.]
6. What is the meaning of the "relative quality factor," q, associated with the various version of
English? [Note: Here is a good place to start. See also [RFC 2616].]
7. What is the client's preferred version of English? What is the browser's least preferred
version of English?
8. Does the browser sending the HTTP message prefer Swiss French over traditional French?
Explain.
9. Does the client already have a (possibly out-of-date) copy of the requested file? Explain. If
so, approximately how long ago did the client receive the file, assuming the GET request has
just been issued?
10. What is the type of client browser and the client's operating system? [Note: To answer this,
you'll need to understan.
CSCI 132 Practical Unix and Programming .docxmydrynan
CSCI
132:
Practical
Unix
and
Programming
Adjunct:
Trami
Dang
Assignment
4
Fall
2018
Assignment 41
This set of exercises will strengthen your ability to write relatively simple shell scripts
using various filters. As always, your goals should be clarity, efficiency, and simplicity. It
has two parts.
1. The background context that was provided in the previous assignment is repeated here
for your convenience. A DNA string is a sequence of the letters a, c, g, and t in any
order, whose length is a multiple of three2. For example, aacgtttgtaaccagaactgt
is a DNA string of length 21. Each sequence of three consecutive letters is called a codon.
For example, in the preceding string, the codons are aac, gtt, tgt, aac, cag, aac,
and tgt.
Your task is to write a script named codonhistogram that expects a file name on the
command line. This file is supposed to be a dna textfile, which means that it contains
only a DNA string with no newline characters or white space characters of any kind; it is
a sequence of the letters a, c, g, and t of length 3n for some n. The script must count the
number of occurrences of every codon in the file, assuming the first codon starts at
position 13, and it must output the number of times each codon occurs in the file, sorted
in order of decreasing frequency. For example, if dnafile is a file containing the dna
string aacgtttgtaaccagaactgt, then the command
codonhistogram dnafile
should produce the following output:
3 aac
2 tgt
1 cag
1 gtt
because there are 3 aac codons, 2 tgt, 1 cag, and 1 gtt. Notice that frequency comes
first, then the codon name.
1
This is licensed under the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International
License. To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-sa/4.0/.
2
This is really just a simplification to make the assignment easier. In reality, it is not necessarily a
multiple of 3.
3
Tho.
CSCI 714 Software Project Planning and EstimationLec.docxmydrynan
This document provides an overview of work breakdown structures (WBS) and their role in project planning and management. It discusses approaches to developing WBS, basic principles for creating effective WBS, and the purpose of WBS for cost estimating, budgeting, resource planning, and other project functions. Specific topics covered include defining the scope of work, developing a hierarchy of deliverables and tasks, and using a WBS to improve scheduling, tracking, and managing changes to a project.
CSCI 561Research Paper Topic Proposal and Outline Instructions.docxmydrynan
CSCI 561
Research Paper: Topic Proposal and Outline Instructions
The easiest approach for selecting a topic for your paper might be to review the various subject areas covered in the course readings (i.e., search the bibliographies of the textbooks). Although the chosen topic must relate directly to the general subject area of this course, you are not limited to the concepts, techniques, and technologies specifically covered in this course.
Each Topic Outline must include the following 3 items:
1. A brief (at least 3–4 bullets with 1–2 sentences per bullet) overview of the research topics of your paper – you will need to address these in the actual paper. This will be titled “Research Objectives”.
2. A list of at least 3 questions (in a numbered list) you intend your research to ask and hopefully answer. These must be questions that will require you to draw conclusions from your research. These must not be questions to answer your research objectives. This section will be titled “Questions”
3. At least 3 initial research sources, 1 of which is an academic journal or other peer reviewed source. These should match APA formatting of sources.
Example formats for Topic Outlines (an example, not a template):
Research Objectives
· Briefly describe the overall concept of system integration.
· Discuss the traditional approach of big-bang integration including the major advantages and disadvantages of this approach.
· Discuss the traditional approaches of top-down and bottom-up integration and their major advantages and disadvantages.
· Discuss the traditional approach of mixed integration, combining the desirable advantages from the top-down and bottom-up integration approaches.
Questions
1. Why is system integration an important step in the software development process?
2. Why has big-bang integration not survived as a useful testing method?
3. Why have top-down and bottom-up integration not been replaced by more modern methods?
4. Why would you use mixed integration all the time rather than sometimes using top-down and bottom-up integration exclusively?
References
1. Herath, T. , & Rao, H. (2012). Encouraging information security behaviors in the best organizations: Role of penalties, pressures, and potential effectiveness. Descision Support Systems, 47(2), 154-165.
2. Testing Computer Software, 2nd Edition, by Cem Kaner
3. Anderson, R. (2008). Security Engineering: A Guide to Building Dependable Distributed Systems (2nd ed.). Cambridge, MA: Wiley.
During your research, if any substantial changes to your objective(s) are necessary, or a topic change is required, communicate with your instructor via email.
The Policy Research Paper: Topic Proposal and Outline is due by 11:59 p.m. (ET) on Sunday of Module/Week 2.
The Technology Research Paper: Topic Proposal and Outline is due by 11:59 p.m. (ET) on Sunday of Module/Week 5.
Quantitative Reasoning 2 Project
Shawn Cyr
MTH/216
01/16/2019
Mr. Kim
Running head: QUANTITATIVE REASONING 2 PROJEC.
CSCI 561 DB Standardized Rubric50 PointsCriteriaLevels of .docxmydrynan
This document outlines a rubric for grading student discussion posts and replies in an online course. It evaluates students on content, structure, and integration of biblical worldview. For the original post, students can earn up to 19 points for content and 5 points for structure. For each of two required replies, students can earn up to 8 points for content and 5 points for structure. Higher scores are given for more thorough engagement with course materials, critical analysis, and APA formatting.
CSCE 1040 Homework 2 For this assignment we are going to .docxmydrynan
CSCE 1040 Homework 2
For this assignment we are going to design a system to schedule drivers and
passengers for rides in the Mean Green EagleLift system
For this we will need the following entities, plus collections for each of the
entities: Driver, Passenger and Ride.
The data for a Driver will contain at least the following:
Driver Id (6 digits)
Driver Name (20 characters each for first and last name)
Vehicle Capacity ( integer value for number of passengers)
Handicapped Capable (Boolean)
Vehicle Type (compact 2 dr, sedan 4dr, SUV, Van, other)
Driver Rating (floating point value 0-5)
Available (Boolean)
Pets allowed (Boolean)
Notes (String – could include days and hours of operation, coverage area, etc)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
The data for a Passenger will contain at least:
Name (e.g. Fred Smith)
ID number (6 digits e.g. 123456)
Payment preference (cash, credit, debit)
Handicapped (Boolean)
Default rating required (floating point)
Has pets (Boolean)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
The data for a Ride (The transaction entity) will contain at least
the following:
Ride ID (8 digit value auto assigned)
Pickup location (string)
Pickup Time (Time value)
Drop-off location (string)
Size of party (whole number)
Includes pets (Boolean)
Drop-off time (Time value – entered at completion)
Status (Active, Completed, Cancelled)
Rating by customer (floating point value)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
For the collections of each of the 3 Entity Classes identified above you
will need to include the ability to:
Add
Edit
Delete
Search/Find based on appropriate criteria
Print a list of all entries in the specific collection
Print the details for a single entity (do a find first)
Print a list of all Rides for a particular Passenger
Print a list of all Rides for a Particular Driver
Print a list of all Active (future and current) Rides, all completed rides and all
cancelled rides
for the Rides collection when you add a Ride you will need to verify that
a. the Driver selected is available during the defined time period
b. the Driver selected has number of seats sufficient for the passengers
c. The Driver has the appropriate pet policy
d. The Driver has required Handicapped capability
e. the driver has at least the minimum rating preferred by the Passenger
Note that a particular Driver could have multiple assignments
as long as they do not conflict with dates or times. For this assignment
you do not need to worry about verifying availability based on starting and
ending locations.
You will also need to provide in the Rides collection the ability to
print an assignment schedule for a particular .
CSCE 509 – Spring 2019
Assignment 3 // updated 01May19
DUE: May 11, 2019 at 5 p.m.
• Two data sets available on Moodle
o {concaveData.npy, concaveTarget.npy}
o {testData.npy, testTarget.npy}
• Write TensorFlow code to perform DNN classification with three (3) classes
• Use concave*.npy for training
• Use test*.npy for test
• Data is the data matrix; Target is the labeled targets from {0, 1, 2}
• Do each of the following steps. For each step: Note the accuracy of the classification using
the test data set. Discuss the results.
1. Write TensorFlow code to perform DNN classification using default settings. Define your
own architecture with two hidden layers. Calculate the number of parameters in your
network. Do not let the number of parameters exceed the number of input samples in
concave*.npy
2. Use one or two additional layers compared to (1) but be sure that the number of
parameters do not exceed the number of input samples. Which has better accuracy
performance? Or are they about the same?
3. Write Python code to read in the data sets. Add a large constant (such as “509” or “5090”)
to each input feature. Write the data sets as files, to be read in as input sets. Repeat the
classification using the new input files with the architecture that has better performance
in (1) or (2). What is the accuracy performance for the same number of epochs? If the
accuracy performance is about the same, does it converge faster or slower or about the
same?
4. Use the given data sets as used in (1) and (2). Use either of the two architectures. Change
the tf.layers.dense() function initlialization to He initialization by using the
variance_scaling_initializer() function:
he_init = tf.contrib.layers.variance_scaling_initializer(factor=2.0)
hidden1 = tf.layers.dense(X, n_hidden1, activation=tf.nn.relu,
kernel_initializer=he_init, name=”hidden1”)
# do the same for other hidden layers
What is the accuracy performance? Compare to either (1) or (2).
5. Take the architecture from either (1) or (2). Replace the relu activation function by the
exponential linear unit (ELU). In the tf.layers.dense function, use
activation=tf.nn.elu
What is the accuracy performance? Compare to either (1) or (2) and to (4).
6. Perform batch normalization on either (1) or (2) as follows. We want to zero-center and
normalize the inputs to the activation function of each layer by learning the mean and
scales of the inputs for each layer. Modify the Python code as follows:
X = tf.placeholder(tf.float32, shape=(None, n_inputs), name=”X”)
training = tf.placeholder_with_default(False, shape=(), name=”training”)
Then in defining the hidden layers:
hidden1 = tf.layers.dense(X, n_hidden1, name=”hidden1”)
batchnorm1 = tf.layers.batch_normalization(hidden1, training=training,
momentum=0.9)
bn1_act = tf.nn.elu(batchnorm1)
hidden2 = tf.layers.dense(bn1_act, n_hidden2, name=”hidden2”)
batchnorm2 = tf.layers.batch_normalization.
CSCI 2033 Elementary Computational Linear Algebra(Spring 20.docxmydrynan
CSCI 2033: Elementary Computational Linear Algebra
(Spring 2020)
Assignment 1 (100 points)
Due date: February 21st, 2019 11:59pm
In this assignment, you will implement Matlab functions to perform row
operations, compute the RREF of a matrix, and use it to solve a real-world
problem that involves linear algebra, namely GPS localization.
For each function that you are asked to implement, you will need to complete
the corresponding .m file with the same name that is already provided to you in
the zip file. In the end, you will zip up all your complete .m files and upload the
zip file to the assignment submission page on Gradescope.
In this and future assignments, you may not use any of Matlab’s built-in
linear algebra functionality like rref, inv, or the linear solve function A\b,
except where explicitly permitted. However, you may use the high-level array
manipulation syntax like A(i,:) and [A,B]. See “Accessing Multiple Elements”
and “Concatenating Matrices” in the Matlab documentation for more informa-
tion. However, you are allowed to call a function you have implemented in this
assignment to use in the implementation of other functions for this assignment.
Note on plagiarism A submission with any indication of plagiarism will be
directly reported to University. Copying others’ solutions or letting another
person copy your solutions will be penalized equally. Protect your code!
1 Submission Guidelines
You will submit a zip file that contains the following .m files to Gradescope.
Your filename must be in this format: Firstname Lastname ID hw1 sol.zip
(please replace the name and ID accordingly). Failing to do so may result in
points lost.
• interchange.m
• scaling.m
• replacement.m
• my_rref.m
• gps2d.m
• gps3d.m
• solve.m
1
Ricardo
Ricardo
Ricardo
Ricardo
�
The code should be stand-alone. No credit will be given if the function does not
comply with the expected input and output.
Late submission policy: 25% o↵ up to 24 hours late; 50% o↵ up to 48 hours late;
No point for more than 48 hours late.
2 Elementary row operations (30 points)
As this may be your first experience with serious programming in Matlab,
we will ease into it by first writing some simple functions that perform the
elementary row operations on a matrix: interchange, scaling, and replacement.
In this exercise, complete the following files:
function B = interchange(A, i, j)
Input: a rectangular matrix A and two integers i and j.
Output: the matrix resulting from swapping rows i and j, i.e. performing the
row operation Ri $ Rj .
function B = scaling(A, i, s)
Input: a rectangular matrix A, an integer i, and a scalar s.
Output: the matrix resulting from multiplying all entries in row i by s, i.e. per-
forming the row operation Ri sRi.
function B = replacement(A, i, j, s)
Input: a rectangular matrix A, two integers i and j, and a scalar s.
Output: the matrix resulting from adding s times row j to row i, i.e. performing
the row operatio.
CSCE 3110 Data Structures & Algorithms Summer 2019 1 of .docxmydrynan
CSCE 3110 Data Structures & Algorithms Summer 2019
1 of 12
Project 3 – Hopscotch Hash Table
Due: 11:59 PM on Friday, June 21, 2019
PROGRAM DESCRIPTION
In this C++ program, you will implement an efficient hopscotch hash table that improves
on the classic linear probing algorithm. Specifically, you will use a TABLE_SIZE = 17
and use the single hash function ℎ(𝑥) = 𝑥 mod 𝑇𝐴𝐵𝐿𝐸_𝑆𝐼𝑍𝐸. You shall resolve
collisions using linear probing where the maximal length of the probe sequence (i.e.,
distance away from the original hash location) is bound by the hopscotch hash
algorithm where MAX_DIST = 4.
You shall support the following five operations that are menu driven:
1. Insert Value
2. Delete Value
3. Search Value
4. Output Table
5. Exit Program
All data shall be entered through the console and consist of integers. You may assume
valid data, though data may be out of range (i.e., zero, negative integers or possibly out
of range of menu options). Your algorithm to find the next available slot is bound by the
end of the table so that the linear probe sequence need not be circular. In other words,
you do not need to wrap around beyond the last element of the array to the first for
either the linear probe or the bound for the hopscotch algorithm. For example, if the
user attempts to insert 33 which hashes to index position 16 (i.e., 33 % TABLE_SIZE) in
the array, but an element already exists at that location, the insert will fail as there are
no more array locations beyond this to attempt to insert the element.
You must keep an item array containing the elements as well as an associated hop
array that indicates positions in the item array that are occupied with items that hash to
the same value. You should also provide specific feedback to the user on successful
operations or when an operation failed. The search should utilize the hash value and
then perhaps a linear probe of MAX_DIST – 1 index locations, but you should not
simply search the entire array to accomplish this operation. Be sure to handle the case
that requires multiple hops (i.e., using recursion) to get the value within the correct
range.
REQUIREMENTS
• Your code should be well documented in terms of comments. For example, good
comments in general consist of a header (with your name, course section, date,
and brief description), comments for each variable, and commented blocks of
code.
• Your program will be graded based largely on whether it works correctly on the
CSE machines (e.g., cse01, cse02, …, cse06), so you should make sure that
your program compiles and runs on a CSE machine.
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
CSCE 3110 Data Structures & Algorithms Summer 2019
2 of 12
• You should contact your instructor if there is any question about what is being
asked for.
• This is an individual programming assignment that must be the sole work of the
individual student. Any in
CSCI 340 Final Group ProjectNatalie Warden, Arturo Gonzalez, R.docxmydrynan
CSCI 340 Final Group Project
Natalie Warden, Arturo Gonzalez, Ricky Gaji
Introduction
As our world continues to rely on technology to store our information, issues concerning data storage and organization will arise
Association of Computing Machinery (ACM) has asked us to prepare a database through which they can easily and effectively access this information
In this project we have created a tier system of entities, established the relationships between them, and decreased redundancy by eliminating repeating attributes
Responsibility MatrixTask/PersonNatalieArturoRickyAnalysisMSER-DiagramSMRedundancySSSSQLMSLogical DesignMAnalysis DocMRelationships DocMReadMe DocSMDatabaseMSS
Software Used:
Analysis:
Google Docs - helped to bring the group together and organize all our information to make sure we were on the same page.
Google Slides- served as the main platform in which to come up with our presentation and visualize what we are going to do.
Draw.io- used to build our many ER diagrams
Database Design:
x10 web hosting- hosted our website and had the tools necessary to get started on the database
phpMyAdmin- here we created our database tables and made sure all the attribute’s data types and entity’s primary key, foreign keys, and attributes were correct.
mySQL Databases- used as relational database management system
generatedata.com-used to create “dummy” data to incorporate in the SQL testing
Analysis and Findings
Problems/Results
Final Decision
Decided to create entities for leadership
Took inspiration from University database setup
ER-Diagram
Tables
Tables
Building the ACM Database
Populated Tables
SQL/RESULTS
3
Name
Course
Date
Instructor
Benchmark - Gospel Essentials
In at least 150 words, complete your introductory paragraph with a thesis statement in which you will address each of the following six sections with at least one paragraph each.
God
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Humanity
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Jesus
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Restoration
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Analysis
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Reflection
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Conclusion
In at least 150 words, synthesize the main points, pulling the ideas of the paper together. Be sure to include citations.
References
Author, A. A., .
CSC-321 Final Writing Assignment In this assignment, you .docxmydrynan
CSC-321 Final Writing Assignment
In this assignment, you will write an article about a recent cybersecurity attack (of your choosing). The
article will include the following components:
1) Executive summary: a 1-page executive summary highlighting the potential impact and likelihood
of a similar attack against a fictional company XYZ. XYZ should be a company in a similar field
to the company attacked by the vulnerability.
a. Audience: A C-level business executive. Do not assume they will have any technical
knowledge but assume they are very interested in the economic impact of things.
b. Purpose: Provide a summary that they will use to make business decisions from. You
need to be convincing that the cost of security makes business sense.
2) Technical report: a 3-page technical report including the following topics: Introduction,
Vulnerability(s) exploited, financial impact (if applicable), social impact (if applicable),
technological impact (if applicable), political impact (if applicable), patches available/needed to
prevent these vulnerabilities (if applicable), human training needed (if applicable), comparison to
similar vulnerabilities in the past 20 years, assessment of how common the vulnerability is, and
recommendations for company XYZ to protect itself from similar vulnerabilities.
a. Audience: A Technical manager and his engineering staff. Assume a good knowledge of
computer science, engineering, and math but no specific security knowledge.
b. Purpose: Provides information to engineers at XYZ about the attack and how to prevent a
similar one against XYZ.
3) Press release: a 2-page article for popular consumption (think wired). This should explain the
vulnerability, protection, and potential impact to general audiences (users and share-holders).
a. Format: 2-page wired article. Be informative, objective, and entertaining
b. Audience: General public who are interested in technology but may have never taken a
computer science course and, almost certainly, have never taken a computer security
course.
c. Purpose: To express your understanding to a broad audience.
Choosing your topic
Your article must be about a recent computer security exploit with real world impacts. You must get your
topic approved in lab or by email before April 22nd.
Format: IEEE conference formatting with 12pt font. All page counts are precise. You should not go
over and should be no more than ¼ column under.
Press release (2 pages) Draft: Apr, 29 Due: May, 13
Lastly you are to write a two-page article for a national technical magazine, think Wired. This article is
intended for a general audience who is interested in technology but does not have formal technical
backgrounds. This article should explain the attack, its impact, how it is mitigated, and what (if
anything) the general audience should do. This article should be informative, objective, and entertaining.
Executive Summary (1 page) .
Cryptography is the application of algorithms to ensure the confiden.docxmydrynan
Cryptography is the application of algorithms to ensure the confidentiality, integrity, and availability of data, while it is at rest, in motion, or in use. Cryptography systems can include local encryptions at the file or disk level or databases. Cryptography systems can also extend to an enterprise-wide public key infrastructure for whole agencies or corporations.
The following are the deliverables for this project:
Deliverables
Enterprise Key Management Plan:
An eight- to 10-page double-spaced Word document with citations in APA format. The page count does not include figures, diagrams, tables, or citations.
Enterprise Key Management Policy:
A two- to three-page double-spaced Word document.
Lab Report:
A Word document sharing your lab experience along with screenshots.
There are seven steps to complete the project. Most steps of this project should take no more than two hours to complete. The entire project should take no more than one week to complete. Begin with the workplace scenario, and then continue to Step 1, “Identify Components of Key Management.”
When you submit your project, your work will be evaluated using the competencies listed below. You can use the list below to self-check your work before submission.
Step 1: Identify Components of Key Management
Key management will be an important aspect of the new electronic protected health information (e-PHI). Key management is often considered the most difficult part of designing a cryptosystem.
Choose a fictitious or an actual organization. The idea is to provide an overview of the current state of enterprise key management for Superior Health Care.
Review these authentication resources to learn about
authentication
and the characteristics of key management.
Provide a high-level, top-layer network view (diagram) of the systems in Superior Health Care. The diagram can be a bubble chart or Visio drawing of a simple network diagram with servers. Conduct independent research to identify a suitable network diagram.
Read these resources on
data at rest
, data in use, and
data in motion
.
Identify data at rest, data in use, and data in motion as it could apply to your organization. Start by focusing on where data are stored and how data are accessed.
Review these resources on insecure handling, and identify areas where
insecure handling
may be a concern for your organization.
Incorporate this information in your key management plan.
In the next step, you will consider key management capabilities.
Step 3: Identify Key Management Gaps, Risks,
Solution
s, and Challenges
In the previous step, you identified the key components of an enterprise key management system. In this step, you will conduct independent research on key management issues in existing organizations. You will use this research to help identify gaps in key management, in each of the key management areas within Superior Health Care.
Conduct independent research to identify typical gaps in key manage.
CSc3320 Assignment 6 Due on 24th April, 2013 Socket programming .docxmydrynan
CSc3320 Assignment 6 Due on 24th April, 2013
Socket programming code (server.c & client.c) demoed in class implement a server-client communication by socket. The server sets up a socket and waits for communication request from a client. The client tries to connect to server and asks user for a message to send to server after the connection established. Server then accepts the communication, reads the message, displays it and send confirmation message to the client. The client reads confirmation from server and displays it too.
Please modify the server.c such that the server can carry out the same communication with
3
clients. It creates a child process (fork()) every time a communication request from one client arrives and continues to wait to serve the next client. This child process takes care of reading message/sending confirmation from/to the corresponding client and terminates with the exit code 0. After serving all 3 clients, the server needs to accept (wait()) termination of all child processes it created. Server prints out message about the child process ID and the exit code every time it accepts the termination of a child process (eg. “A child with PID 1959 terminated with exit code 0”).
Client.c
#include
#include
#include
#include
#include
#include
#include
#include
void error(const char *msg)
{
perror(msg);
exit(0);
}
int main(int argc, char *argv[])
{
int sockfd, portno, n;
struct sockaddr_in serv_addr;
struct hostent *server;
char buffer[256];
if (argc < 3) {
fprintf(stderr,"usage %s hostname port\n", argv[0]);
exit(0);
}
portno = atoi(argv[2]);
sockfd = socket(AF_INET, SOCK_STREAM, 0);
if (sockfd < 0)
error("ERROR opening socket");
server = gethostbyname(argv[1]);
if (server == NULL) {
fprintf(stderr,"ERROR, no such host\n");
exit(0);
}
bzero((char *) &serv_addr, sizeof(serv_addr));
serv_addr.sin_family = AF_INET;
bcopy((char *)server->h_addr,
(char *)&serv_addr.sin_addr.s_addr,
server->h_length);
serv_addr.sin_port = htons(portno);
//printf("h_addr: %s\n", inet_ntoa(serv_addr.sin_addr));
if (connect(sockfd,(struct sockaddr *) &serv_addr,sizeof(serv_addr)) < 0)
error("ERROR connecting");
printf("Please enter the message: ");
bzero(buffer,256);
fgets(buffer,255,stdin);
n = write(sockfd,buffer,strlen(buffer));
if (n < 0)
error("ERROR writing to socket");
bzero(buffer,256);
n = read(sockfd,buffer,255);
if (n < 0)
error("ERROR reading from socket");
printf("%s\n",buffer);
close(sockfd);
return 0;
}
Server.c
/* A simple server in the internet domain using TCP
The port number is passed as an argument */
#include
#include
#include
#include
#include
#include
#include
#include
void error(const char *msg)
{
perror(msg);
.
This presentation includes basic of PCOS their pathology and treatment and also Ayurveda correlation of PCOS and Ayurvedic line of treatment mentioned in classics.
How to Add Chatter in the odoo 17 ERP ModuleCeline George
In Odoo, the chatter is like a chat tool that helps you work together on records. You can leave notes and track things, making it easier to talk with your team and partners. Inside chatter, all communication history, activity, and changes will be displayed.
Reimagining Your Library Space: How to Increase the Vibes in Your Library No ...Diana Rendina
Librarians are leading the way in creating future-ready citizens – now we need to update our spaces to match. In this session, attendees will get inspiration for transforming their library spaces. You’ll learn how to survey students and patrons, create a focus group, and use design thinking to brainstorm ideas for your space. We’ll discuss budget friendly ways to change your space as well as how to find funding. No matter where you’re at, you’ll find ideas for reimagining your space in this session.
How to Manage Your Lost Opportunities in Odoo 17 CRMCeline George
Odoo 17 CRM allows us to track why we lose sales opportunities with "Lost Reasons." This helps analyze our sales process and identify areas for improvement. Here's how to configure lost reasons in Odoo 17 CRM
हिंदी वर्णमाला पीपीटी, hindi alphabet PPT presentation, hindi varnamala PPT, Hindi Varnamala pdf, हिंदी स्वर, हिंदी व्यंजन, sikhiye hindi varnmala, dr. mulla adam ali, hindi language and literature, hindi alphabet with drawing, hindi alphabet pdf, hindi varnamala for childrens, hindi language, hindi varnamala practice for kids, https://www.drmullaadamali.com
How to Build a Module in Odoo 17 Using the Scaffold MethodCeline George
Odoo provides an option for creating a module by using a single line command. By using this command the user can make a whole structure of a module. It is very easy for a beginner to make a module. There is no need to make each file manually. This slide will show how to create a module using the scaffold method.
বাংলাদেশের অর্থনৈতিক সমীক্ষা ২০২৪ [Bangladesh Economic Review 2024 Bangla.pdf] কম্পিউটার , ট্যাব ও স্মার্ট ফোন ভার্সন সহ সম্পূর্ণ বাংলা ই-বুক বা pdf বই " সুচিপত্র ...বুকমার্ক মেনু 🔖 ও হাইপার লিংক মেনু 📝👆 যুক্ত ..
আমাদের সবার জন্য খুব খুব গুরুত্বপূর্ণ একটি বই ..বিসিএস, ব্যাংক, ইউনিভার্সিটি ভর্তি ও যে কোন প্রতিযোগিতা মূলক পরীক্ষার জন্য এর খুব ইম্পরট্যান্ট একটি বিষয় ...তাছাড়া বাংলাদেশের সাম্প্রতিক যে কোন ডাটা বা তথ্য এই বইতে পাবেন ...
তাই একজন নাগরিক হিসাবে এই তথ্য গুলো আপনার জানা প্রয়োজন ...।
বিসিএস ও ব্যাংক এর লিখিত পরীক্ষা ...+এছাড়া মাধ্যমিক ও উচ্চমাধ্যমিকের স্টুডেন্টদের জন্য অনেক কাজে আসবে ...
This presentation was provided by Steph Pollock of The American Psychological Association’s Journals Program, and Damita Snow, of The American Society of Civil Engineers (ASCE), for the initial session of NISO's 2024 Training Series "DEIA in the Scholarly Landscape." Session One: 'Setting Expectations: a DEIA Primer,' was held June 6, 2024.
2. prison population.4 Although crime rates have been declin-
ing appreciably for some time (a decline that preceded the
explosion in prison populations),5 it has become politically
expedient to ignore policy suggestions based on statistical
analysis and focus rather on the uninformed beliefs of
the populace.6 Because the prison system is backed by a
bureaucracy of its own, it continues to grow according to an
internal rationality that favors constant expansion according
to a decidedly retributive ethos.7
Because so much of prison life occurs far from the
public’s view, changes in policy and implications of long-
held truisms are rarely noticed by those who are not
directly affected by the penal system. Just as Victor Hugo’s
fictional Jean Valjean could be largely forgotten in the
bowels of prison, women and men sentenced to correc-
tional facilities largely fall from consciousness unless or
until benign neglect is disturbed by other factors.
Today, that benign neglect in Wisconsin has been dis-
turbed by the financial constraints of maintaining the
current prison population. Between 2000 and 2007,
Wisconsin’s prison population increased by 14 percent.8
The State Corrections budget increased by 71 percent from
1999 to 2009.9 Wisconsin’s health care costs for adult
prisoners leapt from $28.5 million in 1998 to $87.6 million
in 2005.10 The Wisconsin Department of Corrections esti-
mates that it will cost $2.5 billion between 2009 and 2019
to reduce overcrowding and accommodate the expansion
of the prison system.11 As a result of looming costs, Wiscon-
sin, like other states, has begun to reconsider implications
of previously popular law-and-order policies.
One product of Wisconsin’s reconsideration is a recent
change in compassionate release standards for inmates in
state correctional facilities.22 This legislation both expands
3. the category of those eligible for sentence modification
and streamlines the procedure.13 Although the law has
much to recommend it, issues unaddressed may prove
costly—notably the unintended consequences of placing
financial burdens on the families or communities to
which these prisoners are released in a bleak economic
climate.
The idea of compassionate release of elderly and ill
inmates is not new.14 In 1994, Professor Marjorie Russell
published a consideration of the compassionate release
and medical parole programs of the fifty states and the
District of Columbia.15 Only three jurisdictions, the Dis-
trict of Columbia, Kansas, and Maine, had no programs
for the parole or release of terminally ill prisoners.16
Russell noted that
[t]wenty-two states reported that they have no compas-
sionate release program, but each has at least one
method by which a terminally ill prisoner can seek
release. These methods included: commutation of
sentence through the administrative procedures of
the DOC with no specific provision relating to the
terminally ill; general claim for executive clemency;
and normal parole application procedures, where the
prisoner’s medical condition is only one factor to be
considered in the ordinary parole decision.17
Thus, almost twenty years ago, states recognized a need
for this safety valve even without providing a specific statu-
tory grounding for it. Professor Russell maintained that
compassionate release statutes address the concerns of
both inmates and the states far better than do more gener-
alized administrative procedures or clemency petitions.18
4. After laying out the shifts in eligibility standards and
procedure between Wisconsin’s old and new compassion-
ate release laws, I will turn to broader concerns that fall
under the public-interest calculus called for in the statutes.
In addition to usual criminological considerations, I sug-
gest that the word compassionate will need to do heavy lifting
if this law is to make a difference in the lives of inmates.
I. Wisconsin’s old Compassionate Release Law
By way of background, Wisconsin’s current sentencing
structure is relatively new; it was overhauled between
1998 and 2003 under the provisions of the state’s Truth
in Sentencing legislation.19 Under that law, parole was
abolished; felons sentenced to prison are now given a
bifurcated (two-part) sentence in which the sentencing
judge specifies an amount of time a convicted felon will
FSR2301_05.indd 33 9/15/10 3:44:34 PM
F e d e r a l S e n t e n c i n g r e p o r t e r • V o l . 2 3 , n o
. 1 • o c t o b e r 2 0 1 034
serve in prison and an amount of time the person will
serve in the community on extended supervision.20 Under
the original provisions of Truth in Sentencing, most
inmates, with approval of the program review committee
at their respective institutions, could petition the sentenc-
ing court for release to extended supervision in certain
extenuating circumstances.21 However, inmates serving
life sentences were not eligible to petition.22
Eligible inmates included both the elderly and the
gravely ill. With regard to the elderly, the program review
committee at the housing institution could consider peti-
5. tions filed by prisoners either 60 or 65 years old who had
served substantial portions of their sentences.23 In addi-
tion to these petitions, those who had a “terminal
condition” could file for modification.24 The statute
defined “terminal condition” as
an incurable condition afflicting a person, caused by
injury, disease, or illness, as a result of which the
person has a medical prognosis that his or her life
expectancy is 6 months or less, even with available
life-sustaining treatment provided in accordance with
the prevailing standard of medical care.25
Inmates who fit within either category could then peti-
tion the program review committee of their correctional
institution, requesting modification of the bifurcated sen-
tence.26 Any request for modification based on a terminal
condition required affidavits from two physicians.27 The
institution’s program review committee then reviewed
each petition filed and decided if the “public interest”
(a phrase undefined in the statute) would be served by
modifying the inmate’s sentence.28 Only if the program
review committee found such interest could the inmate’s
petition be referred to the sentencing court.29 The statute
provided no right to appeal the program review commit-
tee’s denial of a petition for modification.30
At the sentencing court hearing, the petitioner, the dis-
trict attorney, and any victim of the crime for which the
petitioner was sentenced were permitted to be heard.31 The
petitioner bore the burden of proving by the greater weight
of the credible evidence that modification of his or her sen-
tence would be in the public interest.32 If the court so found,
any reduction in the incarceration portion of the bifurcated
sentence was balanced by a like increase in the extended
supervision portion so that the total length of the original
6. sentence did not change.33 The court’s decision could be
appealed by either the petitioner or the state.34 Inmate peti-
tioners had the right to be represented by counsel, including
appointment of a state public defender.35 In its study of the
new legislation, the Legislative Fiscal Bureau of Wisconsin
provided no evidence describing whether or how often this
law resulted in the release of inmates from confinement.36
II. Wisconsin’s New Compassionate Release Law
Wisconsin’s new compassionate release law simplifies
earlier procedures and expands the class of inmates who
can petition for sentence modification. The statute retains
the distinction between those petitioning for compassion-
ate release because of age and those who petition for
reasons of ill health. The age qualifications track the previ-
ous legislation37; however, the new provision no longer
bars petitions by elderly inmates sentenced to life impris-
onment.38 The second category of “extraordinary health
condition” may signal greater eligibility to petition under
the law.39 Anyone claiming “advanced age, infirmity, or
disability of the person or a need for medical treatment or
services not available within a correctional institution”
may now petition for compassionate release.40
In terms of procedural differences, the law shifts the
locus of decision making from the sentencing court to a
newly created administrative panel, the Earned Release
Review Commission, which replaces the parole board.41 The
Commission, part of the executive branch of state govern-
ment, consists of eight members who have “knowledge of
or experience in corrections or criminal justice.”42 The chair
is nominated by the governor and subject to state senate
approval; other members are appointed by the chair.43
Inmates meeting eligibility criteria may submit peti-
7. tions to the Commission.44 Upon receipt of a petition, the
Commission sets a hearing to determine whether the pub-
lic interest would be served by modifying the sentence as
requested.45 The District Attorney from the sentencing
jurisdiction and any victim of the inmate’s crime must be
notified and can be present for any such hearing.46
Again, inmates must prove that granting their petition
would serve the public interest by the greater weight of the
credible evidence.47 For inmates who meet that burden,
the Commission must modify their sentence in the man-
ner requested.48 As was the case under the previous
legislation, if the petitioner prevails and is granted a modi-
fication, the state may appeal that decision to a reviewing
court (which may overturn the determination using an
abuse of discretion standard).49 By contrast, inmates can
only appeal from the denial of their petition under the
common law right of certiorari.50 Again, those petitioning
for modification are afforded the right to counsel, includ-
ing appointment of a state public defender.51 Echoing
previous law, reduction in an inmate’s term of confine-
ment must be balanced with a like increase in the period
of extended supervision so that the total length of the sen-
tence imposed remains the same.52
Initially, one must applaud Wisconsin’s willingness to
revisit parts of a recent sentencing overhaul to address
difficulties in the current system. Although the proposed
changes are hardly sweeping in scope, they do offer real
possibilities of change. By removing a level of bureaucracy
and shifting decision making from elected judges to a
politically appointed commission, Wisconsin may speed
up the petitioning process and improve results. In an era
when judicial elections are marred by often unsupported
allegations that opponents are soft on crime, the decision
to release an elderly or infirm prisoner seems best shielded
8. from obvious political posturing. That said, the Commis-
sion must still be responsive to the citizens of the state.
FSR2301_05.indd 34 9/15/10 3:44:35 PM
F e d e r a l S e n t e n c i n g r e p o r t e r • V o l . 2 3 , n o
. 1 • o c t o b e r 2 0 1 0 35
III. Public Interest Considerations
To determine the public-interest standard that governs
decisions to grant or deny release, it is helpful to return to
standard sentencing goals. Presumably public interest
includes consideration of specific deterrence of the inmate
and protection of the public, retribution for past wrongs,
and an inmate’s efforts at rehabilitation while incarcerated.
The literature also indicates that public interest includes
saving the criminal justice system money while not impos-
ing an undue burden on the communities to which the
inmates will be released. Finally, it seems that consideration
of the public interest must also include some reflection on
the odd word compassionate in the title of the statute.
No one doubts that specific deterrence and protection
of the public are paramount in considering the release of
prisoners into society. To underscore this idea, Wisconsin
State Representative Scott Suder recently organized forty-
four GOP lawmakers to protest all of the prisoner release
provisions passed as part of the budget bill in 2009.53
Commenting on similar legislation in the past, Suder
decried compassionate release of elderly inmates: “I don’t
think age should be a factor . . . for letting people loose
early or giving them things like house arrest. . . . Putting
these criminals in residential nursing homes with an
already vulnerable population . . . I think is just utterly
9. dangerous.”54
Although concern with public safety is an important
factor, statistical analysis undermines claims that those
eligible for compassionate release pose a substantial
threat to society.55 Research in this area indicates that
elderly prisoners are the least likely to, and the least capa-
ble of, committing crimes.56 For one thing, elders in
prison appear to be more physically impaired than the
general elderly population.57 They frequently have lives
marked by poverty and addiction;58 therefore, they tend to
be less healthy than society at large. Aside from these ex
ante considerations, the major factor contributing to
growth in Wisconsin’s prison population is revocation of
earlier sentences.59 Inmates know that they will always be
subject to revocation if they step out of line while on
extended supervision. This awareness may well discour-
age further unlawful behavior.
Second, internal evidence from the statute demonstrates
that retribution is taken into account in compassionate
release determinations. Elderly prisoners are not eligible
to file petitions until they have served a substantial period
of their sentences behind bars.60 Furthermore, Wisconsin
prison sentences and periods of extended supervision
have increased markedly under Truth in Sentencing,
which in part underscores the necessity of this law.61
Retribution concerns are thus met. In addition, Wisconsin
statutes specifically provide that courts must consider
inmates’ efforts at rehabilitation while incarcerated as a
factor in any motion to modify a sentence.62 Insofar as
correctional institutions still accept the idea that prisoners
strive to reform their lives, inmates’ efforts at self-
improvement are rewarded by current Wisconsin law.63
Although necessary, it is fair to concede that the forego-
10. ing would not constitute sufficient grounds for changing
the release standards barring an expected dividend of cost
savings. Thus, it is noteworthy that such savings remain
undefined. For example, no one has been able to estimate
what, if any, net savings may accrue because of Wisconsin’s
sentence modification legislation.64 Indeed, rather than
careful analysis of projected savings and possible costs that
may be shifted to other state, county, or municipal pro-
grams by releasing inmates under compassionate release,
the legislative history assumes without proof that it is more
economical to house some people outside of state prisons.
Moving prisoners out of the state corrections system will
surely save money for corrections.65 The National Center on
Institutions and Alternatives concluded that release of non-
violent elderly prisoners to communities would result in
“astronomical” savings.66 Later studies are more guarded
and suggest that it is at best unclear whether this strategy
will garner any net savings across government and private
entities.67
One key concern is that costs may be shifted to those
particularly unable to take on added financial burdens
given the precarious state of Wisconsin’s current economic
situation. In particular, Milwaukee has been recognized as
a metropolitan area suffering concentrated poverty.68 For
instance, one recent study of the past forty years of eco-
nomic data in the largest U.S. cities revealed that “none of
their urban centers fell as far, as fast, as hard,” as Milwau-
kee’s.69 The study concluded that “Milwaukee falls to the
bottom of nearly every index of social distress.”70 Another
recent study revealed that Milwaukee has one of the high-
est rates of Black male joblessness among U.S. cities.71
If one accepts as a reasonable assumption that many
who are released will return to their families for end-of-life
or extended care, it would also seem reasonable that any
11. bill providing for compassionate release would provide for
increased community reentry funding to support families
facing the financial burdens associated with caring for
these family members. Before the new bill, the State
Department of Corrections spent more than $27 million
annually for the purchase of goods, care, and services,
including community-based residential care, for inmates,
probationers, parolees, and individuals on extended super-
vision.72 Although the governor requested additional
positions and funding in the bill of more than $5 million,
that request was vetoed by the Wisconsin Legislature’s
Joint Finance Committee and adopted by the Conference
Committee.73 This denial of additional funding may end
up costing the state more in the long run, because it may
either make compassionate release a practical impossibil-
ity in a great number of inmates’ cases or lead families
already in precarious financial circumstances into even
greater economic distress.
Despite these very real cost concerns, on balance, the
public interest may well be upheld by Wisconsin’s new
compassionate release programs—but this interest requires
a different sort of analysis from that which usually occupies
FSR2301_05.indd 35 9/15/10 3:44:35 PM
F e d e r a l S e n t e n c i n g r e p o r t e r • V o l . 2 3 , n o
. 1 • o c t o b e r 2 0 1 036
lawyers. The values at stake are well expressed by consid-
ering the Latin root of the word compassion: “I suffer
with.” Rather than the Kantian broad-based rules that
characterize most public interests, the interest spoken of
here is more in line with a Heideggerian “Dasein,” the
12. “being there” that roots more personal considerations.74
The word compassion evokes a relationship at a level of per-
sonal directness that the penal apparatus rarely considers.
Rather than determining results that could be seen as dis-
tributed equitably by a blindfolded figure holding scales,
those deciding compassionate release petitions must con-
sider the suffering and extremity of a particular inmate
with particular physical, emotional, and mental needs and
limitations.
In determining the public interest involved in compas-
sionate release of convicts, the Commission will need to
ask not only what sort of society we are but also what sort
of society we aspire to be. For compassionate release, the
public interest must be focused on a very particular private
interest. If the Commission is not willing so to act, Wiscon-
sin’s new compassionate release law will not engender
much change.
Notes
* I would like to thank Professor Phoebe Williams for her help-
ful insights. i owe a further debt of gratitude to Mr. Samuel
Sarver, who helped with research on this paper. Finally, thank
you to the kind staff at the Marquette University law library,
especially Ms. Julia Jaet, Mr. peter Kersten, and Ms. robin
cork, who graciously helped me hunt down sources.
1 John Pratt, Penal PoPulism 12 (2007). pratt characterizes
penal populism this way:
[P]enal populism speaks to the way in which criminals
and prisoners are thought to have been favoured at the
expense of crime victims in particular and the law-abid-
ing public in general. it feeds on expressions of anger,
disenchantment and disillusionment with the criminal
13. justice establishment. it holds this responsible for what
seems to have been the insidious inversion of common-
sensical priorities: protecting the well-being and security
of the law-abiding ‘ordinary people’. punishing those
whose crimes jeopardize this. Id. (emphasis omitted).
2 See Bernard harcourt, illusions of order: the false Promise
of Broken WindoWs Policing 2 (2001) (“in new York city, the
quality of life initiative produced between 40,000 and 85,000
additional adult misdemeanor arrests per year during the
period of 1994–1998, and an even greater number of stops
and frisks during a period of sharply declining crime rates.”
(citations omitted)).
3 See david garland, Punishment and modern society: a study in
social theory 6 (1990) (“this all-inclusive sign provided a sense
of purpose and justification for penal practice and made pun-
ishment appear meaningful for its various audiences. today,
however, this unifying and uplifting term is no longer the tal-
ismanic reference point it once was. Following a sustained
critique, the notion of rehabilitation has come to seem prob-
lematic at best, dangerous and unworkable at worst.”).
4 See henry ruth & kevin reitz, the challenge of crime: rethink-
ing our resPonse 18–22 (2003). ruth and reitz provide a
first-rate analysis of incarceration trends that highlights not
only the increase in the overall prison population but also the
increase in average sentence lengths in the United States.
the U.S. incarceration rate is now roughly five to ten times
the rate of most other industrialized nations. public Safety
performance project, pew center on the States, public Safety,
Public Spending: Forecasting America’s Prison Population
2007–2011, at 1 (2007).
5 Id. at 98–102. For a discussion of the debate regarding the
14. cause of drop in crime, see robert Weisberg, Tragedy, Skepti-
cism, Empirics and the MCS, 61 fla. l. rev. 797, 806–11
(2009). relying on the research of professor Frank Zimring,
Weisberg suggests that although the crime drop was real, it
is owed to a multiplicity of factors that “cannot be disentan-
gled with our current statistical tools.” Id. at 811.
6 See, e.g., Pratt, supra note 1, at 17–18 (“crime levels were to
be judged on the basis of ‘what we all know’ rather than any
such abstract quantifications. it was this that determined its
reality, not statistical detail.”).
7 See, e.g., garland, supra note 3, at 3 (“like all habitual pat-
terns of social action, the structures of modern punishment
have created a sense of their own inevitability and of the nec-
essary rightness of the status quo. our taken for granted
ways of punishing have relieved us of the need for thinking
deeply about punishment and what little thinking we are left
to do is guided along certain narrowly formatted channels.”
(citation omitted)).
8 See council of state governments Justice center, Justice rein-
vestment in Wisconsin: analyses and Policy oPtions to reduce
sPending on corrections and increase PuBlic safety 3 n.5
(2009) (citing Wisconsin dePartment of corrections, Depot
Update through 2007 (2008)).
9 Time to Break Prison-Spending Cycle, the northWestern,
oshkosh,
Wis., May 13, 2009, available at http://www.legis.state.wi.us/
lc/committees/study/2008/Jrio/files/editorial_break.pdf.
10 bob purvis, Cheaper Prison Options Sought; As Number of
Older
Prisoners Rises, So Do Costs for Care, milWaukee J. sentinel,
aug. 7, 2006, at a1.
15. 11 council of state governments Justice center, supra note 8, at
3.
12 Wis. stat. § 302.1135 (2010).
13 the new law took effect on January 4, 2010. it was passed
and signed by the governor as part of the 2009 omnibus
budget bill, act 28.
14 indeed, the topic has been the subject of scholarly research
for some time. representative articles include Marjorie p.
russell, Too Little, Too Late, Too Slow: Compassionate Release
of Terminally Ill Prisoners—Is the Cure Worse Than the
Disease?,
3 Widener J. PuB. l. 799 (1994); Jason S. ornduff, Releasing
the Elderly Inmate: A
Solution
to Prison Overcrowding, 4 elder
l.J. 173, (1996); William b. aldenberg, Bursting at the Seams:
An Analysis of Compassionate-Release Statutes and the
Current
Problem of HIV and AIDS in U.S. Prisons and Jails, 24 neW
eng.
J. on crim. & civ. confinement 541 (1998); John a. beck,
Compassionate Release from New York State Prisons: Why Are
So Few Getting Out?, 27 J.l. med. & ethics 216 (1999); nadine
curran, Blue Hairs in the Bighouse: The Rise in Elderly Inmate
16. Population, Its Effect on the Overcrowding Dilemma and Solu-
tions to Correct It, 26 neW eng. J. on crim. & civ. confinement
225 (2000); ronald H. aday & Jennifer J. Krabill, Aging
Offenders in the Criminal Justice System, 7 marq. elder’s
advisor 237 (2006); timothy curtin, The Continuing Problem
of America’s Aging Prison Population and the Search for a
Cost-Effective and Socially Acceptable Means of Addressing
It,
15 elder l.J. 473 (2007).
15 russell, supra note 14.
16 Id. at 818–19.
17 Id. at 819 (citations omitted).
18 Id.
19 The history and provisions of that law are nicely laid out in
thomas Hammer, The Long and Arduous Journey to Truth-in-
Sentencing in Wisconsin, 15 fed. sent. reP. 15 (2002).
20 Wis. stat. § 973.01 (2009).
FSR2301_05.indd 36 9/15/10 3:44:36 PM
17. F e d e r a l S e n t e n c i n g r e p o r t e r • V o l . 2 3 , n o
. 1 • o c t o b e r 2 0 1 0 37
21 Wis. stat. §§ 302.113(9g)(a)(1), (b)(3)(cm) (2007).
22 See Wis. stat. §§ 973.014, 302.114 (2007).
23 Wis. stat. § 302.11(9g)(b) (2007). the statute provides as
follows:
An inmate who is serving a bifurcated sentence for a
crime other than a class b felony may seek modification
of the bifurcated sentence in the manner specified in par.
(f) if he or she meets one of the following criteria:
1. the inmate is 65 years of age or older and has served
at least 5 years of the term of confinement in prison
portion of the bifurcated sentence.
2. the inmate is 60 years of age or older and has served
at least 10 years of the term of confinement in prison
portion of the bifurcated sentence. Id.
24 Wis. stat. § 302.113(9g)(c) (2007).
25 Wis. stat. § 302.113(9g)(a)(2) (2007).
26 Wis. stat. § 302.113(9g)(c) (2007).
27 Id.
18. 28 Wis. stat. § 302.113(9g)(cm) (2007).
29 Id.
30 Wis. stat. §§ 302.113(9g)(h)-(i) (2007).
31 Wis. stat. § 302.113(9g)(d) (2007).
32 Wis. stat. § 302.113(9g)(e) (2007).
33 Wis. stat. § 302.113(9g)(f) (2007).
34 Wis. stat. § 302.113(9g)(h) (2007). the appellate court could
overturn the sentencing court under an abuse of discretion
standard. Id.
35 Wis. stat. § 302.113(9g)(j) (2007).
36 See Wisconsin legislative fiscal Bureau, Bifurcated sentence
modification (corrections-sentencing modification) (2009),
available at http://www.legis.state.wi.us/lfb/2009-11budget/
budget%20papers/277.pdf.
37 The statute provides as follows:
An inmate who is serving a bifurcated sentence imposed
under s. 973.01 or, notwithstanding s. 973.014 (1g) (a)
or (2), an inmate who is serving a life sentence imposed
under s. 973.014 may seek modification of the sentence
in the manner specified in sub. (6) if he or she meets
one of the following criteria: (a) the inmate is 65 years
19. of age or older and has served at least 5 years of the
term of confinement in prison portion of the bifurcated
sentence for a sentence imposed under s. 973.01 or has
served at least 5 years in prison for a life sentence
imposed under s. 973.014. (b) the inmate is 60 years
of age or older and has served at least 10 years of the
term of confinement in prison portion of the bifurcated
sentence for a sentence imposed under s. 973.01 or has
served at least 10 years in prison for a life sentence
imposed under s. 973.014. Wis. stat. § 302.1135(2)
(2010).
38 Id.
39 Wis. stat. § 302.1135(1)(b) (2010).
40 Id.
41 Wis. stat. § 15.145(1) (2010).
42 Id.
43 Id.
44 Wis. stat. § 302.1135(3) (2010). as was the case previously,
the claim of an “extraordinary health condition” must be sup-
ported by affidavits from two physicians. Id.
45 Wis. stat. § 302.1135(4) (2010).
46 Id.
20. 47 Wis. stat. § 302.1135(5) (2010).
48 Id.
49 Wis. stat. § 302.1135(8) (2010).
50 Id.
51 Wis. stat. § 302.1135(10) (2010).
52 Wis. stat. § 302.1135(6)(a) (2010).
53 press release, Wisconsin State rep. Scott Suder, rep. Suder
calls for repeal of democrats’ “let ’em loose early” program
(Jan. 6, 2010), available at http://www.thewheelerreport.com/
releases/jan10/jan6/0106suderearlyrelease.pdf (“letting
convicted felons out of jail early on a hope and prayer that
they won’t strike again is not only bad public policy, it’s
downright dangerous.”).
54 bob purvis, Cheaper Prison Options Sought; As Number of
Older Prisoners Rises, So Do Costs for Care, milWaukee J.
senti-
nel, aug. 7, 2006, at a1.
55 according to older studies, elders are less likely to be recidi-
vists; indeed, age is the only reliable factor on which
recidivism may be predicted. Within one year of release,
nearly 22 percent of those between the ages of 18 and 24
will return to prison, but only about 2 percent of those 45
21. and older will return. after seven years, nearly 50 percent of
those between the ages of 18 and 24 at release will have
returned, but only about 12 percent of those 45 or older at
release will return. Statement of professor Jonathan turley,
Assistant Professor of Law and Director of the Project for
older prisoners, tulane law School, to Special budget task
Force of the louisiana State Senate (oct. 23, 1989). See also
allen J. Beck, u.s. deP’t of Justice, recidivism of Prisoners
released in 1983, at 1 (1989); russell, supra note 14, at 805
(citing laWrence a. greenfield, u.s. deP’t of Justice, examining
recidivism, at 1(1985)).
56 See, e.g., ginny carroll, Growing Old Behind Bars: Some
Cell-
blocks Are More Nursing Home Than Jail, neWsWeek, nov. 20,
1989, at 70 (drawing on the research of Jonathan turley).
57 cynthia Massie Mara, Chronic Illness, Disability and Long-
Term
Care in the Prison Setting, in vulneraBle PoPulations in the long
term care continuum 39, 43–44 (paul r. Katz et al. eds., 2004)
(“although 23.8% of inmates under age [twenty-five] reported
having at least one (chronic) condition, 47.6% of prisoners
over [forty-four] years of age said they had a similar level of
impairment.”), cited in curtin, supra note 14, at 481.
22. 58 one study found that 8.5 percent of the elderly individuals
studied were arrested for driving under the influence and
12.4 percent were arrested or ticketed for public intoxication.
peter c. Kratcoski & george a. pownall, Federal Bureau of
Prisons Programming for Older Inmates, fed. ProBation, June
1989, at 28. alcohol is also a major factor in violent crimes
committed by elders. curtin, supra note 14, at 482 (citing
Karen M. Jennison, The Violent Older Offender: A Research
Note, fed. ProBation, Sept. 1986, at 60).
59 See council of state governments Justice center, supra note
8, at 4 (“between 2000 and 2007, the number of people
admitted to prison who did not comply with the conditions of
their community supervision increased 40 percent. the num-
ber of people admitted to prison who committed new
offenses, however, decreased 11 percent.”).
60 Wis. stat. § 302.1135(2) (2010).
61 See council of state governments Justice center, supra note
8, at 5 (“between 2000 and 2007, the average period of
post-release community supervision to be served for individu-
als receiving a new prison sentence more than doubled,
increasing from 23 to 54 months. the average confinement
23. period also increased, albeit by a smaller margin, from 31 to
40 months.”).
62 Wis. stat. § 973.195(1r)(b) (“any of the following is a
ground
for a petition [for sentence modification]: 1. the inmate’s
conduct, efforts at and progress in rehabilitation, or partici-
pation and progress in education, treatment, or other
correctional programs since he or she was sentenced.”).
63 See, e.g., david rothman, the discovery of the asylum: social
order and disorder in the neW rePuBlic 79–108 (2d ed.
1990).
FSR2301_05.indd 37 9/15/10 3:44:37 PM
F e d e r a l S e n t e n c i n g r e p o r t e r • V o l . 2 3 , n o
. 1 • o c t o b e r 2 0 1 038
64 See, e.g., Wisconsin legislative fiscal Bureau, sentence
adJustment
for class c through class i felonies (corrections—sentencing
modifications) 8–9 (2009), available at http://www.legis.state.
24. wi.us/lfb/2009-11budget/budget%20papers/275.pdf.
of the above totals, it is unknown how many offenders’
sentences would be adjusted under the bill and how many
prison beds savings may occur as a result of the provi-
sions. Factors that would affect how many offenders are
eligible and how much time may be earned include how
many offenders with non-violent Class F to I felonies
might be assessed as high-risk, and how many regulation
violations offenders might receive in prison and in the
community. according to the department, there is “no
way to determine the actual number of inmates who
would have their sentences modified for release to super-
vision. . . .” although this statement on cost estimates
applies most clearly to legislation addressing good time
adjustments, it applies with equal force to the compas-
sionate release legislation. Id.
65 carrie aBner, the council of state governments, graying
Prisons: states face challenges of an aging inmate PoPulation
8, 10 (2006) (“the financial burden for states in providing
adequate health care for older prisoners is staggering. in
1997, the texas criminal Justice policy council reported that
health care for elderly inmates ran $14.80 per day, nearly
three times the health care costs for younger prisoners.”).
25. 66 national center on institutions and alternatives, imPrisoning
elderly offenders: PuBlic safety or maximum security nursing
homes? 2 (1998), available at http://www.igc.org/sent/exec.
pdf. the ncia calculates $69,000 a year being spent on
elderly inmates as opposed to $22,000 a year for younger
inmates. Id.
67 aBner, supra note 65, at 11.
“although corrections may reduce costs through early
release the cost to taxpayers doesn’t necessarily go
away,” said carl Wicklund, executive director of the amer-
ican probation and parole association. With little savings
and limited employment opportunities, elderly offenders
may not be able to adequately care for themselves. as a
result, said Wicklund, “society may still be burdened by
the costs for caring for an offender, even though he or she
may no longer pose a threat to the community.” others
agree, and advocate that some cost savings associated
with early release programs be used to assist with the
community re-entry transition. testifying before the cali-
fornia Senate in 2003, [professor Jonathan] turley
warned that “some of that money (from early release)
has to be put back into the post-release plan. . . . it’s not
26. that expensive to do that. but it can be the difference
between zero recidivism and greater recidivism. it’s called
a soft landing.” Id.
68 See generally, Jeremiah boyle, Milwaukee, Wisconsin: The
Northwest Neighborhood, in the enduring challenge of con-
centrated Poverty in america: case studies from communities
across the u.s. (d. erickson et al. eds., 2008), available at
http://www.frbsf.org/cpreport/docs/milwaukee_wi.pdf. this
study was commissioned by the Federal reserve bank and
the brookings institution.
69 John Schmid, A Dream Derailed, milWaukee J. sentinel,
dec. 5,
2004.
70 Id.
71 marc v. levine, the crisis of Black male JoBlessness in
milWaukee:
trends, exPlanations, and Policy oPtions (2007), available at
http://www4.uwm.edu/ced/publications/blackcrisis307.pdf.
in a research update to his previous work, levine indicates
that Milwaukee’s black male unemployment in 2008 held at
47.1 percent of the population; White male unemployment
27. was at 18.1 percent. marc v. levine, research uPdate: race and
male JoBlessness in milWaukee: 2008, at 5 (2009), available at
http://www4.uwm.edu/ced/publications/race_joblessness08.
pdf.
72 Wisconsin legislative fiscal Bureau, community reentry
funding
(corrections—adult community corrections) (2009), available
at http://www.legis.state.wi.us/lfb/2009-11budget/budget%20
papers/296.pdf.
73 Wisconsin legislative fiscal Bureau, comParative summary
of
2009–2011 Budget, corrections—adult community correc-
tions, community reentry funding 306 (2009).
74 Professor Linda Ross Meyer masterfully lays out this
distinc-
tion in The Merciful State, in forgiveness, mercy and clemency
64, 79–85 (austin Sarat & nasser Hussain eds., 2007).
Although Professor Meyer refers primarily to questions of
clemency in this chapter, i believe her insights can be easily
transferred to the interests raised in compassionate release.
FSR2301_05.indd 38 9/15/10 3:44:37 PM