The document reports on the identification of early proteins from human papillomaviruses HPV16 and HPV18 in cervical carcinoma cell lines. Key findings include:
- The researchers sequenced DNA containing open reading frames E6, E7, part of E1 from HPV18 and identified homologous regions in HPV16.
- They expressed the viral proteins using prokaryotic expression vectors and generated antibodies against E6, E7, E1 from HPV18 and E6, E7, E4, L1 from HPV16.
- Using the antibodies, they detected the E7 protein as the most abundant in cell lines containing HPV16 or HPV18 DNA, identifying it as a 15kd cytoplasmic
This document describes an analysis pipeline for gene expression data. It involves steps like raw data normalization, statistics, differential gene expression analysis, and profile interpretation. It also discusses using the Affymetrix analysis system and mouse 430A chip for a nephridium experiment comparing different time points and genotypes. Multivariate analysis techniques like 2-way ANOVA and PCA are applied. The goal is to build systems biology analysis platforms integrating clinical records, biological databases, and dynamic databases for knowledge discovery.
J. biol. chem. 2016-shao-jbc.m116.724401andrei andrei
FBXO3 promotes ubiquitylation and transcriptional activity of AIRE. The study found that the E3 ubiquitin ligase FBXO3 interacts with phosphorylated residues on AIRE and promotes its ubiquitylation. This post-translational modification increases the interaction between AIRE and P-TEFb, potentiating their transcriptional activity on tissue-specific antigen genes in the thymus. Knockdown of FBXO3 decreased ubiquitylation and transcriptional activity of AIRE.
This document summarizes key events in translation including:
1. tRNAs act as adaptor molecules that pair each mRNA codon to its corresponding amino acid. Francis Crick first proposed this "adaptor hypothesis".
2. tRNAs undergo processing and modification before being charged with their cognate amino acids by aminoacyl tRNA synthetases.
3. The genetic code was deciphered through experiments using RNA polymers and identification of codon frequencies. Wobble base pairing allows multiple codons to code for the same amino acid.
4. Ribosomes catalyze peptide bond formation using rRNA. Bacterial and eukaryotic ribosomes differ in their subunit composition and initiation factors. Elongation
1) PSF, a pre-mRNA splicing factor, was identified as a constituent of PER complexes purified from mouse tissues.
2) PSF recruits the SIN3A-HDAC complex to the Per1 promoter in a circadian manner through interactions with PER complexes.
3) Recruitment of the SIN3A-HDAC complex by the PER complex leads to histone deacetylation at the Per1 promoter, providing a molecular mechanism for circadian clock negative feedback through rhythmic repression of Per1 transcription.
This document summarizes research on hematopoiesis and lymphopoiesis in zebrafish. It describes how zebrafish are used to study the development of blood and immune cells in early embryonic regions like the intermediate cell mass and caudal hematopoietic tissue, and how these precursors colonize the thymus and kidney. It also discusses mutations affecting thymus morphogenesis and the role of genes like runx1.
Researchers investigated the roles of two sirtuin genes, SIRT4 and SIRT7, in grapevine physiology. In vitro assays showed both genes exhibited very weak NAD+-dependent deacetylase activity, even in the presence of resveratrol. Long fragments of the true coding sequences for SIRT4 and SIRT7 were obtained via RT-PCR that highly corresponded to hypothetical sequences. Basal transcription of both genes was found in grape cell cultures. Exposure to methyl jasmonate and UV-C radiation showed no influence on SIRT4 expression, while SIRT7 expression was more complex and non-linear, requiring further study. The work provides a starting point for understanding
This document discusses endometrial receptivity and the Endometrial Receptivity Array (ERA) test. The ERA test analyzes the endometrial transcriptome using microarrays to determine if a patient's window of receptivity is receptive or non-receptive. For patients found to have a non-receptive window, personalizing the timing of embryo transfer based on the ERA results can improve pregnancy rates compared to using a standard transfer schedule. The ERA test is currently being clinically validated in an international randomized controlled trial.
The document summarizes information about COVID-19, including its genotype and lifecycle. COVID-19 belongs to betacoronaviruses and causes severe acute respiratory syndrome. It has a large positive-sense RNA genome that encodes non-structural and structural proteins. The virus lifecycle involves binding to host cell receptors, releasing its RNA, replicating inside the cell, producing structural proteins, assembling a nucleoprotein complex in the endoplasmic reticulum, and being released from cells via Golgi vesicles. While similar to SARS-CoV and MERS-CoV, COVID-19 has differences in its genome and proteins. Potential treatments target viral replication or use monoclonal antibodies, but there is no certain cure currently.
This document describes an analysis pipeline for gene expression data. It involves steps like raw data normalization, statistics, differential gene expression analysis, and profile interpretation. It also discusses using the Affymetrix analysis system and mouse 430A chip for a nephridium experiment comparing different time points and genotypes. Multivariate analysis techniques like 2-way ANOVA and PCA are applied. The goal is to build systems biology analysis platforms integrating clinical records, biological databases, and dynamic databases for knowledge discovery.
J. biol. chem. 2016-shao-jbc.m116.724401andrei andrei
FBXO3 promotes ubiquitylation and transcriptional activity of AIRE. The study found that the E3 ubiquitin ligase FBXO3 interacts with phosphorylated residues on AIRE and promotes its ubiquitylation. This post-translational modification increases the interaction between AIRE and P-TEFb, potentiating their transcriptional activity on tissue-specific antigen genes in the thymus. Knockdown of FBXO3 decreased ubiquitylation and transcriptional activity of AIRE.
This document summarizes key events in translation including:
1. tRNAs act as adaptor molecules that pair each mRNA codon to its corresponding amino acid. Francis Crick first proposed this "adaptor hypothesis".
2. tRNAs undergo processing and modification before being charged with their cognate amino acids by aminoacyl tRNA synthetases.
3. The genetic code was deciphered through experiments using RNA polymers and identification of codon frequencies. Wobble base pairing allows multiple codons to code for the same amino acid.
4. Ribosomes catalyze peptide bond formation using rRNA. Bacterial and eukaryotic ribosomes differ in their subunit composition and initiation factors. Elongation
1) PSF, a pre-mRNA splicing factor, was identified as a constituent of PER complexes purified from mouse tissues.
2) PSF recruits the SIN3A-HDAC complex to the Per1 promoter in a circadian manner through interactions with PER complexes.
3) Recruitment of the SIN3A-HDAC complex by the PER complex leads to histone deacetylation at the Per1 promoter, providing a molecular mechanism for circadian clock negative feedback through rhythmic repression of Per1 transcription.
This document summarizes research on hematopoiesis and lymphopoiesis in zebrafish. It describes how zebrafish are used to study the development of blood and immune cells in early embryonic regions like the intermediate cell mass and caudal hematopoietic tissue, and how these precursors colonize the thymus and kidney. It also discusses mutations affecting thymus morphogenesis and the role of genes like runx1.
Researchers investigated the roles of two sirtuin genes, SIRT4 and SIRT7, in grapevine physiology. In vitro assays showed both genes exhibited very weak NAD+-dependent deacetylase activity, even in the presence of resveratrol. Long fragments of the true coding sequences for SIRT4 and SIRT7 were obtained via RT-PCR that highly corresponded to hypothetical sequences. Basal transcription of both genes was found in grape cell cultures. Exposure to methyl jasmonate and UV-C radiation showed no influence on SIRT4 expression, while SIRT7 expression was more complex and non-linear, requiring further study. The work provides a starting point for understanding
This document discusses endometrial receptivity and the Endometrial Receptivity Array (ERA) test. The ERA test analyzes the endometrial transcriptome using microarrays to determine if a patient's window of receptivity is receptive or non-receptive. For patients found to have a non-receptive window, personalizing the timing of embryo transfer based on the ERA results can improve pregnancy rates compared to using a standard transfer schedule. The ERA test is currently being clinically validated in an international randomized controlled trial.
The document summarizes information about COVID-19, including its genotype and lifecycle. COVID-19 belongs to betacoronaviruses and causes severe acute respiratory syndrome. It has a large positive-sense RNA genome that encodes non-structural and structural proteins. The virus lifecycle involves binding to host cell receptors, releasing its RNA, replicating inside the cell, producing structural proteins, assembling a nucleoprotein complex in the endoplasmic reticulum, and being released from cells via Golgi vesicles. While similar to SARS-CoV and MERS-CoV, COVID-19 has differences in its genome and proteins. Potential treatments target viral replication or use monoclonal antibodies, but there is no certain cure currently.
This document discusses using zinc-finger nucleases (ZFNs) to establish HIV-1 resistance in T cells by reducing expression of the CCR5 receptor. ZFNs were used to modify T cells in vitro and in mouse models. Results showed that ZFN-modified T cells had reduced CCR5 expression, survived and expanded during HIV-1 infection, increased T cell counts, and provided protection against viremia. Establishing HIV-1 resistance with ZFNs is important for developing an HIV cure through immunotherapy and cures for other viral infections.
Drosophila (fruit flies) are commonly used as a model for neural development research due to several advantages: they are inexpensive to culture, have a small and well-known genome, a short lifecycle, and many genetic tools available. Thomas Hunt Morgan established Drosophila as a genetic model in the early 1900s and won the 1933 Nobel Prize for this work. The Drosophila genome was fully sequenced in 2000, aiding further research. Drosophila have a 10-day lifecycle and well-studied embryonic neural development and neuroblast mapping. Genetic tools like P-element insertions and the UAS-GAL4 system allow for gene overexpression and knockdown experiments. Drosophila research has provided insights into neural pathways, phot
This document summarizes Angela Sanchez's research on how temperature-regulated genes affect aging in C. elegans. Key findings include:
- Many proteostasis and protein synthesis genes are differentially expressed between 15°C and 25°C.
- Inhibition of certain temperature-regulated proteostasis genes, like cpr-7 and egl-45, causes earlier onset of paralysis at 15°C but not 25°C.
- A neuromuscular exam showed locomotion defects, especially in backward movement, precede paralysis upon proteostasis gene inhibition. This suggests the dysfunction starts in motor neurons.
- Motor neurons innervating the posterior half have fewer synaptic connections, which
Sima Lev: VAP-B and its role in Amyotrophic lateral sclerosis Sima Lev
VAP-B and its role in Amyotrophic lateral sclerosis
The document discusses VAP-B and its role in Amyotrophic lateral sclerosis (ALS). ALS is a neurodegenerative disorder characterized by motor neuron death. The P56S mutation in VAP-B has been linked to familial ALS and causes protein aggregation, ubiquitination, and insolubility. The mutation induces conformational changes in VAP-B that enhance oligomerization and prevent interaction with lipid transfer proteins, impairing membrane trafficking and lipid homeostasis. This leads to endoplasmic reticulum stress, proteasomal dysfunction, and motor neuron degeneration.
This document describes the development of a plasmid-based reverse genetics system for rotaviruses. Key aspects include:
- Rotaviruses have a genome consisting of 11 segments of double-stranded RNA that encode 6 structural and 6 nonstructural proteins.
- A plasmid-based system was developed to genetically engineer rotaviruses, including constructing recombinant viruses expressing reporter genes by inserting GFP or NLuc into the NSP1 gene.
- Recombinant viruses lacking the NSP6 protein were generated to study its role, and growth curves and plaque formation of these mutant viruses were analyzed with wild-type viruses as controls.
#67 Análisis genómico comparativo de Clostridium solventogenicos: Una mirada ...Juan Rosas Morales
The document summarizes genomic analysis of Clostridium solventogenic bacteria strains. It finds that the strains are closely related to Clostridium butyricum based on average nucleotide identity and tetranucleotide frequency. Pan-genome analysis shows Clostridium has a large, open pan-genome. Single-copy ortholog detection is influenced by sequence quality and produces comparable results between different detection methods. Overall, the analysis helps characterize the taxonomy and metabolism of the solventogenic Clostridium strains.
GeneChrome, two biochemist joined hand & started this concept on the basis of 11 year experience in diagnostics segment with exposure of various technology.
We decided to focus on niche area where most of the laboratory does not focus & to provide quality services in health care segments like…
Autoimmunity
Allergy
Hormones
Vitamins
Genetics
Electrophoresis
Special biochemistry & many more profile ……………….
We have a team of technically sound professional in diagnostics to drive our mission without compromising our values.
Discriminating Facts from Artefacts in the Secreted Ly-6 Protein FamilyChris Southan
The document discusses several issues related to accurately characterizing the secreted Ly-6 protein family based on bioinformatic analysis. It describes the discovery of novel rat Ly-6 proteins from urine samples and EST data, but also finds chimeric mRNA sequences that combined portions of unrelated genes with Ly-6 sequences, complicating the analysis. Genome mapping showed the chimeras did not represent real gene fusions but likely arose from artifacts. While many rat and mouse homologs were identified, clear orthologs between species were difficult to determine due to high sequence divergence over time.
Seminario biología molecular. Juan camilo BoteroCamilo Botero
Rab27a is a Rab family protein involved in intracellular membrane transport. This study examined whether infection with human parainfluenza virus type 2 (hPIV-2) affects Rab27a expression levels. Using Rab-depleted and Rab-overexpressing cells, the study investigated the effects of Rab proteins on hPIV-2 growth. Results showed that depletion of Rab27a decreased hPIV-2 growth by reducing expression of the hPIV-2 F and HN proteins. This suggests Rab27a is involved in hPIV-2 growth by promoting transport of viral proteins.
T. brucei contains a single protein, PRORP, that functions in place of the typical multi-subunit RNA-protein nuclear RNase P complex. PRORP localizes to the nucleus and mitochondria of T. brucei and has RNase P enzymatic activity, processing pre-tRNAs. Expression of the T. brucei PRORP1 protein in yeast was able to replace the function of the yeast nuclear RNase P RNA component, demonstrating that a single protein can perform the role nuclear RNase P. This highlights the widespread nature of a "protein-only" pathway for nuclear tRNA processing.
This document summarizes research on developing a method for targeted delivery of interleukin-12 (IL-12) to tumors to enhance its anti-tumor effects while reducing systemic toxicity. Key points:
1) Separate administration and vascular targeting of the individual IL-12 subunits p35 and p40 could allow for their reassembly and activity specifically in tumors, avoiding toxicity from cytokine release syndrome.
2) Mutations were introduced to the subunits to allow their purification via different tags after co-expression and cleavage with TEV protease.
3) Surface plasmon resonance analysis showed the mutated subunits can still assemble into IL-12, and in vitro bioassays demonstrated the assembled IL-12 induces IFN
This document reports on a study investigating the effect of the ABCA4 gene variant c.5461-10T/C, a frequent cause of Stargardt disease (STGD1), on mRNA splicing. The study found that in patient-derived photoreceptor progenitor cells, this variant resulted in skipping of exon 39 or exons 39 and 40 in the ABCA4 mRNA. In vitro minigene assays confirmed the variant caused these splicing defects. Patients who were homozygous for the variant displayed a severe phenotype, with early onset of STGD1, poor vision, and legal blindness by age 25. The variant was found to be located on a founder haplotype lacking other disease-causing variants,
SARS-CoV-2 and Covid-19: Genetics, Treatment and VaccinesDenish Aloo
The document provides information on SARS-CoV-2 and COVID-19. It discusses the history of past respiratory disease pandemics. It defines coronaviruses and SARS-CoV-2, the virus that causes COVID-19. It describes the taxonomy, structure, genome organization, mutations, and life cycle of SARS-CoV-2. It also discusses the non-structural proteins, structural proteins, and accessory proteins of SARS-CoV-2.
Prof. Sima Lev - The role of Nir proteins in phosphatidylinositol (PI) transp...Sima Lev
1) Nir proteins are involved in phosphatidylinositol transport between membranes and localizing to membrane contact sites.
2) Nir2 specifically functions at ER-Golgi and ER-plasma membrane contact sites to transport phosphatidylinositol between the membranes.
3) Nir2 interacts with VAP proteins and its localization and lipid transport activity is affected by mutations in VAP proteins, influencing membrane morphology and traffic.
GENETIC ANALYSIS OF THE 2013/14 SAT2 FOOT-AND-MOUTH DISEASE (FMD) OUTBREAK IN...EuFMD
The document summarizes a study that analyzed genetic variation in isolates from a 2013-2014 foot-and-mouth disease outbreak in South Africa using next-generation sequencing. Key findings include:
1) The most variable genomic regions coded for immune response repression and antigenicity, while the most conserved regions involved capsid stability and replication efficiency.
2) Phylogenetic analysis showed that outbreak isolates clustered within a single genotype of topotype I and were grouped by collection location, indicating two possible transmission pathways.
3) Twenty-two amino acid sites underwent negative selection, while one underwent positive selection and should be further examined for vaccine impact.
The study identified genetic variation during the outbreak and implications for regularly updating SAT2
The document discusses several key concepts in molecular biology including DNA, RNA, transcription, translation, and protein synthesis. It explains that DNA is transcribed into RNA which is then translated into proteins. It describes the central dogma of molecular biology and provides more details on processes like transcription, splicing, and translation. It also discusses topics like alternative splicing, RNA editing, and RNA interference.
Genome editing as a tool for enhancing disease resistance in crops - Vladimir...OECD Environment
CRISPR-Cas genome editing can be used to engineer disease resistance in crops by targeting susceptibility genes. The document discusses using CRISPR to knock out the S-gene SlMLO1 in tomato, conferring resistance to powdery mildew. It also describes improving resistance to RNA and DNA viruses in Nicotiana benthamiana by targeting viral sequences or genes involved in viral infection. CRISPR allows generating mutations without transgenes for non-GM disease resistant crops.
1. The study investigates the interaction between Infectious spleen and kidney necrosis virus (ISKNV) ORF119L protein and host PINCH1 protein, leading to cardiovascular defects in zebrafish.
2. ORF119L is predicted to encode a protein containing three ankyrin repeats but lacking the kinase domain of integrin-linked kinase (ILK). ORF119L directly interacts with host PINCH protein and affects the host ILK-PINCH interaction.
3. Overexpression of ORF119L in zebrafish embryos results in myocardial dysfunction and disintegration of sarcomeric Z-disk, resembling phenotypes seen from inhibiting endogenous ILK. This suggests ORF119
The document summarizes research on the NS2B/NS3 protease of Japanese Encephalitis Virus. It discusses the virus's classification and disease symptoms. It also describes current prevention and treatment methods. The bulk of the document focuses on characterizing the molecular biology of the virus's NS2B/NS3 protease, including its structure, catalytic residues, and interactions with the NS2B cofactor. It explores using NS2B analogs as potential broad-spectrum drugs against flaviviruses.
Jordan and Doran - West Cork Leader Presentationdoran_justin
This document summarizes statistical data on population, housing, employment, income, and regional resilience in West Cork, Ireland from 2011. It finds that population in West Cork grew between 2006 and 2011, with the highest growth in the ten most populated districts. Housing vacancy rates were highest in 2011 in the districts with the lowest populations. Employment on the live register and income per person were both lower in County Cork than the state average. The document also examines four factors of regional resilience and finds that sectors like agriculture, fisheries and tourism contributed more to resilience in the South-West region. It concludes by arguing for continued strategic investment in regional development and use of the National Spatial Strategy to support sustainable economic recovery across Ireland.
Doran, Jordan and O'Leary (2012) - Presentation to SSISI 1st nov 2012doran_justin
This paper estimates the private returns to four different kinds of R&D spending on the probability of Irish and foreign-owned businesses engaging in product, process and organizational innovation. By providing econometric analysis of nearly 2000 businesses in the Community Innovation Survey: 2004 to 2006, it makes an important contribution to our understanding of the effects of Irish innovation policy, which has incentivized businesses to spend on R&D in Ireland. The main findings are that Irish-owned businesses are significantly more likely than foreign-owned to introduce new products as a result of creative R&D work undertaken. Foreign-owned businesses, which spend nearly 6 times more per worker on R&D than Irish-owned, enjoy very high returns mostly from the purchase or licence of patents. This reflects a fundamental difference in the innovation activities of these businesses, which is critical for policymakers’ understanding of the Irish innovation system.
This document discusses using zinc-finger nucleases (ZFNs) to establish HIV-1 resistance in T cells by reducing expression of the CCR5 receptor. ZFNs were used to modify T cells in vitro and in mouse models. Results showed that ZFN-modified T cells had reduced CCR5 expression, survived and expanded during HIV-1 infection, increased T cell counts, and provided protection against viremia. Establishing HIV-1 resistance with ZFNs is important for developing an HIV cure through immunotherapy and cures for other viral infections.
Drosophila (fruit flies) are commonly used as a model for neural development research due to several advantages: they are inexpensive to culture, have a small and well-known genome, a short lifecycle, and many genetic tools available. Thomas Hunt Morgan established Drosophila as a genetic model in the early 1900s and won the 1933 Nobel Prize for this work. The Drosophila genome was fully sequenced in 2000, aiding further research. Drosophila have a 10-day lifecycle and well-studied embryonic neural development and neuroblast mapping. Genetic tools like P-element insertions and the UAS-GAL4 system allow for gene overexpression and knockdown experiments. Drosophila research has provided insights into neural pathways, phot
This document summarizes Angela Sanchez's research on how temperature-regulated genes affect aging in C. elegans. Key findings include:
- Many proteostasis and protein synthesis genes are differentially expressed between 15°C and 25°C.
- Inhibition of certain temperature-regulated proteostasis genes, like cpr-7 and egl-45, causes earlier onset of paralysis at 15°C but not 25°C.
- A neuromuscular exam showed locomotion defects, especially in backward movement, precede paralysis upon proteostasis gene inhibition. This suggests the dysfunction starts in motor neurons.
- Motor neurons innervating the posterior half have fewer synaptic connections, which
Sima Lev: VAP-B and its role in Amyotrophic lateral sclerosis Sima Lev
VAP-B and its role in Amyotrophic lateral sclerosis
The document discusses VAP-B and its role in Amyotrophic lateral sclerosis (ALS). ALS is a neurodegenerative disorder characterized by motor neuron death. The P56S mutation in VAP-B has been linked to familial ALS and causes protein aggregation, ubiquitination, and insolubility. The mutation induces conformational changes in VAP-B that enhance oligomerization and prevent interaction with lipid transfer proteins, impairing membrane trafficking and lipid homeostasis. This leads to endoplasmic reticulum stress, proteasomal dysfunction, and motor neuron degeneration.
This document describes the development of a plasmid-based reverse genetics system for rotaviruses. Key aspects include:
- Rotaviruses have a genome consisting of 11 segments of double-stranded RNA that encode 6 structural and 6 nonstructural proteins.
- A plasmid-based system was developed to genetically engineer rotaviruses, including constructing recombinant viruses expressing reporter genes by inserting GFP or NLuc into the NSP1 gene.
- Recombinant viruses lacking the NSP6 protein were generated to study its role, and growth curves and plaque formation of these mutant viruses were analyzed with wild-type viruses as controls.
#67 Análisis genómico comparativo de Clostridium solventogenicos: Una mirada ...Juan Rosas Morales
The document summarizes genomic analysis of Clostridium solventogenic bacteria strains. It finds that the strains are closely related to Clostridium butyricum based on average nucleotide identity and tetranucleotide frequency. Pan-genome analysis shows Clostridium has a large, open pan-genome. Single-copy ortholog detection is influenced by sequence quality and produces comparable results between different detection methods. Overall, the analysis helps characterize the taxonomy and metabolism of the solventogenic Clostridium strains.
GeneChrome, two biochemist joined hand & started this concept on the basis of 11 year experience in diagnostics segment with exposure of various technology.
We decided to focus on niche area where most of the laboratory does not focus & to provide quality services in health care segments like…
Autoimmunity
Allergy
Hormones
Vitamins
Genetics
Electrophoresis
Special biochemistry & many more profile ……………….
We have a team of technically sound professional in diagnostics to drive our mission without compromising our values.
Discriminating Facts from Artefacts in the Secreted Ly-6 Protein FamilyChris Southan
The document discusses several issues related to accurately characterizing the secreted Ly-6 protein family based on bioinformatic analysis. It describes the discovery of novel rat Ly-6 proteins from urine samples and EST data, but also finds chimeric mRNA sequences that combined portions of unrelated genes with Ly-6 sequences, complicating the analysis. Genome mapping showed the chimeras did not represent real gene fusions but likely arose from artifacts. While many rat and mouse homologs were identified, clear orthologs between species were difficult to determine due to high sequence divergence over time.
Seminario biología molecular. Juan camilo BoteroCamilo Botero
Rab27a is a Rab family protein involved in intracellular membrane transport. This study examined whether infection with human parainfluenza virus type 2 (hPIV-2) affects Rab27a expression levels. Using Rab-depleted and Rab-overexpressing cells, the study investigated the effects of Rab proteins on hPIV-2 growth. Results showed that depletion of Rab27a decreased hPIV-2 growth by reducing expression of the hPIV-2 F and HN proteins. This suggests Rab27a is involved in hPIV-2 growth by promoting transport of viral proteins.
T. brucei contains a single protein, PRORP, that functions in place of the typical multi-subunit RNA-protein nuclear RNase P complex. PRORP localizes to the nucleus and mitochondria of T. brucei and has RNase P enzymatic activity, processing pre-tRNAs. Expression of the T. brucei PRORP1 protein in yeast was able to replace the function of the yeast nuclear RNase P RNA component, demonstrating that a single protein can perform the role nuclear RNase P. This highlights the widespread nature of a "protein-only" pathway for nuclear tRNA processing.
This document summarizes research on developing a method for targeted delivery of interleukin-12 (IL-12) to tumors to enhance its anti-tumor effects while reducing systemic toxicity. Key points:
1) Separate administration and vascular targeting of the individual IL-12 subunits p35 and p40 could allow for their reassembly and activity specifically in tumors, avoiding toxicity from cytokine release syndrome.
2) Mutations were introduced to the subunits to allow their purification via different tags after co-expression and cleavage with TEV protease.
3) Surface plasmon resonance analysis showed the mutated subunits can still assemble into IL-12, and in vitro bioassays demonstrated the assembled IL-12 induces IFN
This document reports on a study investigating the effect of the ABCA4 gene variant c.5461-10T/C, a frequent cause of Stargardt disease (STGD1), on mRNA splicing. The study found that in patient-derived photoreceptor progenitor cells, this variant resulted in skipping of exon 39 or exons 39 and 40 in the ABCA4 mRNA. In vitro minigene assays confirmed the variant caused these splicing defects. Patients who were homozygous for the variant displayed a severe phenotype, with early onset of STGD1, poor vision, and legal blindness by age 25. The variant was found to be located on a founder haplotype lacking other disease-causing variants,
SARS-CoV-2 and Covid-19: Genetics, Treatment and VaccinesDenish Aloo
The document provides information on SARS-CoV-2 and COVID-19. It discusses the history of past respiratory disease pandemics. It defines coronaviruses and SARS-CoV-2, the virus that causes COVID-19. It describes the taxonomy, structure, genome organization, mutations, and life cycle of SARS-CoV-2. It also discusses the non-structural proteins, structural proteins, and accessory proteins of SARS-CoV-2.
Prof. Sima Lev - The role of Nir proteins in phosphatidylinositol (PI) transp...Sima Lev
1) Nir proteins are involved in phosphatidylinositol transport between membranes and localizing to membrane contact sites.
2) Nir2 specifically functions at ER-Golgi and ER-plasma membrane contact sites to transport phosphatidylinositol between the membranes.
3) Nir2 interacts with VAP proteins and its localization and lipid transport activity is affected by mutations in VAP proteins, influencing membrane morphology and traffic.
GENETIC ANALYSIS OF THE 2013/14 SAT2 FOOT-AND-MOUTH DISEASE (FMD) OUTBREAK IN...EuFMD
The document summarizes a study that analyzed genetic variation in isolates from a 2013-2014 foot-and-mouth disease outbreak in South Africa using next-generation sequencing. Key findings include:
1) The most variable genomic regions coded for immune response repression and antigenicity, while the most conserved regions involved capsid stability and replication efficiency.
2) Phylogenetic analysis showed that outbreak isolates clustered within a single genotype of topotype I and were grouped by collection location, indicating two possible transmission pathways.
3) Twenty-two amino acid sites underwent negative selection, while one underwent positive selection and should be further examined for vaccine impact.
The study identified genetic variation during the outbreak and implications for regularly updating SAT2
The document discusses several key concepts in molecular biology including DNA, RNA, transcription, translation, and protein synthesis. It explains that DNA is transcribed into RNA which is then translated into proteins. It describes the central dogma of molecular biology and provides more details on processes like transcription, splicing, and translation. It also discusses topics like alternative splicing, RNA editing, and RNA interference.
Genome editing as a tool for enhancing disease resistance in crops - Vladimir...OECD Environment
CRISPR-Cas genome editing can be used to engineer disease resistance in crops by targeting susceptibility genes. The document discusses using CRISPR to knock out the S-gene SlMLO1 in tomato, conferring resistance to powdery mildew. It also describes improving resistance to RNA and DNA viruses in Nicotiana benthamiana by targeting viral sequences or genes involved in viral infection. CRISPR allows generating mutations without transgenes for non-GM disease resistant crops.
1. The study investigates the interaction between Infectious spleen and kidney necrosis virus (ISKNV) ORF119L protein and host PINCH1 protein, leading to cardiovascular defects in zebrafish.
2. ORF119L is predicted to encode a protein containing three ankyrin repeats but lacking the kinase domain of integrin-linked kinase (ILK). ORF119L directly interacts with host PINCH protein and affects the host ILK-PINCH interaction.
3. Overexpression of ORF119L in zebrafish embryos results in myocardial dysfunction and disintegration of sarcomeric Z-disk, resembling phenotypes seen from inhibiting endogenous ILK. This suggests ORF119
The document summarizes research on the NS2B/NS3 protease of Japanese Encephalitis Virus. It discusses the virus's classification and disease symptoms. It also describes current prevention and treatment methods. The bulk of the document focuses on characterizing the molecular biology of the virus's NS2B/NS3 protease, including its structure, catalytic residues, and interactions with the NS2B cofactor. It explores using NS2B analogs as potential broad-spectrum drugs against flaviviruses.
Jordan and Doran - West Cork Leader Presentationdoran_justin
This document summarizes statistical data on population, housing, employment, income, and regional resilience in West Cork, Ireland from 2011. It finds that population in West Cork grew between 2006 and 2011, with the highest growth in the ten most populated districts. Housing vacancy rates were highest in 2011 in the districts with the lowest populations. Employment on the live register and income per person were both lower in County Cork than the state average. The document also examines four factors of regional resilience and finds that sectors like agriculture, fisheries and tourism contributed more to resilience in the South-West region. It concludes by arguing for continued strategic investment in regional development and use of the National Spatial Strategy to support sustainable economic recovery across Ireland.
Doran, Jordan and O'Leary (2012) - Presentation to SSISI 1st nov 2012doran_justin
This paper estimates the private returns to four different kinds of R&D spending on the probability of Irish and foreign-owned businesses engaging in product, process and organizational innovation. By providing econometric analysis of nearly 2000 businesses in the Community Innovation Survey: 2004 to 2006, it makes an important contribution to our understanding of the effects of Irish innovation policy, which has incentivized businesses to spend on R&D in Ireland. The main findings are that Irish-owned businesses are significantly more likely than foreign-owned to introduce new products as a result of creative R&D work undertaken. Foreign-owned businesses, which spend nearly 6 times more per worker on R&D than Irish-owned, enjoy very high returns mostly from the purchase or licence of patents. This reflects a fundamental difference in the innovation activities of these businesses, which is critical for policymakers’ understanding of the Irish innovation system.
Active Enterprises provides marketing and communications services including painting. They offer direct services in Venice, Valencia, and the Far East. The document advertises a Sunday lunch buffet at the Terrace Restaurant of the Westin Dragonara Resort in Malta, featuring a selection of food and drinks for €30.95 per person.
Doran and Butler (2011) ISNE Presentationdoran_justin
This is a copy of the slide I presented at the Irish Society of New Economists Annual Conference in UCD on the 19th of August 2011. Please contact me if you are interested in obtaining a copy of the working paper.
This document provides an overview and introduction to effective use of SAP Sales and Distribution (SD). It discusses key SD concepts like organizational structures, master data, pricing, and integration with other SAP modules. The document also describes new features in recent SAP releases and how to navigate this book, which aims to help users get the most out of their SAP SD implementation.
1) The document analyzes differences in the drivers of innovation across sectors in Ireland using survey data.
2) It finds that while external interactions are important for product innovation, the effects vary across sectors. R&D is consistently important across all sectors.
3) For new products, manufacturing sectors differ in their external knowledge sources and the importance of being indigenous or foreign-owned, calling for nuanced sectoral innovation policies.
This document summarizes statistical data on population, housing, employment, income, and regional resilience in West Cork, Ireland from 2011. It finds that population in West Cork grew between 2006 and 2011, with the highest growth in the ten most populated districts. Housing vacancy rates were highest in 2011 in the districts with the lowest populations. Employment on the live register and income per person were both lower in County Cork than the state average. The document also examines four factors of regional resilience and finds that sectors like agriculture, fisheries and tourism contributed more to resilience in the South-West region. It concludes by arguing for continued strategic investment in regional development and infrastructure to support economic recovery across Ireland.
This document contains contact information for Sanit Klamchanuan, an illustrator and printmaker. It lists their name, phone number, email, occupation, and website URL repeated over multiple lines. The contact details provided are for Sanit Klamchanuan, an illustrator and printmaker, and includes their phone number, email, and website.
This document contains contact information for Sanit Klamchanuan, an illustrator and printmaker. It lists their name, occupations, email address, phone number, and website URL repeated multiple times. The contact details provided can be used to reach Sanit Klamchanuan for illustration and printmaking work.
This document provides guidance for applicants to the North/South Postgraduate Scholarships offered by Universities Ireland and the Electricity Supply Board (ESB) for the 2012-2013 academic year. Five scholarships worth €15,000 each will be awarded, with three for studies in energy and engineering sponsored by Universities Ireland and ESB, and two for other fields sponsored by Universities Ireland. To be eligible, applicants must be Irish or Northern Irish students willing to relocate to study in the other jurisdiction. Applicants must submit a 1,400-1,500 word essay explaining why they wish to study in the other jurisdiction and how their studies will enhance innovation or all-island perspectives. The application deadline is May 25
The purpose of this paper is to analyse the drivers of eco-innovation and to compare the impact of eco-innovation and non-eco-innovation on firm performance. The paper provides insights into the role government regulation can play in directing and stimulating eco-innovation. The findings suggest that regulation and customer perception can explain a firm’s decision to engage in eco-innovation. Eco-innovation is also found to be more important than non-eco-innovation in determining firm performance.
Document sur l'Auto provisioning, contacts, presence et streaming sur asteriskEmeric Kamleu Noumi
Ce document complète la présentation en powerpoint sur l'auto provisioning, la présence et le streaming sur asterisk. Elle détaille l'implémentation de tous ces services de manière détaillée.
Travail de Fin d'Etudes 2014 : L'intégration de la visioconférence pour rendr...Alessio Fancello
Voici mon TFE, réalisé durant ma dernière année de bachelier en Ecriture Multimédia (2013-2014). Le but de ce travail fut la création d'une plate-forme communautaire de cours de cuisine en ligne (par visioconférence). Autrement dit, un simple blog culinaire mais qui offre plus d'interactivité à ses lecteurs de par l'organisation de cours de cuisine gratuits en ligne et en les faisant participer à ceux-ci.
Ce travail m'a valu une distinction. C'est pourquoi j'ai décidé de le partager. Il sera peut-être une source d'inspiration pour tout étudiant passionné de web et qui devra, un jour, réaliser un travail similaire.
ANT2- Atelier 2: Communication stratégique efficace et planifiéeDogstudio pour le BEP
Atelier organisé dans le cadre du parcours ANT 2, initiative du Bep, Bureau Economique de la Province de Namur et animé le 30 novembre à Namur, par Gerald Stein, Directeur de l'agence Léon Travel Tourisme.
This document summarizes a study investigating the minimum requirements for reconstituting an RNA interference (RNAi) pathway in yeast. The key findings are:
1) RNAi can be reconstituted in yeast by introducing the Dicer and Argonaute proteins from another yeast species, Saccharomyces castellii, but not with human Dicer.
2) Both S. castellii and human Argonaute proteins require regulation by the heat shock protein Hsp90 to function in the yeast RNAi pathway, suggesting this regulatory mechanism has been conserved.
3) Unlike previous reports, the study found that human Dicer, TRBP2 and Argonaute2 were not sufficient to reconstit
Western Blotting Of Camkii Β And T 287Beth Salazar
1. Tomato production is affected by various bacterial, fungal and viral diseases which can cause considerable yield losses.
2. One of the most devastating diseases is tomato leaf curl disease (ToLCD), caused by geminiviruses, which is increasing worldwide and poses a major constraint to tomato production in India.
3. ToLCD causes serious yield losses according to studies from the 1940s and more recently. Effective management strategies are needed to control this and other diseases threatening tomato production.
Cloning and expression of the Nodamura virus RNA-dependent RNA polymerase
Poster presentation at Society for the Advancement of Chicanos and Native Americans in Science (SACNAS) National Conference, October 2012, Seatltle, WA
In this research paper from the Spring 2015 semester, I described my analysis of certain genome scaffolds, or gaps within the Malaclemys terrapin genome. I examined seven of these scaffolds and determined their approximate sizes through Polymerase Chain Reaction (PCR) and Gel Electrophoresis. The DNA was then prepped to be sent for sequencing by an external source. The resulting chromatograms gave inconclusive results on the exact sequences of these scaffolds.
Hotspot mutation and fusion transcript detection from the same non-small cell...Thermo Fisher Scientific
The presence of certain chromosomal Header
rearrangements and the subsequent fusion
gene derived from translocations has been
implicated in a number of cancers. Hundreds of
translocations have been described in the
literature recently but the need to efficiently
detect and further characterize these
chromosomal translocations is growing
exponentially. The two main methods to identify
and monitor translocations, fluorescent in situ
hybridization (FISH) and comparative genomic
hybridization (CGH) are challenging, labor
intensive, the information obtained is limited,
and sensitivity is rather low. Common sample
types for these analyses are biopsies or small
tumors, which are very limited in material
making the downstream measurement of more
than one analyte rather difficult; obtaining
another biopsy, using a different section or
splitting the sample can raise issues of tumor
heterogeneity. The ability to study mutation
status as well as measuring fusion transcript
expression from the same sample is powerful
because you’re maximizing the information
obtained from a single precious sample and
eliminating any sample to sample variation.
Here we describe the efficient isolation of two
valuable analytes, RNA and DNA, from the
same starting sample without splitting, followed
by versatile and informative downstream
analysis. This methodology has been applied to
FFPE and degraded samples as well as fresh
tissues, cells and blood. DNA and RNA were
recovered from the same non-small cell lung
adenocarcinoma sample and both mutation
analysis, as well as fusion transcript detection
was performed using the Ion Torrent PGM™
platform on the same Ion 318™ chip. Using
10ng of DNA and 10ng of RNA input, we
applied the Ion AmpliSeq™ Colon and Lung
Cancer panel to analyze over 500 COSMIC
mutations in 22 genes and the Ion AmpliSeq™
RNA Lung Fusion panel to detect 40 different
fusion transcripts.
1. The document discusses gene expression methods used to study the var2 and var3 genes of Plasmodium falciparum, which cause malaria.
2. Microarray, northern blotting, and RT-qPCR methods are described for analyzing var gene expression at different parasite stages. Studies found var2 mRNA is expressed at higher levels, associated with more severe malaria.
3. Understanding var gene expression is important as it leads to production of PfEMP1, which allows the parasite to bind red blood cells and evade the immune system, causing infection. Interfering with var gene expression may help circumvent malaria's dangers.
2004 paper primer ctx dissemination of ctx m-type -lactamases among clinical ...JairAlexanderTllez
This document summarizes a study analyzing 19 clinical isolates of Enterobacteriaceae (16 E. coli and 3 K. pneumoniae) collected from four hospitals in Paris, France between 2000-2002 that exhibited resistance to extended-spectrum cephalosporins. Testing found the resistance was due to various CTX-M-type beta-lactamase enzymes, predominantly CTX-M-15. Most isolates produced both TEM-1 and CTX-M enzymes. The blaCTX-M genes were located on large plasmids and often upstream of the insertion sequence ISEcp1. Five isolates had identical plasmid fingerprints, suggesting clonal dissemination of CTX-M-15-producing strains in
Detection of ehrlichia platys dna in brown dog ticksJosephine Huang
This document reports on a study that detected Ehrlichia platys DNA in brown dog ticks (Rhipicephalus sanguineus) collected from dogs in Okinawa Island, Japan. Key findings include:
- Partial 16S rRNA gene sequences of E. platys were detected in 3 out of 32 ticks collected from 2 dogs using PCR and sequencing.
- This represents the first detection of E. platys in Japan and the first report of detecting it in ticks.
- Sequence analysis showed the 3 positive ticks were highly similar (99.7-100% identical) to known E. platys sequences, confirming the detection.
- This suggests R. sanguineus ticks
The document describes the establishment of immortalized human amniotic epithelial cell (iHAE) lines. HAE cells were extracted from placentas and infected with retroviruses containing HPV16 E6/E7 and hTERT genes to extend their lifespan. The iHAE lines showed extended proliferation ability and expression of stem cell markers. They maintained multipotent differentiation potential as demonstrated by their ability to differentiate into adipocytes, osteocytes, neurons, and cardiac cell types. The iHAE cells represent a promising new cell source for applications in regenerative medicine and cell therapy due to their immunosuppressive properties and differentiation potential.
Molecular characterization of anaplasma platys strains from dogs in sicily, i...Josephine Huang
1) Researchers analyzed blood samples from 344 dogs in Sicily, Italy to characterize strains of Anaplasma platys.
2) They found A. platys DNA in 14 dogs (4% prevalence) through PCR and gene sequencing of the 16S rDNA, groESL, and gltA genes.
3) Sequence analysis identified at least 3 different genotypes of A. platys among the Sicilian dog samples based on variations in the gltA gene.
The ribosomal RNA gene unit of Tritrichomonas foetus was cloned and analyzed. Southern blot analysis showed the rDNA unit is organized as a tandem head to tail repeat of 6 kb, with 12 copies present. The small subunit rRNA is one of the shortest reported at 1571 bp, while the 5.8S rRNA is 159 bp. Northern blot analysis detected primary and precursor rRNA transcripts of 5.8 kb and 4 kb. Sequence analysis confirmed the secondary structure of the small subunit rRNA is similar to other eukaryotes, while being shorter in variable regions.
Regulation Of Atp7 A Gene Expression By The Grx1 As An Inducer In Menkes D...pranamees
This document summarizes an engineering approach to address Menkes disease by expressing an ATP7A-Glrx1 gene cassette. Menkes disease is caused by mutations in the ATP7A gene resulting in a truncated copper-transporting protein. The approach involves designing an expression vector containing the ATP7A gene and the Glrx1 gene, which interacts with ATP7A, to allow Glrx1 to potentially restore copper transport function despite ATP7A truncation upon transfection into intestinal cells. Validation would assess GFP expression and copper transport capability of the transfected truncated ATP7A protein with co-expressed Glrx1.
This document summarizes a research article published in The Journal of Immunology in 2008. The study found that:
1) FOXP3, a transcription factor important for regulatory T cells, interacts with the nuclear receptor RORα.
2) Full-length FOXP3, but not a shorter isoform lacking exon 2, is able to inhibit RORα's ability to activate transcription.
3) Mutation of an LxxLL motif in exon 2 abolished FOXP3's interaction with and repression of RORα. Expression of RORα leads to expression of Th17 cell-related genes, which full-length FOXP3, but not the shorter isoform, was able to inhibit
The document summarizes experiments conducted to isolate and analyze a gene called mrfA involved in aerial hyphae development in Monascus ruber. Key findings include:
1. M. ruber mutants with disrupted mrfA showed abnormal hyphae growth compared to the original strain.
2. TAIL-PCR and other techniques were used to isolate the mrfA gene sequence.
3. A knock-out vector was constructed and transformed into M. ruber, resulting in transformants that exhibited autolytic aerial hyphae.
Simultaneous Isolation of RNA & DNA from one FFPE SampleQIAGEN
The document summarizes the AllPrep DNA/RNA FFPE Kit, which simultaneously isolates genomic DNA and total RNA from formalin-fixed paraffin-embedded (FFPE) tissue samples. FFPE samples are lysed and centrifuged to separate the RNA-containing supernatant from the DNA-containing pellet. The supernatant and pellet are then processed separately to purify high-quality RNA and DNA suitable for downstream applications like real-time PCR and pyrosequencing. Results show the kit yields RNA and DNA of sufficient quality and quantity from old FFPE samples for gene expression analysis and detection of genetic mutations.
This document describes a method for performing RNA sequencing on single nuclei. Key points:
1) The authors demonstrate that double-stranded cDNA can be synthesized from single mouse neural progenitor cell nuclei and hippocampal tissue nuclei, allowing for whole transcriptome sequencing.
2) On average, sequencing of single nuclei detected over 16,000 of the approximately 24,000 mouse protein-coding genes.
3) Analysis of single nuclei avoids issues with dissociating intact cells from complex tissues, is applicable across eukaryotic species, and provides insight into nuclear gene regulation.
4) RNA sequencing of single nuclei is a powerful new method for investigating gene expression at the single cell level without disrupting cells.
2011 - Cellular inhibitor of apoptosis protein-1 (cIAP1) can regulate E2F1 tr...Simon Gemble
Cellular inhibitor of apoptosis protein-1 (cIAP1) can directly interact with the transcription factor E2F1 and increase its transcriptional activity. cIAP1 is recruited to E2F1 binding sites on cyclin E and cyclin A promoters in a cell cycle-dependent manner. Silencing cIAP1 inhibits E2F1 DNA binding and transcriptional activation of cyclin E, reducing cell proliferation. Thus, one function of nuclear cIAP1 is to regulate E2F1 transcriptional activity and control cell cycle progression.
RNA Extraction of Peste Des Petits Ruminants Virus (PPRV) from Clinical Sampl...ZULKIFAL HUSSAIN
This document describes a study that evaluated two RNA extraction methods, Tri-reagent and Acid guanidinium thiocyanate–phenol–chloroform (AGPC), for detecting Peste Des Petits Ruminants Virus (PPRV) in clinical samples. RNA was extracted from 10 tissue samples that tested positive for PPRV using Immuno-capture ELISA. Both extraction methods produced RNA of sufficient quality and purity for downstream applications. The study found that both Tri-reagent and AGPC are effective methods for extracting RNA from PPRV samples and can enable accurate diagnosis of the disease. Rapid detection of PPRV through nucleic acid-based methods like these helps control outbreaks by facilitating early
This study examines the expression of nicotinic acetylcholine receptors (nAChRs) in neuroepithelial bodies (NEBs) of neonatal hamster lung. The key findings are:
1) NEB cells express mRNA for the β2 subunit of nAChRs and contain α4, α7, and β2 nAChR subunits, as shown by in situ hybridization and immunofluorescence.
2) Patch clamp recordings of NEB cells show that nicotine activates inward currents in a concentration-dependent manner, mediated by nAChRs.
3) The nicotine-induced currents have properties consistent with α3β2, α4β2, and α7
Adhd Medication Shortage Uk - trinexpharmacy.comreignlana06
The UK is currently facing a Adhd Medication Shortage Uk, which has left many patients and their families grappling with uncertainty and frustration. ADHD, or Attention Deficit Hyperactivity Disorder, is a chronic condition that requires consistent medication to manage effectively. This shortage has highlighted the critical role these medications play in the daily lives of those affected by ADHD. Contact : +1 (747) 209 – 3649 E-mail : sales@trinexpharmacy.com
Rasamanikya is a excellent preparation in the field of Rasashastra, it is used in various Kushtha Roga, Shwasa, Vicharchika, Bhagandara, Vatarakta, and Phiranga Roga. In this article Preparation& Comparative analytical profile for both Formulationon i.e Rasamanikya prepared by Kushmanda swarasa & Churnodhaka Shodita Haratala. The study aims to provide insights into the comparative efficacy and analytical aspects of these formulations for enhanced therapeutic outcomes.
Histololgy of Female Reproductive System.pptxAyeshaZaid1
Dive into an in-depth exploration of the histological structure of female reproductive system with this comprehensive lecture. Presented by Dr. Ayesha Irfan, Assistant Professor of Anatomy, this presentation covers the Gross anatomy and functional histology of the female reproductive organs. Ideal for students, educators, and anyone interested in medical science, this lecture provides clear explanations, detailed diagrams, and valuable insights into female reproductive system. Enhance your knowledge and understanding of this essential aspect of human biology.
Integrating Ayurveda into Parkinson’s Management: A Holistic ApproachAyurveda ForAll
Explore the benefits of combining Ayurveda with conventional Parkinson's treatments. Learn how a holistic approach can manage symptoms, enhance well-being, and balance body energies. Discover the steps to safely integrate Ayurvedic practices into your Parkinson’s care plan, including expert guidance on diet, herbal remedies, and lifestyle modifications.
8 Surprising Reasons To Meditate 40 Minutes A Day That Can Change Your Life.pptxHolistified Wellness
We’re talking about Vedic Meditation, a form of meditation that has been around for at least 5,000 years. Back then, the people who lived in the Indus Valley, now known as India and Pakistan, practised meditation as a fundamental part of daily life. This knowledge that has given us yoga and Ayurveda, was known as Veda, hence the name Vedic. And though there are some written records, the practice has been passed down verbally from generation to generation.
Does Over-Masturbation Contribute to Chronic Prostatitis.pptxwalterHu5
In some case, your chronic prostatitis may be related to over-masturbation. Generally, natural medicine Diuretic and Anti-inflammatory Pill can help mee get a cure.
Muktapishti is a traditional Ayurvedic preparation made from Shoditha Mukta (Purified Pearl), is believed to help regulate thyroid function and reduce symptoms of hyperthyroidism due to its cooling and balancing properties. Clinical evidence on its efficacy remains limited, necessitating further research to validate its therapeutic benefits.
Cell Therapy Expansion and Challenges in Autoimmune DiseaseHealth Advances
There is increasing confidence that cell therapies will soon play a role in the treatment of autoimmune disorders, but the extent of this impact remains to be seen. Early readouts on autologous CAR-Ts in lupus are encouraging, but manufacturing and cost limitations are likely to restrict access to highly refractory patients. Allogeneic CAR-Ts have the potential to broaden access to earlier lines of treatment due to their inherent cost benefits, however they will need to demonstrate comparable or improved efficacy to established modalities.
In addition to infrastructure and capacity constraints, CAR-Ts face a very different risk-benefit dynamic in autoimmune compared to oncology, highlighting the need for tolerable therapies with low adverse event risk. CAR-NK and Treg-based therapies are also being developed in certain autoimmune disorders and may demonstrate favorable safety profiles. Several novel non-cell therapies such as bispecific antibodies, nanobodies, and RNAi drugs, may also offer future alternative competitive solutions with variable value propositions.
Widespread adoption of cell therapies will not only require strong efficacy and safety data, but also adapted pricing and access strategies. At oncology-based price points, CAR-Ts are unlikely to achieve broad market access in autoimmune disorders, with eligible patient populations that are potentially orders of magnitude greater than the number of currently addressable cancer patients. Developers have made strides towards reducing cell therapy COGS while improving manufacturing efficiency, but payors will inevitably restrict access until more sustainable pricing is achieved.
Despite these headwinds, industry leaders and investors remain confident that cell therapies are poised to address significant unmet need in patients suffering from autoimmune disorders. However, the extent of this impact on the treatment landscape remains to be seen, as the industry rapidly approaches an inflection point.
Osteoporosis - Definition , Evaluation and Management .pdfJim Jacob Roy
Osteoporosis is an increasing cause of morbidity among the elderly.
In this document , a brief outline of osteoporosis is given , including the risk factors of osteoporosis fractures , the indications for testing bone mineral density and the management of osteoporosis
2. K.Seedorf et a!.
1a ATACTAATTGTAATTTAATGAT AAAAAGGGAGTGACCGAAACGGT CGGGACCGAAACGGTGTATT;ATAGATGTGAG
I A-
TAACTTT TAAC
A ArACTTTC GT
1 01 AACACACC,ACAA TAC T ATGGCGCGC TT TGAGI.:ATCCAAC'ACGGCGACCCTACAAGC TACC TGA TC T GTGCACGGACT GACACTTCACTGCAAGACAT
M@tA(8ArgPh@G(uA5oP,roThrAr,QAr,ProTvrLv,L.uPr,oASoL.uCvsThrGIuL.uAsnThrS.rL.uGinAsoII. Al
20 1 AGJAA-ATAACCTGTGTATATTGCAGACAGTATTGGAACTTACAGJA<XATTTGAATTTGCATTTAAGATTTATTTGTGGTGTATAGAGACAGTATACCG
aTvrAr,gASergIIPro
GluIIeThrCvsVaITvrCvsLvsThrVetLeuGguL.uThrGluValPheGluPheAlaPheLvsAsoL.uPh.Va V RI
Xbal
301 CATGCTGCATGCCATAATGTATAGATTTTTATTCTAGAATTAGAGAATTAAGACATTATTCAGACTCTGTGTATGGAGACACATTGGAAACTACTA
HI sAl ^AI CvsHz sLv^ysCvsIeAsoPh*TvrS*rArgi IeArgGluL*uAraH sTvrS*rAsoS#rVaITvrGIvAsDThrLouGluLvsLouThrA&n RI
4 01 ACACTGGGTTATACAATTTATTAATAA3Gk-TGCCTGCGGTGCCAGAAACCGTTGAATCCAGCAGAAACTTAGACACCTTAATGAA^CGACGATTTCA
ThrGILeuTvrAsnL.uL.uII*AraCvsLeuArqCvsGInLvsProLuAsnProAIaGIuLvsL.uArgHisL.uAsnGIuLysArgArgPheHas RI
S O1 CAACAT AGC TGGGCAC TATAGAGGCCAGTGCCAT TCGTGCTGCACCGAGCACGACAGGAbCGAC TCCAAACGACGC CG TATATATTAA
Asni I AIGIGvHisTvrArgGIvGInCvsHisSOrCvsCvSASnArgAlaArgGInGIuAr9LOuGInArgArgArgGIuThrGlnVoI_ Rl
E7'-. .
60O1 GTA TGCATGGACC TAAGGCAACAT TGCAGACATTGTAT TGCAT TTAGAGCCCCAATGAAT TCCGGT TGACCT TCTATGTACCT TTAACGA
M.tHsGI vProLvsAI6 ThrLuGI nASDI I*VIL@uHi5sLuGIGuProGInnA6nGIuII6Pr oValAsoLLuLuCysiGUGluGInL@uSrASP R3
TOl1 C TCAGAGCGGA GATGAATAGATGGAGTTAATCATCAACAT TTAC-CAGCCCGACGAGCCG^ACCAr-AACGTCACAC^TGT TGTGTATGTGT TGT
SerGIuGIuGIuAsnAsoGIuI I*AsoGIvValAsnH4isGInHi4sL.uProAI&Ar9Ar 9At*GIuProGInAr gHisThrMetLeuCysMtCysCvs R3
o1 ^AGT GT GAGCCAGAAT TGAGC TAGTAGTACAG<C TCAGCAGACGACC TTCG^GCAT TCCAGCAGC TG TTTC TGAACACCC TGTCC TT TGTGTGTCCGT
L SCvsCluAIaArg ileGIuLOuVaIvIIGIuS.rS.rA.AspASOL@uAraAlIaPhGinGinLuPhLuAsnThrLuS*rPhVICysProTr R3
El01
gol GGTGT GCA TCCCAG.CAGTAAGcACAATe..CTGATCCAGAGETACAGACGGGGAGGGCACGGGCTTGTACGGCTGGT T TTATGTACAACTATTGTAG
CysAIaS*rGinGltleTh,M@tAiaA oPr@GiuGIyThrAsGIyGIuGIvThrGIvCysAmnGIvTroPh*TvfVIlG_nAII _eVeIA R3
1 00 CAAAACAGGAGATGTATATCAGATGACGAGGACGGAACAAGCAACAGA TGGATCG CTTT GAT T CACAT TTTGT
LvsLvsTh rGivASoV6I I.*SerAsOASDGIuADoGIuASnAI6ThrASoThrIGvS@VA*SOMtV6IASoPh@I I*AS&ThrGlnGIyThf PhCyS R3
I 1I0 1 GACAGGCAGAGCTAGAGACAGCACAGGCAT TGT TCCATGCGCACGGGGTCCACATGATGCACAGTGT TGCATGT TTTA^CGCAT TTGCAGGAG
.i uG I nA *G I uL*uGI uTh rAt .aG nAl L*LuPh*H1 i sA I*CI nGI We I H A*AnA*oAI *CI nVa I L*uH sV& I L*uLy*At 9LysPh*Al*I vGy
yCI R3
1 2 01 GCAGCACAGAACAGTCCAT TAGGGG;AGCGGCTGGAGGTGGATACAGAGTT^AGTCCACGGTTACAGAATAT CTTTTAAATAGTACC
SetThrGIuASnS.rProL@uGIyGIuAr9LuGIGuVOIAsoThrGiuL@uS@rProArgLeuGIAnGuI IeSerLuAsnSGIGyCIGnLySLySAl* A3
1 3o 1 A AAGGCGGCTGT TTACATATCAG^TAGTGGCTATGGCTGTTCTGAGTGGAGCAACACAGAT TCAGGTACTACAATGCCCACATCCGCAACT
I.IGnV.ITrT(hAAnGlyGIuHisGlyGlyASn
LvsArgArgL.uPh.ThrIlIeSerAIoSrIGyTyrGIvCvsS*rVGluVICIGuAl ThhIGnI R3
1 40O1 GTATGTAGTGGCGGCAGTACGGAGGC TATAGAcAcGGGGGCAr-AGAGGGCCAACAACACAGTGTAGACGCTACAA TGACATAGCAATATAGC^TG
VaCvySeSrGvGiySe rThrGI uAIll AsDAsnGlyGvIvThrGIuCIGVAsnASnSrS@frV IAsoGI vThrS@rA AnS.rASnfIIeGIuASnVOI
S R3
1 S O1 TAATCCACAATGTACCATAGCACATTAAGACTTGTTAAAAGTAACA^GATACGGGCTAT ISTTAGCAGTATTTAAA^CACAT^TC CTATC
AmnProGinCvsThr IlAilGInLLuLvsASoLuL@uLvsVUIAInASnLvSGlLnGvAI oMIYLAuAI V aIPheLyeAsDThrTyrGIyL*uS r A3
1 60 1 AT T TACAGA T TTAGT TAGA^TTT TAAGTGA TAACCACGTGCTACAGA TTGGGT TACAGCCTA TAT T T GAGTAACCCAACTACACGGT TTT
Ph*ThrAsoL.uV.iAr,gAsnPh.LV,SSrAsoLysThrThrCvsThrA,DTroV OIThrAl I I*PheGIvVaIA*nProThr I 1eAI*GIuGIyPh* R3
Xbal
1O01 AACACTAATACAGCCATTTATATTATATGCCCATATTCATGTCTAGA
LvsThIr L@uIIGIlnProPhI I*L@uTvrAHI8HsII*GIfnCvSL@u R3
PRINTOUT FOR EO/E?/E1 (66/4/049)
10 20 30 40 S0 60 7o so 90 100
b E6
E E7 E4Li
L2
HPV16 rJ El L2
2 3 4E61 1
BX 3i5 1? . 1.1
HPV 1S- ' I
_B B 1.3
X 1.5 X
B 25 H
x X 21
*111
Fig. 1. (a) Nucleotide sequence and derived amino acid sequence of the early region of HPV 18 (1730 bp). The numbering system was chosen by analogy to
other HPV DNA sequences based on alignment via the CAT-box region. The ORF E6, E7 and El are underlined, the corresponding translation initiation
codons are marked by the name of the particular ORF (E6, E7 and El). Stop codons are marked by black bars, reading frames are indicated by RI and R3.
Vertical arrows correspond to the 5' boundary of the ORF introduced into the expression vector. Brackets demonstrate splice donor and acceptor sites deduced
from cDNA sequences (Schneider-Gadicke and Schwarz, 1986). Two TATA boxes (position 19 and 66) upstream from the E6 translation initiation ATG are
boxed by dashed lines. (b) Alignment of HPV 18 DNA with HPV 16 DNA according to nucleotide sequence homologies. On top the distribution of the ORF
is shown. For partial sequence analysis restriction fragments of HPV 18 DNA generated by cleavage with BamHI (B), HindlIl (H) and XbaI (X) were used.
The 1.5 kb XbaI fragment was digested from the 5' end with exonuclease Bal31 resulting in progressive 5' deletions (2-11). The complete DNA sequence
information for the first 1730 bp was generated by overlapping sequencing as indicated by arrows.
140
3. Human papilloma virus in cervical carcinoma cells
Table I. Open reading frames expressed in E. coli linker. After confirming the sequence of the 5' ends of the in-
serts, appropriate sticky-end fragments were recloned into
ORF Position of the Position of the Antibodies expression vectors (see Table I). The expression vectors used
first nucleotide last nucleotide obtained were derivatives of plasmid pPLc 24 (Remaut et al., 1981,
HPV 16 1983a,b) modified by introducing a polylinker fragment with the
E6 110 556 + restriction sites for EcoRI, BamHI, Sall, PstI, BgllI, XbaI and
E7 585 855 + HindIII in three reading frames with respect to the amino ter-
El 1240 2811 minus of the MS2 polymerase. Details of construction will be
E4 3399 3617 + published elsewhere (H.Krafft, G.Krammer, K.Seedorf,
E5 3869 4097 U.M.Schatzle and W.G.Rowekamp, in preparation). E. coli
L2 4139 5654 C600/537 was transformed with the recombinant plasmids, syn-
LI 5692 7152 thesis of the fusion proteins was induced and the fusion proteins
L112 5692 6819 + were purified as described in Materials and methods.
L1232 6819 7152 +
Following this procedure we were able to express and purify
HPV 18 large amounts of protein (the yield from a 1 litre culture was
E6 112 571 + in the range of 5-20 mg protein) for E6, E7, E4 and LI of
E7 616 897 + HPV 16 and E6 and E7 of HPV 18 (see Figure 2).
El 1045 1730 + Subequently high-titre antisera were raised in rabbits against
LlI 5754 7152
the fusion proteins from these recombinants (see Figure 2 and
ORFs of HPV 16 and HPV 18 expressed as fusion proteins in E. coli Table I). All antisera were purified by ammonium sulphate
C600/537. The numbering system for the HPV 16 ORFs was taken from precipitation and immunoaffinity chromatography on columns
the DNA sequence published recently (Seedorf et al., 1985), for E6, E7 with proteins bound which had been extracted from induced
and El of HPV 18 as indicated in Figure 1. E. coli cells containing the parental expression vector.
aThe numbering system was chosen analogous to HPV 16 after homology
comparisons. Detection of HPV proteins in carcinoma cell lines by Western
blot analysis
From studies on the integration of HPV 18 and HPV 16 DNA
M E6B E6. El. El. E4. L122131I t-1 M into the cellular genome it is known that the 3' part of the early
-92 region is either deleted (HeLa, C4-1 and SiHa) or interrupted
s -68 (SW756 and CaSki) by the integration event (Schwarz et al.,
-0 1985; M.Durst, personal communication). HPV 18 cDNA
-45 sequence information from HeLa, SW756 and C4-1 cells
(Schneider-Gadicke and Schwarz, 1986) and HVP 16 transcripts
.Foo
.> -_
oo o -29 mapped in the CaSki cell line (Smotkin and Wettstein, 1986) sup-
ports these findings and suggests that proteins from the early
region can only be expected from the ORF E6, E7, El and
-21 possibly E4. Therefore, in our first Western blot experiments
specific antisera were used to identify these proteins in total cell
-12 extracts from cell lines derived from cervical carcinomas. In the
lines containing HPV 18 DNA, i.e. HeLa, C4-1 and SW756,
Fig. 2. Identification of HPV 16 and HPV 18 specific fusion proteins in cell a very strong 12-kd signal became visible with antibodies raised
extracts of transformed E. coli C600/537. The fusion proteins were enriched against the E7 fusion protein of HPV 18. This 12-kd protein band
by differential extraction from E. coli cells (see Materials and methods) and is specific for these three cell lines and was not detected in other
separated on a 12.5% polyacrylamide gel (10 jtg protein/lane). The position lines (see Figure 3a). A similar result was obtained with antisera
of HPV specific fusion proteins is indicated by arrows. M = mol. wt against the E7 fusion protein of HPV 16. In this case a specific
standard, L1232/16 = C-termninal fragment of the late protein LI of
HPV 16; L112/16 = N-terminal fragment of LI of HPV 16; E1/18 = 15-kd protein band can be identified in total protein extracts from
early protein El of HPV 18, etc. the SiHa and CaSki cell lines (see Figure 3b). This 15-kd pro-
tein is more abundant in the CaSki line than in the SiHa line cor-
by analogy to other papilloma viruses, up to position 1730 (see relating with the viral RNA levels in these cell lines (Schwarz
Figure 1). Additionally, 120 bp of the N-terminal part of the LI et al., 1985). Cell fractionation into membrane, cytoplasmic and
ORF of HPV 18 were sequenced (data not shown). The sequen- nuclear proteins indicated that the E7 protein is a cytoplasmic
cing reaction was performed according to the dideoxy chain ter- protein (data not shown).
mination method (Sanger et al., 1977) with modifications for In contrast, with antisera directed against E6, E4, El and LI
double-stranded DNA as template (Seedorf et al., 1985). This we were not able to identify specific proteins in any of these cell
sequence information together with homology comparisons to the lines.
HPV 16 DNA sequence recently published (Seedorf et al., 1985) In vitro translation of hybrid selected viral poly(A)+ RNA
allowed us to identify the ORF E6, E7, El and LI of HPV 18. prepared from cervical carcinoma-derived cell lines
Expression of open reading frames of HPV 16 and HPV 18 in The failure to detect E6, E4 and El proteins might be due to
E. coli and preparation of antisera the limited sensitivity of the Western blot analysis. To exclude
Based on this sequence information we cloned the ORF E6, E7, the possibility and to confirm that the E7 specific 12-kd and 15-kd
El, LI of HPV 18 and E6, E7, El, E4, E5, L2 and LI of proteins are indeed encoded by HPV 18 and HPV 16, respec-
HPV 16 into pUC8 or pUC 19. In most cases we used blunt-ended tively, we isolated viral-specific poly(A) + RNA from HeLa SiHa
fragments which were cloned into the HinclI site of the poly- and CaSki cells by hybrid selection. These RNAs were translated
4. K.Seedorf et al.
a" 1 2 3 4 5 6 kd -D i.-
k L 3 4 b 6 7 kd
-92
-68_Y; p-68
-45
-29
-21
--
-- -12 6 *_ -12
Fig. 3. Identification of E7 specific proteins of HPV 16 and HPV 18 by Western blot analysis in different cell lines. 50 jig of total cell proteins were
separated on a 12.5% polyacrylamide gel, transferred by Western blotting to a nitrocellulose filter, 'immunolabeled' with HPV 18 E7 specific antibodies (a)
and HPV 16 E7 specific antibodies (b) followed by incubation with 1 'tCi 1251-labeled protein A in both cases. Cell lines: 1 = HT-3 (control), 2 = C4-1,
3 = SW756, 4 = HeLa, 5 = CaSki, 6 = SiHa and 7 = C-33A (control). Filter a (probed with E7 HPV 18 antibodies) was exposed for 24 h, filter b
(probed with E7 HPV 16 antibodies) for 9 days. The E7 specific signals (12 kd and 15 kd) are indicated by arrows.
in a rabbit reticulocyte system. After immunoprecipitation with the values found on polyacrylamide gels. Since a complete E6
the corresponding antisera and isolation of the immunocomplexes ORF would code for a 19-kd protein we assume that the E6 pro-
with protein A-Sepharose we detected specific protein bands tein found in CaSki cells (11 kd) is generated by a splicing event.
for E7 (12 kd) and El (70 kd) of HPV 18 and for E6 (11 kd), The most abundant protein in cell lines containing HPV 16 or
E7 (15 kd) and E4 (10 kd) of HPV 16 in 12.5% polyacrylamide HPV 18 DNA is the E7 protein. This is in agreement with the
gels according to Laemmli (1970) (see Figure 4). No proteins fact that in the cell lines HeLa, C4-1, SW756 and CaSki all ear-
were detected with antisera raised against E6 of HPV 18 and LI ly transcripts contain a complete E7 ORF (Schneider-Gadicke,
of HPV 16. 1986; Smotkin and Wettstein, 1986). Genetic studies on the func-
tion of an E7 protein in BPV have shown that this gene product
Discussion is involved in the maintenance of plasmids at a high copy number
Northern blotting data from HeLa, SW756 and C4-1 as well as (Lusky and Botchan, 1985). Since neither HPV 16 nor HPV 18
DNA sequence information obtained from HPV 18 cDNA clones DNA have been identified as episomal plasmids in these cell lines
suggest that the early region of HVP 18 is transcribed into three an additional function for this protein has to be postulated. A
differentially spliced mRNA species containing cellular sequences similar argument can be applied to El where published data sug-
at the 3' end (Schneider-Gadicke and Schwarz, 1986). In HeLa gest an involvement of the BPV El protein in plasmid
cells these three early mRNAs can give rise to complete E6, E7 maintenance in transformed mouse cells (Lusky and Botchan,
and possibly a complete El, as well as a shortened version of 1984). Amino acid comparisons between the putative El gene
an E6 protein. An analogous situation can also be considered products of papilloma viruses (BPV 1, HPV la and HPV 6b)
in the case of SW756 and C4-1 cells, with the exception of and the large T protein of polyoma and Simian virus 40 show
El-specific mRNA which is mainly spliced at the major splice significant homologies in two blocks in their carboxy-terminal
donor site (Schneider-Gadicke and Schwarz, 1986). halves. These homologous regions correspond to sites involved
The transcription data of Schneider-Gadicke and Schwarz in the ATPase and nucleotide binding activities suggesting an in-
(1986) and our Western blotting and in vitro translation data in- volvement in DNA replication (Clertant and Seif, 1984).
dicate that the HPV 18 early mRNAs must be transcribed as Since an E4 protein has been recently suggested to be involv-
polycistronic RNA. The sizes of the E7 protein (12 kd) and the ed in viral particle maturation, its function in the CaSki cell line
El protein (70 kd) estimated from polyacrylamide gels after remains unclear.
hybrid selection or from Western blot experiments are consis- The identification of an E6 gene product in transformed cell
tent with the sizes predicted from the DNA sequence. lines containing HPV 16 or HPV 18 DNA could be important,
Also, in the CaSki cell line only parts of the HPV 16 early because the E6 protein of BPV has been shown to function as
region are transcribed. Detailed mapping data of these transcripts a transforming protein in DNA transfection experiments (An-
suggest that they all code for a complete E7 protein. A complete drophy et al., 1985). In fact, we find a E6 protein in the CaSki
as well as two shortened versions of an E6 protein can be cells just above the detection limit of the hybrid selection method,
generated by differential splicing. The ORF E2 is interrupted thus not excluding the possibility that in HeLa and SiHa cells
by splicing preventing synthesis of a complete E2 protein but an E6 protein is also present but at even lower levels.
allowing the expression of a complete E4 polypeptide (Smotkin Based on the results reported here, HPV 16 and HPV 18
and Wettstein, 1986). These results are confirmed by the iden- specific proteins (E7 E6, E4 of HPV 16, and E7 and El of
tification of an E7 protein, as well as translatable mRNAs for HPV 18, respectively) can possibly now be isolated by im-
E6 and E4 proteins in the CaSki cell line. The predicted sizes munoabsorption and thus assayed for their biological functions.
for E7 (12 kd) and E4 (10 kd) proteins are nearly identical to It has to be shown whether we can identify any of these proteins
142
5. Human papilloma virus in cervical carcinoma cells
V, 3,
8 0 11 ''2
92-
to F
69 -
46
*M 40
-
.-e
29
29-*s
,Ae' woo*
opp'oe-i,
12 5-
Fig. 4. Identification of the early proteins E6, E7, E4 of HPV 16 and E7
and El of HPV 18 after in vitro translation. Hybrid-selected poly(A)+ RNA Track Antibody used Identification Mol. wt
isolated from SiHa, CaSki (containing HPV 16 DNA) and HeLa cells for immuno- of specific
(containing HPV 18 DNA) was translated in vitro in a rabbit reticulocyte precipitation proteins
lysate containing [35S]methionine and [35S]cysteine. Viral polypeptides were
obtained by successive rounds of immunoprecipitation with specific antisera I HeLa E7 HPV 18 + 12 kd
and protein A-Sepharose. The order of immunoprecipitation was E7, E6, 2 CaSki E7 HPV 16 + 15 kd
E1, E4 and LI (L1232 and L1 12). The immunoprecipitated proteins were 3 SiHa E7 HPV 16 + 15 kd
separated on a 12.5% polyacrylamide gel. Specific proteins are indicated by 4 HeLa E6 HPV 18
arrows. Lane 1-3 and 10-12 were exposed for 3 days; lanes 4-9 for 5 CaSki E6 HPV 16 + I Ikd
3 weeks. (M = marker.) The schematic evaluation of this experiment is 6 SiHa E6 HPV 16
shown on the right. 7 HeLa E1 HPV 18 + 70 kd
8 CaSki E4 HPV 16 + 10 kd
in HPV 16 or HPV 18 infected tissues (e.g. cervical carcinomas, 9 SiHa E4 HPV 16 -
vulvar and penile cancers, premalignant lesions). This should give 10 HeLa LI HPV 16a -
us further insight into the different steps of the development of 11 CaSki LI HPV 16a -
human cancer related to HPV infections. Expressed fusion pro- 12 SiHa LI HPV 16a -
teins may also be useful in determining antibody titers in patients.
Our results may thus permit a wide spectrum of basic and clinical aA mixture of antibodies directed against L112 and L1232 was used.
applications.
EJxpression and purification of fusion proteins
Materials and methods ORFs of HPV 16 and HPV 18 (see Table I) were subcloned into pUC8 or pUC 19,
in most cases by blunt-end cloning into the Hincd site of the polylinker sequence.
Bacterial strains, plasmid vectors and cell lines Sticky-end fragments were then recloned into the correct expression vectors after
Plasmid preparations and transfections of bacteria were performed as described sequencing the 5' ends of the inserts. The E. coli strain C600/537 was transfected
by Maniatis et al. (1982). The ORFs of HPV 16 and HPV 18 used for sequenc- with the expression vectors carrying the indicated HPV sequences. Growth of
ing were subcloned into the plasmids pUC8 or pUC19 and transformed into E. coli the cells and induction was essentially as described by Remaut et al. (1981). After
strain HB 101. The original expression vector pPLc24 (kindly supplied by 3 h of growth at the restricted temperature, the cells of a 1 litre culture were
E.Remaut, Gent) allows the expression of inserts fused to the first 98 amino acids collected and suspended in 40 ml of 8% sucrose, 50 mM EDTA, 50 mM
of the MS2 polymerase under the control of the lambda PL promoter (Remaut Tris-HCI pH 8.0, treated with lysozyme (200 jig/ml, final concentration) for
et al., 1981, 1983a,b). The vector pPLc24 was modified by us as described 30 min and lysed by addition of 0.1% Triton X-100. After sonication and stir-
elsewhere (Krafft et al., in preparation). The appropriate host E. coli C600/537 ring for 15 min at 37°C the lysate was cleared by centrifugation at 40 000 g for
was a gift from H.Schaller, Heidelberg. This strain harbours a temperature-sensitive 15 min. The resulting pellet was successively extracted with 25 ml of PBS con-
CI repressor gene of phage lambda on a multicopy plasmid conferring kanamycin taining 0.1 % Triton X-100, then with 25 ml 1 M urea with sonication, further
resistance. stirring at 37°C and centrifugation as described before. The fusion proteins could
Cells of the cervical carcinoma lines HeLa, C4-1, SW756, SiHa, CaSki, HT-3 be purified from the 1 M urea residue by 7 M urea extraction yielding prepara-
and C-33A (originally obtained from the American Type Culture Collection and tions which normally contained between 70 and 90% fusion protein. The overall
kindly supplied by L.Gissmann, Heidelberg) were grown in monolayer cultures yield from a 1 litre culture was in the range of 5-20 mg protein for most of
in DMEM minimum essential medium containing 10% fetal calf serum. the expressed fusion peptides.
DNA sequencing Antisera and affinity chromatography
The DNA sequencing reaction was performed according to Sanger et al. (1977) Antisera were raised by immunizing rabbits (Herbert, 1973). Purification of the
with modifications for double-stranded DNA as template (Seedorf et al., 1985). antibodies was performed as described by Goding (1983). The sera were further
143
6. K.Seedorf et al.
purified by affinity chromatography on a Sepharose column containing MS2 and Pater,M.M. and Pater,A. (1985) Virology, 145, 313-318.
E. coli proteins covalently linked. Activation of CNBr-Sepharose and protein Remaut,E., Stanssens,P. and Fiers,W. (1981) Gene, 15, 81-93.
coupling were performed according to the manufacturer's instructions (Pharmacia, Remaut,E., Stanssens,P. and Fiers,W. (1983a) Nucleic Acids Res., 11,
Uppsala). 4677-4688.
Total cell extracts and Western blot analysis Remaut,E., Tsao,H. and Fiers,W. (1983b) Gene, 22, 103-113.
Sanger,F. Nicklen,S. and Coulson,A.R. (1977) Proc. Natl. Acad. Sci. USA, 74,
About 108 cells were collected (after trypsination), washed twice with PBS, 5463 -5467.
resuspended in 200 M1 PBS and lysed by adding 200 M1 of a two-fold concen- Sarver,N., Rabson,M.S., Yang,Y.C., Byrne,J.C. and Howley,P.M. (1984) J.
trated Laemmli sample buffer. About 50 Ag of total cell protein prepared from Virol., 52, 377-388.
the cell lines were separated on a 12.5% polyacrylamide gel (Laemmli, 1970) Schlegel,R., Wade-Glass,M., Rabson,M.S. and Yang,Y.-C. (1986) Science, 233,
and transferred by Western blotting to nitrocellulose (Schleicher and Schiill, BA 464-466.
85) as described by Towbin et al. (1979). The filters were coated by incubation Schiller,J.T., Vass,W.C. and Lowy,D.R. (1984) Proc. Natl. Acad. Sci. USA,
in 1 x PBS, 5% milk powder, 0.02% Tween 20 for 1 h. The antibody reaction 81, 7880-7884.
(dilution of the antisera was 1:200) was carried out overnight followed by three Schiller,J.T., Vass,W.C., Vousden,K.H. and Lowy,D.R. (1986) J. Virol., 57,
washes with the following buffers: PBS + 0.1% Triton X-100, PBS + 0.5% 1-6.
Triton X-100, PBS + 0.4 M NaCl. Staining with Staphylococcus aureus pro- Schneider-Gadicke,A. and Schwarz,E. (1986) EMBO J., 5, 2285 -2292.
tein A (1 ytCi 125I-labeled protein A from Amersham, Braunschweig) was car- Schwarz,E., Durst,M., Demankowski,C., Lattermann,O., Zeck,R., Wolfsper-
ried out for 3 h in PBS + 5 % milk powder, followed by the washing procedure ger,E., Suhai,S. and zur Hausen,H. (1983) EMBO J., 2, 2341-2348.
mentioned before. Filters were exposed to X-ray films with an intensifier screen. Schwarz,E., Freese,U.K., Gissmann,L., Mayer,W., Roggenbruck,B., Strem-
RNA isolation, hybrid selection and in vitro translation of virus specific poly(A)+ lau,H. and zur Hausen,H. (1985) Nature, 314, 111-114.
RNA Seedorf,K., Krammer,G., Durst,M., Suhai,S. and Rowekamp,W.G. (1985)
Total cellular RNA from 107 cells was isolated using the guanidine thiocyanate
_ Virology, 145, 181-185.
method according to Chirgwin et al. (1979). Poly(A)+ RNA purification and Smotkin,D. and Wettstein,F.O. (1986) Proc. Natl. Acad. Sci. USA, 83,
hybrid selection of viral RNA starting with 30 Ag of poly(A)+ RNA, was per- 4680-4684.
formed according to Maniatis et al. (1982). The viral enriched poly(A)+ RNA Spalholz,B.A., Yang,Y.-C. and Howley,P.M. (1985) Cell, 42, 183-191.
(5 ,Ml) was translated in 40 M1 of a rabbit reticulocyte lysate (Amersham, Towbin,H., Stiihelin,T. and Gordon,J. (1979) Proc. Natl. Acad. Sci. USA, 76,
Braunschweig) with 40 MCi [35S]methionine and [35S]cysteine each for 45 min 4350-4354.
at 30°C. The reaction was stopped by adding RNase (10 Mg/ml) and EDTA Yang,Y.C., Okayama,H. and Howley,P.M. (1985) Proc. Natl. Acad. Sci. USA,
(20 mM final concentration). Incorporation of labeled amino acids was monitored 82, 1030-1034.
by TCA precipitation. Immunoprecipitation of viral specific proteins was per- Yee,C., Krishnan-Hewlett,H.I., Buker,C.C., Schlegel,R. and Howley,P.M.
formed overnight at 4°C after addition of 200 M1 of PBS + 5% milk powder, (1985) Am. J. Pathol., 119, 361-366.
30 IM1 protein A-Sepharose (Pharmacia) and 30 Mt1 antiserum diluted 1:20 in PBS. zur Hausen,H. and Schneider,A. (1987) In Howley,P.M. and Salzman,N. (eds),
Immunocomplexes bound to protein A -Sepharose were collected by centrifugation The Papovaviridae: The Papilloma Viruses. Plenum Press, NY, in press.
(5 s, 5000 g). The pellets (protein A-Sepharose-antigen-antibody complexes)
were washed three times with the buffers already mentioned (see Western blot Received on 8 September 1986; revised on 10 October 1986
analysis). The last pellet was resuspended in 30 ,ul Laemmli sample buffer and
after incubation at 100°C for 5 min the proteins were separated in a 12.5% poly-
acrylamide gel. After electrophoresis the proteins were fixed wth 10% acetic acid
(30 min), incubated for 30 min in Amplify (Amersham), dried and exposed at
-700C.
Acknowledgements
We thank Dr L.Gissman, Dr E.Schwarz and Dr H.zur Hausen for helpful discus-
sions, U.Schatzle for technical assistance and M.Cole for typing the manuscript.
Parts of this work were supported by a grant from the Deutsche Forschungs-
gemeinschaft to W.G.R. (Ro 444/6-4).
References
Androphy,E.J., Schiller,J.T. and Lowy,D.R. (1985) Science, 230, 442-445.
Boshart,M., Gissmann,L., Ikenberg,H., Kleinheinz,A., Scheurlen,W. and zur
Hausen,H. (1984) EMBO J., 3, 1151-1157.
Chen,E.Y., Howley,P.M., Levinson,A.D. and Seeburg,P.H. (1982) Nature, 299,
529-534.
Chirgwin,J.M., Przybyla,A.E., MacDonald,R.J. and Rutter,W.J. (1979) Bio-
chemistry, 18, 5294-5299.
Clertant,P. and Seif,I. (1984) Nature, 311, 276-279.
Danos,O., Katinka,M. and Yaniv,M. (1982) EMBO J., 1, 231-236.
Danos,O., Giri,I., Thierry,F. and Yaniv,M. (1984) J. Invest. Dermatol., 83,
7-11.
Dartmann,K., Schwarz,E., Gissmann,L. and zur Hausen,H. (1986) Virology,
151, 124-130.
Doorbar,J., Campbell,D., Grand,R.J.H. and Gallimore,P.H. (1986) EMBO J.,
5, 355-362.
Duirst,M., Gissmann,L., Ikenberg,H. and zur Hausen,H. (1983) Proc. Natl. Acad.
Sci. USA, 80, 3812-3815.
Goding,J.W. (1983) In Monoclonal Antibodies: Principles and Practice. Academic
Press, Orlando.
Herbert,W.J. (1973) Laboratory animal techniques for immunology. In Weir,D.H.
(ed.), Handbook of Experimental Immunology. Vol. 3, Blackwell, Oxford.
Laemmli,U.K. (1970) Nature, 227, 680-685.
Lusky,M. and Botchan,M.R. (1984) Cell, 36, 391-401.
Lusky,M. and Botchan,M.R. (1985) J. Virol., 53, 955-965.
Maniatis,T., Fritsch,E.F. and Sambrook,J. (1982) In Molecular Cloning: A
Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Har-
bor, NY.
144