This document discusses leprosy, including its classification, transmission, diagnosis, and treatment. It analyzes samples from leprosy patients and their contacts in India to detect the bacteria Mycobacterium leprae using PCR of the rlep gene. Blood and slit skin smear samples were collected and their DNA extracted and amplified by PCR. Gel electrophoresis showed more positive results for slit skin samples from patients, but sample type did not affect results from contacts. While slit skin smears remain reliable, blood samples also show potential as an early diagnostic method.
Seroepidemiology for MERS coronavirus using microneutralisation and pseudopar...Ranawaka A.P.M Perera
We describe a novel spike pseudoparticle neutralisation
assay (ppNT) for seroepidemiological studies on
Middle East respiratory syndrome coronavirus (MERSCoV)
and apply this assay together with conventional
microneutralisation (MN) tests to investigate 1,343
human and 625 animal sera. The sera were collected
in Egypt as a region adjacent to areas where MERS has
been described, and in Hong Kong, China as a control
region. Sera from dromedary camels had a high prevalence
of antibody reactive to MERS-CoV by MERS NT
(93.6%) and MERS ppNT (98.2%) assay. The antibody
titres ranged up to 1,280 and higher in MN assays
and 10,240 and higher in ppNT assays. No other
investigated species had any antibody reactivity to
MERS-CoV. While seropositivity does not exclude the
possibility of infection with a closely related virus, our
data highlight the need to attempt detection of MERSCoV
or related coronaviruses in dromedary camels. The
data show excellent correlation between the conventional
MN assay and the novel ppNT assay. The newly
developed ppNT assay does not require Biosafety Level
3 containment and is thus a relatively high-throughput
assay, well suited for large-scale seroepidemiology
studies which are needed to better understand the
ecology and epidemiology of MERS-CoV.
Study was conducted in Rajendra Institute of Medical Science (RIMS), Ranchi, Jharkhand, during June 2012 to September 2013. The objective of the study was to know the hospital based incidence of Japanese Encephalitis (JE) and to study the age, sex and seasonal pattern of infection. 219 cases were analyzed by the Department of Microbiology, RIMS, Ranchi with clinical diagnosis. These samples were experimentally tested to confirm Japanese encephalitis by IgM Antibody Capture Enzyme Linked Immunosorbent Assay (MAC ELISA). Out of 219 cases, diagnosis was confirmed in 53 cases (24.20%) with male to female ratio of 0.89:1. All were below 15 yrs of age. Most of the cases were children. Clinically, fever (100%), altered sensorium (69.80%) headache (54.71%), neck rigidity (39.62%), Kernig’s sign (28.30%), convulsion (43.39%) and vomiting (35.80%) were the major findings observed. Majority of cases were from rural areas. The hospital based incidence of JE was found to be significant in the area of study. Effective measures should be taken to minimize disease transmission.
This document summarizes a study that evaluated the use of the Line Probe Assay (LPA) for rapid detection of Multi Drug Resistant Tuberculosis (MDR-TB) in Sudan. 300 smear-positive sputum samples were collected from TB patients and tested using LPA, culture-based drug susceptibility testing (DST), and conventional laboratory methods. Results found a high prevalence of MDR-TB in Sudan of 38% by DST and 37.3% by LPA. Comparison of LPA and DST results showed high accuracy of LPA for rapid detection of rifampin and isoniazid resistance with a sensitivity of 98.3% and specificity of 100%. LPA provided results within 2
The document summarizes a study that used nested PCR and gel electrophoresis to analyze DNA samples from birds in Peru in order to determine the prevalence of avian Plasmodium infection and investigate how climate change may affect infection rates. The results showed bands for the positive control but no bands for the bird samples, likely because few samples were actually infected based on information from collaborators, and differences in sample preparation or protocols may have affected the ability to detect infections. The document discusses limitations and avenues for future investigation.
This document describes a proposed study to detect Clostridium perfringens types in goats in Bannu district, Pakistan using multiplex PCR. The study aims to 1) detect C. perfringens in goat blood samples using PCR, 2) identify the toxin types produced, and 3) determine the epidemiological characteristics of C. perfringens in the district. Blood samples will be collected from clinically suspected goats and tested microscopically, through DNA extraction and PCR amplification to detect C. perfringens. Gel electrophoresis will also be used to detect the bacteria. Statistical analysis will be conducted to analyze the results.
Variable transcriptional adaptation between the laboratory (H37Rv) and clinic...Santhi Devasundaram
The remarkable success of M. tuberculosis as a pathogen is largely due to its ability to
persist within the host for long periods. To develop the effective intervention strategies, understanding the biology
of persistence is highly required. Accumulating evidences showed oxygen deprivation (hypoxia) as a potential
stimulus for triggering the transition of M. tuberculosis to a non-replicating persistent state analogous to
latency in vivo. To date, in vitro hypoxia experimental models used the laboratory adapted isolate H37Rv and
very little is known about the behavior of clinical isolates that are involved during disease outbreaks. Hence,
we compared the transcription profiles of H37Rv and two south Indian clinical isolates (S7 and S10) under hypoxia
to find differences in gene expression pattern.
This article summarizes a study which found that a single dose of the ChAdOx1 nCoV-19 vaccine prevented SARS-CoV-2 pneumonia in rhesus macaques. The vaccine elicited a robust immune response in mice and rhesus macaques without evidence of immune-enhanced disease. When vaccinated macaques were challenged with SARS-CoV-2, they had significantly lower viral loads and no pneumonia, unlike control animals who developed pneumonia. This demonstrates the vaccine's potential to prevent COVID-19 disease in humans.
A novel coronavirus from patients with pneumonia in china, 2019Juan Rubio
- In late December 2019, a cluster of patients with pneumonia of unknown cause was linked to a seafood market in Wuhan, China. Through testing samples from these patients, a novel coronavirus was discovered and named 2019-nCoV.
- Using samples from the pneumonia patients, researchers were able to isolate and culture the novel coronavirus (2019-nCoV) using human airway epithelial cells. Electron microscopy of the cultured cells showed coronavirus particles.
- Genomic sequencing of samples from the patients identified the virus as a new strain of coronavirus within the subgenus sarbecovirus, most closely related to SARS-CoV and MERS-CoV but distinct from them.
Seroepidemiology for MERS coronavirus using microneutralisation and pseudopar...Ranawaka A.P.M Perera
We describe a novel spike pseudoparticle neutralisation
assay (ppNT) for seroepidemiological studies on
Middle East respiratory syndrome coronavirus (MERSCoV)
and apply this assay together with conventional
microneutralisation (MN) tests to investigate 1,343
human and 625 animal sera. The sera were collected
in Egypt as a region adjacent to areas where MERS has
been described, and in Hong Kong, China as a control
region. Sera from dromedary camels had a high prevalence
of antibody reactive to MERS-CoV by MERS NT
(93.6%) and MERS ppNT (98.2%) assay. The antibody
titres ranged up to 1,280 and higher in MN assays
and 10,240 and higher in ppNT assays. No other
investigated species had any antibody reactivity to
MERS-CoV. While seropositivity does not exclude the
possibility of infection with a closely related virus, our
data highlight the need to attempt detection of MERSCoV
or related coronaviruses in dromedary camels. The
data show excellent correlation between the conventional
MN assay and the novel ppNT assay. The newly
developed ppNT assay does not require Biosafety Level
3 containment and is thus a relatively high-throughput
assay, well suited for large-scale seroepidemiology
studies which are needed to better understand the
ecology and epidemiology of MERS-CoV.
Study was conducted in Rajendra Institute of Medical Science (RIMS), Ranchi, Jharkhand, during June 2012 to September 2013. The objective of the study was to know the hospital based incidence of Japanese Encephalitis (JE) and to study the age, sex and seasonal pattern of infection. 219 cases were analyzed by the Department of Microbiology, RIMS, Ranchi with clinical diagnosis. These samples were experimentally tested to confirm Japanese encephalitis by IgM Antibody Capture Enzyme Linked Immunosorbent Assay (MAC ELISA). Out of 219 cases, diagnosis was confirmed in 53 cases (24.20%) with male to female ratio of 0.89:1. All were below 15 yrs of age. Most of the cases were children. Clinically, fever (100%), altered sensorium (69.80%) headache (54.71%), neck rigidity (39.62%), Kernig’s sign (28.30%), convulsion (43.39%) and vomiting (35.80%) were the major findings observed. Majority of cases were from rural areas. The hospital based incidence of JE was found to be significant in the area of study. Effective measures should be taken to minimize disease transmission.
This document summarizes a study that evaluated the use of the Line Probe Assay (LPA) for rapid detection of Multi Drug Resistant Tuberculosis (MDR-TB) in Sudan. 300 smear-positive sputum samples were collected from TB patients and tested using LPA, culture-based drug susceptibility testing (DST), and conventional laboratory methods. Results found a high prevalence of MDR-TB in Sudan of 38% by DST and 37.3% by LPA. Comparison of LPA and DST results showed high accuracy of LPA for rapid detection of rifampin and isoniazid resistance with a sensitivity of 98.3% and specificity of 100%. LPA provided results within 2
The document summarizes a study that used nested PCR and gel electrophoresis to analyze DNA samples from birds in Peru in order to determine the prevalence of avian Plasmodium infection and investigate how climate change may affect infection rates. The results showed bands for the positive control but no bands for the bird samples, likely because few samples were actually infected based on information from collaborators, and differences in sample preparation or protocols may have affected the ability to detect infections. The document discusses limitations and avenues for future investigation.
This document describes a proposed study to detect Clostridium perfringens types in goats in Bannu district, Pakistan using multiplex PCR. The study aims to 1) detect C. perfringens in goat blood samples using PCR, 2) identify the toxin types produced, and 3) determine the epidemiological characteristics of C. perfringens in the district. Blood samples will be collected from clinically suspected goats and tested microscopically, through DNA extraction and PCR amplification to detect C. perfringens. Gel electrophoresis will also be used to detect the bacteria. Statistical analysis will be conducted to analyze the results.
Variable transcriptional adaptation between the laboratory (H37Rv) and clinic...Santhi Devasundaram
The remarkable success of M. tuberculosis as a pathogen is largely due to its ability to
persist within the host for long periods. To develop the effective intervention strategies, understanding the biology
of persistence is highly required. Accumulating evidences showed oxygen deprivation (hypoxia) as a potential
stimulus for triggering the transition of M. tuberculosis to a non-replicating persistent state analogous to
latency in vivo. To date, in vitro hypoxia experimental models used the laboratory adapted isolate H37Rv and
very little is known about the behavior of clinical isolates that are involved during disease outbreaks. Hence,
we compared the transcription profiles of H37Rv and two south Indian clinical isolates (S7 and S10) under hypoxia
to find differences in gene expression pattern.
This article summarizes a study which found that a single dose of the ChAdOx1 nCoV-19 vaccine prevented SARS-CoV-2 pneumonia in rhesus macaques. The vaccine elicited a robust immune response in mice and rhesus macaques without evidence of immune-enhanced disease. When vaccinated macaques were challenged with SARS-CoV-2, they had significantly lower viral loads and no pneumonia, unlike control animals who developed pneumonia. This demonstrates the vaccine's potential to prevent COVID-19 disease in humans.
A novel coronavirus from patients with pneumonia in china, 2019Juan Rubio
- In late December 2019, a cluster of patients with pneumonia of unknown cause was linked to a seafood market in Wuhan, China. Through testing samples from these patients, a novel coronavirus was discovered and named 2019-nCoV.
- Using samples from the pneumonia patients, researchers were able to isolate and culture the novel coronavirus (2019-nCoV) using human airway epithelial cells. Electron microscopy of the cultured cells showed coronavirus particles.
- Genomic sequencing of samples from the patients identified the virus as a new strain of coronavirus within the subgenus sarbecovirus, most closely related to SARS-CoV and MERS-CoV but distinct from them.
This document discusses various diagnostic techniques for leptospirosis, a zoonotic bacterial infection acquired through contact with contaminated soil or water. It focuses on dark field microscopy, culture, ELISA, agglutination tests, and Faine's criteria. Dark field microscopy can detect leptospires in body fluids but has low sensitivity and specificity. Culture is the gold standard for confirmation but leptospires grow slowly over weeks. Serological tests like ELISA and agglutination tests detect antibodies but cannot confirm acute infection. Faine's criteria provides a scoring system for clinical diagnosis when laboratory tests are inconclusive.
This document describes a study to identify pathogens in Hyalomma ticks collected from cattle in various regions of Khyber Pakhtunkhwa, Pakistan. 70 engorged female ticks will be collected and identified to species. Genomic DNA will be extracted from the ticks and tested using PCR and sequencing to detect Theileria, Babesia, Borrelia burgdorferi, Rickettsia, and Coxiella burnetii pathogens. Sequence results will be compared to the GenBank database to identify the pathogens present. This will help determine the occurrence of tick-borne pathogens affecting cattle in Khyber Pakhtunkhwa.
This document summarizes a study on the isolation and molecular characterization of human adenovirus. The study found that out of 83 samples collected from eye secretions, 69 (83.13%) tested positive for human adenovirus using rapid tests and PCR. The highest rate of infection was found in individuals aged 16-30 years old (55.04%) and males had a higher rate of infection than females. Human adenovirus was successfully isolated by inoculating samples on chicken embryo fibroblast cell cultures and embryonated eggs, where cytopathic effects were observed. Molecular characterization was also conducted to identify the adenovirus strains present.
Proteomics Analysis of Three Different Strains of Mycobacterium tuberculosis...Santhi Devasundaram
The study analyzed protein expression profiles of three Mycobacterium tuberculosis strains (H37Rv, S7, S10) under aerobic and hypoxic conditions using two-dimensional electrophoresis and mass spectrometry. 49 protein spots were found to be overexpressed or newly emergent under hypoxia. Two antigens (ESAT-6, Lpd) were selected and used to stimulate blood samples from healthy household contacts and active TB patients. Flow cytometry analysis showed higher levels of antigen specific memory T cells in household contacts, suggesting these antigens could be potential vaccine targets. In vitro hypoxia experiments with clinical strains help identify antigens involved in persistence.
Sensitivity and Specificity of an In-house Sandwich ELISA Kit for Newcastle D...Dr. Md. Ehsanul Haque
Of all serological tests enzyme-linked immunosorbent assay (ELISA) is still considered the gold standard for the detection of antigens and antibodies of either macro or micro-organisms worldwide. The ELISA kits for serum antibody detection against many viruses and other micro-organisms of both man and animals are available in the market. Whereas, antigen detection ELISA kits for Newcastle disease virus
(NDV) is not yet available in Bangladesh. The Present study was designed for the development of an economically feasible In-house Sandwich ELISA and to test its sensitivity and specificity for the detection of NDV antigens from clinically suspected field samples. 96-well flat bottom polystyrene plates coated with hyperimmune polyclonal serum against NDV raised in rabbits was used to capture NDV
antigens. The anti-rabbit IgG and DAB with 30% H2O2 were used as conjugate and substrate respectively for standardization of the test method. The plate coated with serum diluted 10-3 was found suitable for capturing maximum antigen of NDV by the In-house Sandwich ELISA. The cut-off value of the present ELISA test was calculated as 0.855 and was able to capture the viral antigen present in the 10-4 fold
dilution of allantoic fluid (AF) which is equivalent to 1HA unit, indicating the highest degree of sensitivity of the newly developed ELISA. In case of field samples, the newly developed ELISA kit was able to detect 100% viral antigens of NDV present in the feces, 95.50% of the brain tissue and oro-nasal swab and 94.12% of colon swab samples of either naturally and experimentally infected birds in this study. The
ND virus specific polyclonal antibody used in the kit bind only with ND virus without any cross reactive antigens of other viruses of chicken like Avian influenza virus (AIV) and Infectious bursal disease viruses (IBDV). Therefore, findings of the present study clearly indicates that the newly developed In-house Sandwich ELISA kit can be used for rapid confirmatory diagnosis of Newcastle disease (ND) with minimum cost, using any kind of field samples from either sick or dead birds.
This document describes a study on the seroprevalence of measles IgG antibody in children in Bannu district, Pakistan. The study analyzed 650 blood samples collected from different hospitals and health centers in the district. 123 samples were found to be positive for measles IgG antibodies. Results showed higher prevalence of antibodies in females compared to males, in rural residents compared to urban, and varying by age and month. The study concluded that measles remains common in unvaccinated children in the district and recommended vaccination for all children.
ABSTRACT- Enteric fever is a major public health problem in developing countries like India. An early and accurate diagnosis is necessary for a
prompt and effective treatment. We have evaluated the diagnostic accuracy of ENTEROSCREEN-WBTM as compared to Widal test in rapid and early
diagnosis of enteric fever. A total of 145 patients serum samples were tested by Rapid ENTEROSCREEN-WBTM and Widal test including clinically
suspected cases of enteric fever of all age groups. Vaccinated individuals, patients on antibiotic therapy, patients who have other associated conditions,
patients suffering from fever due to non-enteric etiology & non consent patients were excluded. The overall sensitivity, specificity, positive
predictive value (PPV) and negative predictive value (NPV) of ENTEROSCREEN-WBTM considering Widal test as gold standard were 50% and
96%, 66.66% and 92.30% respectively. ENTEROSCREEN-WBTM was found to be significantly more specific. Although the Rapid ENTEROSCREEN-
WBTM tests are meant to diagnose of S. typhi. Ten patients who were ENTEROSCREEN-WBTM positive for S. typhi were also positive by
Widal test.
Key words- Enteric fever, Rapid ENTEROSCREEN-WBTM, Non-enteric etiology, S. typhi, Widal test
Association of leucocytosis and hemozoin pigment in leucocytes with disease s...iosrjce
IOSR Journal of Dental and Medical Sciences is one of the speciality Journal in Dental Science and Medical Science published by International Organization of Scientific Research (IOSR). The Journal publishes papers of the highest scientific merit and widest possible scope work in all areas related to medical and dental science. The Journal welcome review articles, leading medical and clinical research articles, technical notes, case reports and others.
Antibiotic resistance is increasing in Gram Negative organisms. It is important to know the antibiogram of the hospital to start empirical therapy. It can serve as a reference to clinician looking for information on antibiotic resistance. A retrospective analysis of the isolates obtained from January 2016 to December 2016 was performed. Samples were processed as per CLSI guideline. A total of 718 isolates were obtained. These were analysed for the prevalence
of MDR/XDR/PDR. It was found that XDR isolates are prevalent in our teaching hospital. The study showed an emergence in pan drug resistant isolates. The knowledge of local antibiogram
along with strong antibiotic stewardship program can help in guiding antibiotic therapy.This reduces antibiotic pressure among organisms and hence development of resistance.
This document discusses the history and regulation of the drug thalidomide. It notes that thalidomide was discovered in the 1960s to cause birth defects but has continued to be studied to treat other conditions. In 1998, the FDA approved thalidomide under the brand name Thalomid to treat erythemanodosumleprosum, a complication of leprosy. Due to the risks of birth defects, the FDA took steps to strictly control the drug's use, distribution, and monitoring of patients, especially women of childbearing age, to prevent another public health issue. Research into thalidomide's use for other diseases continues.
El coronavirus, relacionado con el virus que causa el SARS (síndrome respiratorio agudo severo), ha desencadenado un renovado debate sobre si las variantes de laboratorio de ingeniería de virus con posible potencial pandémico valen los riesgos.
En un artículo publicado en Nature Medicine 1 el 9 de noviembre, los científicos investigaron un virus llamado SHC014, que se encuentra en murciélagos de herradura en China. Los investigadores crearon un virus quimérico, compuesto por una proteína de superficie de SHC014 y la columna vertebral de un virus del SARS que se había adaptado para crecer en ratones e imitar una enfermedad humana. La quimera infectó las células de las vías respiratorias humanas, lo que demuestra que la proteína de superficie de SHC014 tiene la estructura necesaria para unirse a un receptor clave en las células e infectarlas. También causó enfermedades en ratones, pero no los mató.
----------------------
Engineered bat virus stirs debate over risky research
Lab-made coronavirus related to SARS can infect human cells.
12 November 2015
An experiment that created a hybrid version of a bat coronavirus — one related to the virus that causes SARS (severe acute respiratory syndrome) — has triggered renewed debate over whether engineering lab variants of viruses with possible pandemic potential is worth the risks.
In an article published in Nature Medicine 1 on 9 November, scientists investigated a virus called SHC014, which is found in horseshoe bats in China. The researchers created a chimaeric virus, made up of a surface protein of SHC014 and the backbone of a SARS virus that had been adapted to grow in mice and to mimic human disease. The chimaera infected human airway cells — proving that the surface protein of SHC014 has the necessary structure to bind to a key receptor on the cells and to infect them. It also caused disease in mice, but did not kill them
This document summarizes a study on the seroprevalence of typhoid fever among patients presenting with acute febrile illness at a clinical laboratory in Addis Ababa, Ethiopia from 2007 to 2011. A total of 5,029 patients were tested for typhoid using the Widal test. The results showed that 22% tested positive for typhoid. Males represented a higher percentage of patients (57%) compared to females (43%). The highest number of cases occurred in adults aged 20-40 years. Seasonally, more cases were seen in the spring and autumn months, with peaks in May and October. The number of cases increased each year from 2007 to 2011.
Isolation, Characterization, and Antibiotics Resistance Profile of Staphyloco...AdeyemiKayode2
This document summarizes a student's presentation on a project isolating, characterizing, and analyzing antibiotic resistance of Staphylococci bacteria from indoor air samples collected from student halls of residence at Obafemi Awolowo University, Nigeria. A total of 26 Staphylococci isolates were recovered from the air samples. Biochemical testing showed that 46% were DNase positive and 54% were DNase negative. Antibiotic susceptibility testing found resistance rates of 0%, 15.4%, and 38.5% to Ciprofloxacin, Gentamicin, and Tetracycline respectively. The presentation concludes that air contamination poses a health risk and calls for improved hygiene and ventilation to reduce
Background & objectives: In Odisha, several cases of dengue virus infection were detected for the first time in 2010, the importance of dengue as a serious mosquito-borne viral infection was felt only in 2011 with the reporting of many more positive cases. This retrospective three year study was done to find out the seroprevalence of dengue Igm antibody and to know the predominant serotype of dengue virus among the patients suspected to have dengue virus infection in a tertiary care hospital in southern Odisha, India.
Methods: Blood samples from clinically suspected dengue cases admitted in the Medicine and Paediatrics departments of a tertiary care hospital were collected. These were processed for detection of dengue specific IgM antibody, carried out by the ELISA method. Dengue IgM antibody positive serum samples were tested for serotypic identification.
Results: of the 5102 samples tested, 1074 (21.05 %) were positive for dengue IgM. Maximum numbers of cases were found in 2012. Majority (47.86 %) of cases were detected in the month of September. The most common affected age group was 11 to 20 yr. DENV1 and DENV2 were the detected serotypes.
Interpretation & conclusions: Rapid increase in the dengue cases in 2012 became a public health concern as majority of cases were affecting the young adolescents. Most of the cases were reported in post-monsoon period indicating a need for acceleration of vector control programmes prior to arrival of monsoon.
Key words Dengue virus - IgM antibody - seroprevalence - serotype - vector control
This document summarizes a study on multidrug resistant organisms and their antibiotic resistance patterns among intensive care unit patients in Surat City, India. The study found that Pseudomonas aeruginosa and Klebsiella species were the most common causes of healthcare-associated infections. It also found high resistance of these organisms to cephalosporins but that amikacin and imipenem were the most effective antibiotics. Regular monitoring of resistance patterns was deemed important for guiding empirical treatment of infections in ICU patients.
This document summarizes the results of sequencing and analyzing genomes of Mycobacterium tuberculosis isolates from 5 patients with extra-pulmonary tuberculosis. Key findings include:
1. The isolates showed genetic heterogeneity, with variations in single nucleotide polymorphisms and presence/absence of genes compared to the reference genome.
2. One isolate (LN8) showed the highest number of unique single nucleotide variations and gene deletions, indicating it had diverged more than the others.
3. Several genes missing or disrupted in the isolates are involved in important processes like cell wall biosynthesis and membrane transport, which may influence pathogenesis.
4. The variations identified suggest next-generation sequencing can effectively detect small genomic changes in M
The genomes of four tapeworm species reveal adaptations to parasitismJoão Soares
The genomes of four tapeworm species reveal adaptations to parasitism. The genomes range from 115 to 141 megabases and show maintenance of synteny with blood flukes but extreme losses of genes and pathways found in other animals, including 34 homeobox families and stem cell fate determinants. Tapeworms have specialized detoxification pathways, metabolism finely tuned to rely on host nutrients, and expansions of heat shock proteins and known antigen families. The genomes provide insights into tapeworm evolution and identify potential new drug targets, furthering development of urgently needed treatments.
Clinical Profile of Envenomation in Children With Reference To Snake Biteiosrjce
IOSR Journal of Dental and Medical Sciences is one of the speciality Journal in Dental Science and Medical Science published by International Organization of Scientific Research (IOSR). The Journal publishes papers of the highest scientific merit and widest possible scope work in all areas related to medical and dental science. The Journal welcome review articles, leading medical and clinical research articles, technical notes, case reports and others.
Prevalence of Rota Virus Detection by Reverse TranscriptasePolymerase Chain R...IOSRJPBS
The present study was conducted for the period from 1/6/2016 to 20/1/2017 in Baquba city. The study aimed to detection of rotavirus in stool specimens of children fewer than five age and also explore the effects of certain demographic factors on the detection rates by revers transcriptase- polymerase chain reaction. The study included 49 patients with acute diarrhea, 32 were male and 17 were female. The age range was two months to 5 years. Demographic information on the patients regarding age, sex, residence, type of feeding and source of drinking water were collected from their parents. Stool specimens were collected from each patients and. Detection of rotavirus in stool specimens was done by conventional reverse transcriptase polymerase chain reaction (RT-PCR). The results of present study showed that the overall infection rate by rotavirus among patients with acute diarrhea by RT-PCR tests was 93.88%. The highest infection rate was recorded among those >10-≤15 months of age. None of the results showed significantly difference between female and male, PCR (88% vs 96.87%). Likewise, there was insignificantly difference between urban and rural residence, PCR (95.65% vs 92.30%). The results revealed insignificantly higher infection rate among patients (those below 2 years) feed mixing (91.66%) and bottled (100%) compared to that breast feeding (77.77%) by RT-PCR. The rotavirus infection rate was insignificantly higher among patients consuming municipal water for drinking (97.22%) compared to those consuming bottled water (84.61%) by the RT-PCR. The study concluded that rotavirus was detected in high rates among children less than 5 years old with acute diarrhea in Baquba city, particularly those less than 2 year old.
Two main animal pathogenic subspecies of Mycobacterium avium are M. avium avium (Maa) and M. avium paratuberculosis (Map). Their pathogenicity is host-specifi c, Maa causing avian tuberculosis in poultry whereas Map commonly cross-infects to ruminant.Veterinary diagnosis of M. avium infections is microscopic examination of acid-fast bacilli or culture in Löwenstein-Jensen medium,which are time-consuming and low sensitivity. This present study aimed to apply real-time PCR coupled with High-Resolution Melting (HRM) analysis for differential detection of Maa in Thai domestic ducks. Specifi c primer targeting host-expression dependent (hed) region
was designed, PCR product of Maa were amplifi ed from duck’s tissue lesions whereas Map were amplifi ed from cow and deer. HRM real-time PCR was performed and analyzed. Different HRM patterns were showed and melting temperature were analyzed at 83.26 ± 0.12°C for Maa and 84.04 ± 0.09°C for Map. This technique can detect as few as 102 DNA copies and present high specifi city by negative amplifi cation of other pathogenic bacterial species. This technique is sensitive, specifi c, rapid and does not require fl uorescent probes or post-PCR electrophoresis. Our technique is a possible new tool for the detection of Maa and Map infection in tissue specimens.
The transformational role of polymerase chain reaction (pcr) in environmental...Alexander Decker
This document discusses the transformational role of polymerase chain reaction (PCR) in environmental health research. PCR allows for exponential amplification of target DNA sequences, which has enabled rapid and sensitive detection of pathogens in environmental samples as an alternative to traditional culture methods. While PCR is widely used in developed countries, its benefits have yet to be fully realized in developing countries like Nigeria. The document provides background on DNA replication and the basics of how PCR works to exponentially amplify DNA. It argues that PCR could greatly aid environmental health monitoring and disease diagnosis in Nigeria.
Methods For Improving The Cellular Uptake Of Dna Origami...Christina Santos
The presentation will focus on how the novel "Fifteen Dogs" has been taken up and promoted via Twitter. It will use Anne Freadman's concept of "uptake" to analyze how different Twitter users discuss and spread information about the novel on the platform, effectively promoting the work. The presentation will examine how Twitter serves as a means for novels to be "taken up" and transformed into promotional devices.
This document discusses various diagnostic techniques for leptospirosis, a zoonotic bacterial infection acquired through contact with contaminated soil or water. It focuses on dark field microscopy, culture, ELISA, agglutination tests, and Faine's criteria. Dark field microscopy can detect leptospires in body fluids but has low sensitivity and specificity. Culture is the gold standard for confirmation but leptospires grow slowly over weeks. Serological tests like ELISA and agglutination tests detect antibodies but cannot confirm acute infection. Faine's criteria provides a scoring system for clinical diagnosis when laboratory tests are inconclusive.
This document describes a study to identify pathogens in Hyalomma ticks collected from cattle in various regions of Khyber Pakhtunkhwa, Pakistan. 70 engorged female ticks will be collected and identified to species. Genomic DNA will be extracted from the ticks and tested using PCR and sequencing to detect Theileria, Babesia, Borrelia burgdorferi, Rickettsia, and Coxiella burnetii pathogens. Sequence results will be compared to the GenBank database to identify the pathogens present. This will help determine the occurrence of tick-borne pathogens affecting cattle in Khyber Pakhtunkhwa.
This document summarizes a study on the isolation and molecular characterization of human adenovirus. The study found that out of 83 samples collected from eye secretions, 69 (83.13%) tested positive for human adenovirus using rapid tests and PCR. The highest rate of infection was found in individuals aged 16-30 years old (55.04%) and males had a higher rate of infection than females. Human adenovirus was successfully isolated by inoculating samples on chicken embryo fibroblast cell cultures and embryonated eggs, where cytopathic effects were observed. Molecular characterization was also conducted to identify the adenovirus strains present.
Proteomics Analysis of Three Different Strains of Mycobacterium tuberculosis...Santhi Devasundaram
The study analyzed protein expression profiles of three Mycobacterium tuberculosis strains (H37Rv, S7, S10) under aerobic and hypoxic conditions using two-dimensional electrophoresis and mass spectrometry. 49 protein spots were found to be overexpressed or newly emergent under hypoxia. Two antigens (ESAT-6, Lpd) were selected and used to stimulate blood samples from healthy household contacts and active TB patients. Flow cytometry analysis showed higher levels of antigen specific memory T cells in household contacts, suggesting these antigens could be potential vaccine targets. In vitro hypoxia experiments with clinical strains help identify antigens involved in persistence.
Sensitivity and Specificity of an In-house Sandwich ELISA Kit for Newcastle D...Dr. Md. Ehsanul Haque
Of all serological tests enzyme-linked immunosorbent assay (ELISA) is still considered the gold standard for the detection of antigens and antibodies of either macro or micro-organisms worldwide. The ELISA kits for serum antibody detection against many viruses and other micro-organisms of both man and animals are available in the market. Whereas, antigen detection ELISA kits for Newcastle disease virus
(NDV) is not yet available in Bangladesh. The Present study was designed for the development of an economically feasible In-house Sandwich ELISA and to test its sensitivity and specificity for the detection of NDV antigens from clinically suspected field samples. 96-well flat bottom polystyrene plates coated with hyperimmune polyclonal serum against NDV raised in rabbits was used to capture NDV
antigens. The anti-rabbit IgG and DAB with 30% H2O2 were used as conjugate and substrate respectively for standardization of the test method. The plate coated with serum diluted 10-3 was found suitable for capturing maximum antigen of NDV by the In-house Sandwich ELISA. The cut-off value of the present ELISA test was calculated as 0.855 and was able to capture the viral antigen present in the 10-4 fold
dilution of allantoic fluid (AF) which is equivalent to 1HA unit, indicating the highest degree of sensitivity of the newly developed ELISA. In case of field samples, the newly developed ELISA kit was able to detect 100% viral antigens of NDV present in the feces, 95.50% of the brain tissue and oro-nasal swab and 94.12% of colon swab samples of either naturally and experimentally infected birds in this study. The
ND virus specific polyclonal antibody used in the kit bind only with ND virus without any cross reactive antigens of other viruses of chicken like Avian influenza virus (AIV) and Infectious bursal disease viruses (IBDV). Therefore, findings of the present study clearly indicates that the newly developed In-house Sandwich ELISA kit can be used for rapid confirmatory diagnosis of Newcastle disease (ND) with minimum cost, using any kind of field samples from either sick or dead birds.
This document describes a study on the seroprevalence of measles IgG antibody in children in Bannu district, Pakistan. The study analyzed 650 blood samples collected from different hospitals and health centers in the district. 123 samples were found to be positive for measles IgG antibodies. Results showed higher prevalence of antibodies in females compared to males, in rural residents compared to urban, and varying by age and month. The study concluded that measles remains common in unvaccinated children in the district and recommended vaccination for all children.
ABSTRACT- Enteric fever is a major public health problem in developing countries like India. An early and accurate diagnosis is necessary for a
prompt and effective treatment. We have evaluated the diagnostic accuracy of ENTEROSCREEN-WBTM as compared to Widal test in rapid and early
diagnosis of enteric fever. A total of 145 patients serum samples were tested by Rapid ENTEROSCREEN-WBTM and Widal test including clinically
suspected cases of enteric fever of all age groups. Vaccinated individuals, patients on antibiotic therapy, patients who have other associated conditions,
patients suffering from fever due to non-enteric etiology & non consent patients were excluded. The overall sensitivity, specificity, positive
predictive value (PPV) and negative predictive value (NPV) of ENTEROSCREEN-WBTM considering Widal test as gold standard were 50% and
96%, 66.66% and 92.30% respectively. ENTEROSCREEN-WBTM was found to be significantly more specific. Although the Rapid ENTEROSCREEN-
WBTM tests are meant to diagnose of S. typhi. Ten patients who were ENTEROSCREEN-WBTM positive for S. typhi were also positive by
Widal test.
Key words- Enteric fever, Rapid ENTEROSCREEN-WBTM, Non-enteric etiology, S. typhi, Widal test
Association of leucocytosis and hemozoin pigment in leucocytes with disease s...iosrjce
IOSR Journal of Dental and Medical Sciences is one of the speciality Journal in Dental Science and Medical Science published by International Organization of Scientific Research (IOSR). The Journal publishes papers of the highest scientific merit and widest possible scope work in all areas related to medical and dental science. The Journal welcome review articles, leading medical and clinical research articles, technical notes, case reports and others.
Antibiotic resistance is increasing in Gram Negative organisms. It is important to know the antibiogram of the hospital to start empirical therapy. It can serve as a reference to clinician looking for information on antibiotic resistance. A retrospective analysis of the isolates obtained from January 2016 to December 2016 was performed. Samples were processed as per CLSI guideline. A total of 718 isolates were obtained. These were analysed for the prevalence
of MDR/XDR/PDR. It was found that XDR isolates are prevalent in our teaching hospital. The study showed an emergence in pan drug resistant isolates. The knowledge of local antibiogram
along with strong antibiotic stewardship program can help in guiding antibiotic therapy.This reduces antibiotic pressure among organisms and hence development of resistance.
This document discusses the history and regulation of the drug thalidomide. It notes that thalidomide was discovered in the 1960s to cause birth defects but has continued to be studied to treat other conditions. In 1998, the FDA approved thalidomide under the brand name Thalomid to treat erythemanodosumleprosum, a complication of leprosy. Due to the risks of birth defects, the FDA took steps to strictly control the drug's use, distribution, and monitoring of patients, especially women of childbearing age, to prevent another public health issue. Research into thalidomide's use for other diseases continues.
El coronavirus, relacionado con el virus que causa el SARS (síndrome respiratorio agudo severo), ha desencadenado un renovado debate sobre si las variantes de laboratorio de ingeniería de virus con posible potencial pandémico valen los riesgos.
En un artículo publicado en Nature Medicine 1 el 9 de noviembre, los científicos investigaron un virus llamado SHC014, que se encuentra en murciélagos de herradura en China. Los investigadores crearon un virus quimérico, compuesto por una proteína de superficie de SHC014 y la columna vertebral de un virus del SARS que se había adaptado para crecer en ratones e imitar una enfermedad humana. La quimera infectó las células de las vías respiratorias humanas, lo que demuestra que la proteína de superficie de SHC014 tiene la estructura necesaria para unirse a un receptor clave en las células e infectarlas. También causó enfermedades en ratones, pero no los mató.
----------------------
Engineered bat virus stirs debate over risky research
Lab-made coronavirus related to SARS can infect human cells.
12 November 2015
An experiment that created a hybrid version of a bat coronavirus — one related to the virus that causes SARS (severe acute respiratory syndrome) — has triggered renewed debate over whether engineering lab variants of viruses with possible pandemic potential is worth the risks.
In an article published in Nature Medicine 1 on 9 November, scientists investigated a virus called SHC014, which is found in horseshoe bats in China. The researchers created a chimaeric virus, made up of a surface protein of SHC014 and the backbone of a SARS virus that had been adapted to grow in mice and to mimic human disease. The chimaera infected human airway cells — proving that the surface protein of SHC014 has the necessary structure to bind to a key receptor on the cells and to infect them. It also caused disease in mice, but did not kill them
This document summarizes a study on the seroprevalence of typhoid fever among patients presenting with acute febrile illness at a clinical laboratory in Addis Ababa, Ethiopia from 2007 to 2011. A total of 5,029 patients were tested for typhoid using the Widal test. The results showed that 22% tested positive for typhoid. Males represented a higher percentage of patients (57%) compared to females (43%). The highest number of cases occurred in adults aged 20-40 years. Seasonally, more cases were seen in the spring and autumn months, with peaks in May and October. The number of cases increased each year from 2007 to 2011.
Isolation, Characterization, and Antibiotics Resistance Profile of Staphyloco...AdeyemiKayode2
This document summarizes a student's presentation on a project isolating, characterizing, and analyzing antibiotic resistance of Staphylococci bacteria from indoor air samples collected from student halls of residence at Obafemi Awolowo University, Nigeria. A total of 26 Staphylococci isolates were recovered from the air samples. Biochemical testing showed that 46% were DNase positive and 54% were DNase negative. Antibiotic susceptibility testing found resistance rates of 0%, 15.4%, and 38.5% to Ciprofloxacin, Gentamicin, and Tetracycline respectively. The presentation concludes that air contamination poses a health risk and calls for improved hygiene and ventilation to reduce
Background & objectives: In Odisha, several cases of dengue virus infection were detected for the first time in 2010, the importance of dengue as a serious mosquito-borne viral infection was felt only in 2011 with the reporting of many more positive cases. This retrospective three year study was done to find out the seroprevalence of dengue Igm antibody and to know the predominant serotype of dengue virus among the patients suspected to have dengue virus infection in a tertiary care hospital in southern Odisha, India.
Methods: Blood samples from clinically suspected dengue cases admitted in the Medicine and Paediatrics departments of a tertiary care hospital were collected. These were processed for detection of dengue specific IgM antibody, carried out by the ELISA method. Dengue IgM antibody positive serum samples were tested for serotypic identification.
Results: of the 5102 samples tested, 1074 (21.05 %) were positive for dengue IgM. Maximum numbers of cases were found in 2012. Majority (47.86 %) of cases were detected in the month of September. The most common affected age group was 11 to 20 yr. DENV1 and DENV2 were the detected serotypes.
Interpretation & conclusions: Rapid increase in the dengue cases in 2012 became a public health concern as majority of cases were affecting the young adolescents. Most of the cases were reported in post-monsoon period indicating a need for acceleration of vector control programmes prior to arrival of monsoon.
Key words Dengue virus - IgM antibody - seroprevalence - serotype - vector control
This document summarizes a study on multidrug resistant organisms and their antibiotic resistance patterns among intensive care unit patients in Surat City, India. The study found that Pseudomonas aeruginosa and Klebsiella species were the most common causes of healthcare-associated infections. It also found high resistance of these organisms to cephalosporins but that amikacin and imipenem were the most effective antibiotics. Regular monitoring of resistance patterns was deemed important for guiding empirical treatment of infections in ICU patients.
This document summarizes the results of sequencing and analyzing genomes of Mycobacterium tuberculosis isolates from 5 patients with extra-pulmonary tuberculosis. Key findings include:
1. The isolates showed genetic heterogeneity, with variations in single nucleotide polymorphisms and presence/absence of genes compared to the reference genome.
2. One isolate (LN8) showed the highest number of unique single nucleotide variations and gene deletions, indicating it had diverged more than the others.
3. Several genes missing or disrupted in the isolates are involved in important processes like cell wall biosynthesis and membrane transport, which may influence pathogenesis.
4. The variations identified suggest next-generation sequencing can effectively detect small genomic changes in M
The genomes of four tapeworm species reveal adaptations to parasitismJoão Soares
The genomes of four tapeworm species reveal adaptations to parasitism. The genomes range from 115 to 141 megabases and show maintenance of synteny with blood flukes but extreme losses of genes and pathways found in other animals, including 34 homeobox families and stem cell fate determinants. Tapeworms have specialized detoxification pathways, metabolism finely tuned to rely on host nutrients, and expansions of heat shock proteins and known antigen families. The genomes provide insights into tapeworm evolution and identify potential new drug targets, furthering development of urgently needed treatments.
Clinical Profile of Envenomation in Children With Reference To Snake Biteiosrjce
IOSR Journal of Dental and Medical Sciences is one of the speciality Journal in Dental Science and Medical Science published by International Organization of Scientific Research (IOSR). The Journal publishes papers of the highest scientific merit and widest possible scope work in all areas related to medical and dental science. The Journal welcome review articles, leading medical and clinical research articles, technical notes, case reports and others.
Prevalence of Rota Virus Detection by Reverse TranscriptasePolymerase Chain R...IOSRJPBS
The present study was conducted for the period from 1/6/2016 to 20/1/2017 in Baquba city. The study aimed to detection of rotavirus in stool specimens of children fewer than five age and also explore the effects of certain demographic factors on the detection rates by revers transcriptase- polymerase chain reaction. The study included 49 patients with acute diarrhea, 32 were male and 17 were female. The age range was two months to 5 years. Demographic information on the patients regarding age, sex, residence, type of feeding and source of drinking water were collected from their parents. Stool specimens were collected from each patients and. Detection of rotavirus in stool specimens was done by conventional reverse transcriptase polymerase chain reaction (RT-PCR). The results of present study showed that the overall infection rate by rotavirus among patients with acute diarrhea by RT-PCR tests was 93.88%. The highest infection rate was recorded among those >10-≤15 months of age. None of the results showed significantly difference between female and male, PCR (88% vs 96.87%). Likewise, there was insignificantly difference between urban and rural residence, PCR (95.65% vs 92.30%). The results revealed insignificantly higher infection rate among patients (those below 2 years) feed mixing (91.66%) and bottled (100%) compared to that breast feeding (77.77%) by RT-PCR. The rotavirus infection rate was insignificantly higher among patients consuming municipal water for drinking (97.22%) compared to those consuming bottled water (84.61%) by the RT-PCR. The study concluded that rotavirus was detected in high rates among children less than 5 years old with acute diarrhea in Baquba city, particularly those less than 2 year old.
Two main animal pathogenic subspecies of Mycobacterium avium are M. avium avium (Maa) and M. avium paratuberculosis (Map). Their pathogenicity is host-specifi c, Maa causing avian tuberculosis in poultry whereas Map commonly cross-infects to ruminant.Veterinary diagnosis of M. avium infections is microscopic examination of acid-fast bacilli or culture in Löwenstein-Jensen medium,which are time-consuming and low sensitivity. This present study aimed to apply real-time PCR coupled with High-Resolution Melting (HRM) analysis for differential detection of Maa in Thai domestic ducks. Specifi c primer targeting host-expression dependent (hed) region
was designed, PCR product of Maa were amplifi ed from duck’s tissue lesions whereas Map were amplifi ed from cow and deer. HRM real-time PCR was performed and analyzed. Different HRM patterns were showed and melting temperature were analyzed at 83.26 ± 0.12°C for Maa and 84.04 ± 0.09°C for Map. This technique can detect as few as 102 DNA copies and present high specifi city by negative amplifi cation of other pathogenic bacterial species. This technique is sensitive, specifi c, rapid and does not require fl uorescent probes or post-PCR electrophoresis. Our technique is a possible new tool for the detection of Maa and Map infection in tissue specimens.
The transformational role of polymerase chain reaction (pcr) in environmental...Alexander Decker
This document discusses the transformational role of polymerase chain reaction (PCR) in environmental health research. PCR allows for exponential amplification of target DNA sequences, which has enabled rapid and sensitive detection of pathogens in environmental samples as an alternative to traditional culture methods. While PCR is widely used in developed countries, its benefits have yet to be fully realized in developing countries like Nigeria. The document provides background on DNA replication and the basics of how PCR works to exponentially amplify DNA. It argues that PCR could greatly aid environmental health monitoring and disease diagnosis in Nigeria.
Methods For Improving The Cellular Uptake Of Dna Origami...Christina Santos
The presentation will focus on how the novel "Fifteen Dogs" has been taken up and promoted via Twitter. It will use Anne Freadman's concept of "uptake" to analyze how different Twitter users discuss and spread information about the novel on the platform, effectively promoting the work. The presentation will examine how Twitter serves as a means for novels to be "taken up" and transformed into promotional devices.
This document discusses immunofluorescent labeling techniques and how they can be used to detect rabies infections. It describes how immunofluorescence allows specific proteins to be detected by making antibodies tagged with fluorescent dyes. There are three main methods: direct, indirect, and inhibition immunofluorescence. The techniques are used with epifluorescent microscopes and have applications in diagnostic medicine, including detecting pathogens like Pneumocystis and Cryptosporidium in HIV patients. Immunofluorescence of skin biopsies and nervous tissue is a reliable way to diagnose rabies in humans and animals.
Knowledgeon Snake Bitediagnosis &Management among Internees in a Government M...iosrjce
IOSR Journal of Dental and Medical Sciences is one of the speciality Journal in Dental Science and Medical Science published by International Organization of Scientific Research (IOSR). The Journal publishes papers of the highest scientific merit and widest possible scope work in all areas related to medical and dental science. The Journal welcome review articles, leading medical and clinical research articles, technical notes, case reports and others.
This document describes the development of a fluorescence-based assay called "ProteAl" to detect the volatile biomarker 2-methylbutanal produced by Proteus bacteria. Gas chromatography-mass spectrometry and Fourier transform infrared spectroscopy were used to identify 2-methylbutanal in the headspace of Proteus cultures. A fluorescent dye, 5-dimethylaminonaphthalene-1-sulfonylhydrazine, was found to react specifically with 2-methylbutanal, producing a distinct green fluorescence. Testing of 95 bacterial strains showed the ProteAl assay can identify Proteus with 100% specificity and sensitivity, providing a simple method for rapid surveillance of this pathogen.
This document summarizes two scientific articles. The first article describes a new method called PIP-seq that establishes a complete footprint of RNA-protein interactions by comparing protein-bound RNA segments protected from degradation to a control sample. The second article describes a novel approach using the single-celled fungus saccharomyces cerevisiae to understand how individual genetic variants affect gene expression over a two-and-a-half year study period. The observation notes that choosing a simple organism provides insights into RNA expression, genetic variations, and protein regulation applicable to human genetics, with implications for precision medicine through understanding disease vulnerability and tailoring treatments.
Immunofluorescence techniques can detect rabies and other infections by using fluorescent dyes and antibodies to label antigens in cells and tissues. There are three main methods: direct immunofluorescence directly labels the primary antibody; indirect immunofluorescence labels the secondary antibody; and inhibition immunofluorescence confirms antibody specificity. Immunofluorescence is commonly used with epifluorescent microscopes in clinical settings to diagnose infections like PCP and rabies through skin biopsies and nervous tissue samples, sometimes detecting rabies days before symptoms. It allows visualization of proteins, structures, and molecular dynamics in live and fixed cells.
A novel coronavirus from patients with pneumonia in china, 2019MANUELPERALTA33
- In December 2019, a cluster of pneumonia cases of unknown cause emerged in Wuhan, China and was linked to a seafood market.
- Researchers isolated a novel coronavirus (2019-nCoV) from bronchoalveolar lavage fluid of patients with pneumonia.
- The virus was able to infect and replicate in human airway epithelial cells in vitro, causing cytopathic effects. Electron microscopy images showed spherical virus particles around 60-140nm in diameter with distinctive spikes.
This document summarizes a seminar presentation on astrovirus. Astrovirus are non-enveloped, single-stranded RNA viruses that cause mild gastroenteritis. They have a star-shaped capsid and infect both mammals and birds. Astrovirus infection is diagnosed using RT-PCR or ELISA techniques. Symptoms include diarrhea, nausea, and abdominal pain. Prevention involves proper handwashing, food safety, and sanitation. The presentation covered the epidemiology, structure, replication cycle, pathogenesis, diagnosis, and prevention of astrovirus.
This study examined 186 treated leprosy patients in the Diamer district of Gilgit-Baltistan, Pakistan to document their clinical status and disabilities. The majority of patients were male (75.8%) with a mean age of 53 years. Borderline tuberculoid leprosy was the most common subtype (43.54%). Many patients still had disabilities after treatment, including claw hand (11.82%), foot drop (10.21%), and visual impairment (11.29-6.9%). The results suggest leprosy remains prevalent in the area and a significant number of treated patients still have disabling effects of the disease. Addressing disabilities through an integrated healthcare approach is recommended.
Neuropsychiatric manifestations of Rabies
This document is a progress report submitted by Shruti Choudhary for her B. Pharm degree. It summarizes rabies, including that it is caused by a virus from the Rhabdoviridae family, signs and symptoms like hydrophobia and aerophobia, and the mechanism of infection including viral entry and spread in the body and formation of Negri bodies. It also discusses the diagnosis, management, and prevention of rabies.
DIAGNOSTICS - Diagnosis of TB - A Nanodiagnostic Approach.pdfsudeepbhattacharyya
The document discusses diagnosis of tuberculosis and highlights opportunities for nanotechnology-based diagnostic approaches. It summarizes several existing methods for TB diagnosis including microscopy, culture-based techniques, immunological methods, and molecular tests. However, current diagnostics have limitations such as low sensitivity, long turnaround time, and requirements for specialized equipment and facilities. The document proposes that nanodiagnostics utilizing nanoparticles, antigens, and antibodies may enable the development of improved point-of-care tests for more rapid, affordable and accurate TB detection.
This study aims to discover potential white blood cell surface biomarkers that could predict which patients presenting to the emergency department with suspected sepsis will develop severe sepsis. The study will prospectively collect data from three patient populations - 300 patients with suspected sepsis in the emergency department, 100 critically ill patients with established sepsis in the ICU, and 100 non-septic control patients in the emergency department. White blood cell surface markers will be analyzed using flow cytometry. Candidate biomarkers will be selected by comparing markers between cohorts, and their predictive value for clinical outcomes will be explored within the suspected sepsis emergency department cohort. The goal is to identify biomarkers that could help predict deterioration early to guide triage, treatment and monitoring.
The resistance of parasites to existing drugs and the availability of better technology platforms has driven the discovery of new drugs. Microfluidic devices have been used to facilitate faster screening of compounds, controlled sampling/sorting of whole animals, and automated behavioral pattern recognition. In most cases, drug effects on small creatures (e.g., Caenorhabditis elegans) are measuredelegant by a single parameter such as worm velocity or stroke frequency. We present a multi-parameter extraction method to characterize modes of paralysis in C. elegans over a longer duration. This was done using a microfluidic device featuring real-time imaging, exposing worms to four anthelmintic drugs at EC75, where 75% of the worm population is affected. We monitored the worms' behavior with metrics such as curls per second, types of paralyzation, mode frequency, and number/duration of active/immobilization periods. Differences were observed in how the worms paralyzed in the various drug environments at equivalent concentrations. This study highlights the importance of assessing drug effects on small animals with multiple parameters, measured at regular intervals over a prolonged period, to accurately detect resistance and adaptability in chemical environments.
Roy Lycke, Archana Parashar, and Santosh Pandey, "Microfluidics-enabled method to identify modes of Caenorhabditis elegans paralysis in four anthelmintics", Biomicrofluidics 7, 064103 (2013).
https://doi.org/10.1063/1.4829777
https://aip.scitation.org/doi/10.1063/1.4829777
The influenza A virus causes annual epidemics that infect millions worldwide and remains a serious public health threat. While vaccines exist, the virus's ability to evolve new strains means immunity relies on pattern recognition receptors in the innate immune system. Recent research examined the role of viral pathogen-associated molecular patterns versus cellular damage in linking innate recognition of influenza A virus to adaptive immunity.
This document summarizes the history and development of chemical insecticides used for vector control. It describes how DDT, discovered in 1939, revolutionized vector control in the 1940s-1950s by effectively controlling diseases like malaria, typhus, and yellow fever. However, concerns about DDT's toxicity and persistence in the environment led to its ban in many countries starting in the 1970s. Newer classes of insecticides like organophosphates, carbamates, and synthetic pyrethroids were developed with better safety profiles. Today's insect growth regulators have extremely low toxicity and promise for treatment of civilian and military facilities.
The document discusses the nematode C. elegans as a model organism for studying Alzheimer's disease. Some key points:
- C. elegans is a useful model organism for neurodegenerative diseases like Alzheimer's and Parkinson's due to its short lifespan, transparency, and genetic similarities to humans.
- Sydney Brenner first introduced C. elegans as a model organism in 1963 due to these advantages.
- About 38% of the C. elegans genome is genetically similar to humans, allowing researchers to study genetic pathways involved in neurodegeneration.
This document discusses various animal models used for research including invertebrate models like Drosophila and C. elegans, rodent models, rabbit models, and large animal models. These models are used to study processes like genetics, development, and disease due to their similarities to humans. Drosophila and C. elegans have been important for discoveries in development and genetics. Rodent models are widely used due to their similarities to humans and short lifespans. Larger animal models are needed for pre-clinical research due to closer mimicry of human physiology. A variety of animal models at different sizes are essential for advancing biomedical research.
Neuropsychiatric manifestations of Rabies
The document is a progress report submitted for a B. Pharm degree. It summarizes rabies, caused by the Lyssavirus, as a zoonotic disease transmitted to humans. It discusses the virus entry and spread in the body through motor and sensory axons. It describes the formation of Negri bodies in infected neurons. It also explains the mechanisms of aerophobia and hydrophobia symptoms, such as involuntary spasms caused by air or water. The diagnosis and management of rabies are also briefly covered.
ABSTRACT- Introduction: Leprosy one of the oldest and chronic infectious disease caused by Mycobacterium
leprae. Leprosy is widely prevalent in India. Most of the cases present as hypopigmented patches or erythematous
lesions over skin. However on histopathology these lesions show a wide spectrum of changes and variations.
Material And Methods: A retrospective study of diagnosed cases of leprosy on skin biopsy in Department of
Pathology, S Nijalingappa Medical College from January 2015 to January 2016. Total of 63 cases were re-evaluated
and classified according to Ridley-Jopling classification.
Results: Lesions were most oftenly seen in middle aged patients and most common symptom was hypopigmented patch
(68.2%). Based on Ridley-Jopling classification, most cases were lepromatous leprosy (23.8%) followed by borderline
lepromatous type (22.2%), indeterminate type (22.2%), tuberculoid leprosy (6.3%), borderline tuberculoid leprosy
(17.4%) and borderline borderline leprosy (7.9%). Wade-Fite staining was done in 42 cases out of which 17 cases
showed positive for acid-fast bacilli. Also noted that the bacilli load was >2+ in lepromatous spectrum.
Conclusion: Histopathology remains the important tool to diagnose the subtype of leprosy lesions. Lepromatous
leprosy is most often associated with high bacterial load.
Key-words- Histomorphological Spectrum, Lepromatous spectrum, Mycobacterium leprae, Leprosy
Study of Histomorphological Spectrum of Lesions in Leprosy- One Year Study in...
Detection of rlep final version
1. Tiffany Eisenbach
St. Olaf College, 2/17/15
Biology in South India Program
By
PCR detection of rlep
gene target of
Mycobacterium leprae
from clinical isolates of
leprosy patients and
contacts in a leprosy
endemic area of India
2. 1
TABLE OF CONTENTS
Abstract.........................................................................................................................................................................3
Introduction .................................................................................................................................................................3
Classifications of leprosy .........................................................................................................................................5
Social issues associated with leprosy .....................................................................................................................6
Other major difficulties with the leprosy disease..................................................................................................6
Forms of bacterial detection ...................................................................................................................................8
Purpose ......................................................................................................................................................................8
Materials and Methodology.........................................................................................................................................9
Sample collection ......................................................................................................................................................9
Blood Sample processing ........................................................................................................................................10
DNA Extraction.......................................................................................................................................................10
From blood sample ..............................................................................................................................................10
From slit skin smear sample ................................................................................................................................10
PCR (Polymerase Chain Reaction)..........................................................................................................................10
Gel Electrophoresis..................................................................................................................................................11
Results.........................................................................................................................................................................11
Discussion...................................................................................................................................................................14
Acknowledgements .....................................................................................................................................................16
Literature Cited..........................................................................................................................................................17
Appendix I: Consent form ...........................................................................................................................................20
Appendix II: Gel pictures ............................................................................................................................................23
Appendix III: Detailed laboratory protocol and materials list for rlep PCR amplification of M. Leprae DNA
extracted from blood and slit skin samples .............................................................................................................25
Materials .................................................................................................................................................................25
Sample collection ...............................................................................................................................................25
Blood Sample processing...................................................................................................................................25
3. 2
DNA extraction...................................................................................................................................................25
PCR (Polymerase Chain Reaction)....................................................................................................................25
Gel electrophoresis ............................................................................................................................................26
Methods ...................................................................................................................................................................26
Sample collection ...............................................................................................................................................26
Blood Sample processing...................................................................................................................................26
DNA Extraction...................................................................................................................................................27
PCR (Polymerase Chain Reaction)....................................................................................................................28
Gel Electrophoresis............................................................................................................................................29
Personal Reaction to Project........................................................................................................................................30
4. 3
ABSTRACT
Early detection of leprosy is critical for timely treatments before significant nerve damage
occurs. My goal was to discover whether blood or slit skin smear samples provided the
most reliable diagnostic measure using rlep PCR-based detection. I collected blood samples
from newly diagnosed and untreated leprosy patients, familial contacts, and controls, and
slit skin scrapings from patients and contacts. All 41 samples were collected from cases and
contacts who attended the Schieffelin Institute of Health Research and Leprosy Center at
Karigiri or the Field Clinic in Gudiyatham. Blood cells and serum were separated, and DNA
was extracted from both blood and slit skin smear samples. The rlep gene target was
amplified from the extracted DNA using PCR, and the amplicons were analyzed by gel
electrophoresis with Orange G dye. A UV trans-illuminator was used to visualize the rlep
gene and confirm its presence. More positive results were observed for rlep PCR of slit skin
samples than blood samples from leprosy patients, but sample type did not seem to have
an effect on percent of positive results from rlep PCR for leprosy patient contacts. Although
slit skin smears for PCR are a reliable diagnostic measure, blood samples appear to have a
similar efficacy, especially for patient contacts.
INTRODUCTION
Leprosy has plagued people for millennia, with the Bible recording the disease being
prevalent in the Middle East from the 16th-6th century BCE and the Vedas (composed
during 1500-1000 BCE) recording it in India (Lavania et al. 2012). In fact, leprosy is one of
the oldest diseases known to affect humans (Turankar et al. 2013). As of April 1, 2010,
India had a leprosy prevalence of 6.9/100,000 (Lavania et al. 2012). The World Health
Organization introduced a Multi-Drug Therapy regimen in 1996 that significantly reduced
the number of people with prolonged leprosy infections (Vedithi et al. 2014). Although the
current prevalence rate may seem small, considering that India’s population is over 1
billion, more than 69,000 people in India are still infected. In 2011, more than 100,000 of
the 228,474 leprosy cases reported globally were from India (Vedithi et al. 2014). As of
March 2010, only 510 districts out of 633 in India have achieved leprosy elimination (NLEP
2010), and 11 districts in Chhattisgarh, Gujarat, Maharashtra, West Bengal, Dadra & Nagar
Haveli, Orissa, and Delhi still have an incidence rate of greater than 50 per 100,000 people
(NLEP 2012).
The causative agent of leprosy is the bacterium Mycobacterium leprae. The habitat of choice
for these bacteria is the Schwann cells of peripheral nerves and macrophages of mucous
membranes, because they bind to them and have an elaborate entry mechanism. The
bacteria prefer cooler areas of the body like ears, fingers, and toes (Vedithi et al. 2014).
5. 4
When M. leprae enters the body, it goes into the circulatory system and enters these nerve
cells by crossing the endothelium, basement membranes/neural sheath, and then being
endocytosed by Schwann cells. The first nerve usually attacked is the ulna nerve. A
thickening of the nerve may result, leading to a nerve abscess, although this is infrequent
for the first manifestation of leprosy (Rai et al. 2013). Most often, patches form on the
patient’s body on the forearm or in other cool areas where the bacteria reproduce most
successfully (Cherath and Frey 2006). In fact, the most indicative characteristics used to
diagnose leprosy are hypo-pigmented patches or skin lesions, loss of sensation in this
patch, and a thickening of the sensory nerve serving this area.
Although the mechanism of infection of Mycobacterium leprae is still under investigation, it
is believed that the bacteria secrete a protein that keeps Schwann cells in a dedifferentiated
state, which causes them to lose their normal function leading to neurodegeneration, so
that the patient no longer has adequate nerve sensitivity to determine when too much
stress is placed on a body part (Costandi 2013). This leads to the development of ulcers,
called trophic ulcers, particularly in the hands and feet. Nerve impairment also can produce
disfiguring effects, such as clawing of the hands as the bacteria destroy the motor nerve at
the junction of the wrist and tendons. Other such deformities may also result, and may
become permanent without treatment or tendon transplant surgery. In leprosy’s systemic
form, as M. leprae multiplies, other organs may be infected, including the liver, kidneys,
gonads, bone, and cartilage. Another reason for deformities in leprosy patients is the
disintegration of cartilage, due to undetected extra stress placed on body parts because of
malfunctioning sensory nerves (Singh et al. 2000).
One of the current treatments for leprosy is Multi-Drug Therapy (MDT). MDT involves
Dapsone, a bacteriostatic drug which prevents bacteria from propagating by inhibiting the
biosynthetic pathway for folic acid, a nutrient bacteria require to survive. Dapsone blocks
the activity of an enzyme necessary for this pathway. MDT also includes Rifampicin, which
kills bacteria by inhibiting transcription, and Clofazimine, an anti-inflammatory drug that
controls human inflammations in addition to killing bacteria by enhancing the intracellular
killing ability of phagocytes (Wadee et al. 1988). For paucibacillary forms of the disease
(skin smears at all tested sites are negative for bacteria), a six-month drug regimen is
prescribed, which includes the first two medicines mentioned above. For multibacillary
forms of the disease (skin smears are positive for bacilli at any tested location), a 12-month
drug regimen is required, using all three drugs (WHOb 2014).
6. 5
CLASSIFICATIONS OF LEPROSY
It is possible for a person to be infected with M. leprae but never develop leprosy
symptoms, if they have an adequate immune response to the bacilli – in fact, an estimated
95% of people do have full immunity to the disease (Bennett et al. 2008). In those
individuals who do progress to active disease, the T lymphocytes don’t produce adequate
amounts of cytokines such as interferon-γ, interleukin-10, tumor necrosis factor-α, and
interleukin-1β that act as antibodies against M. leprae (Moubasher et al. 1998). In fact, the
various leprosy disease forms are dictated by the host’s immune response. The two main
forms are tuberculoid pole and lepromatous pole, the latter characterized by a very low
response of the body to the bacteria. The progression of the disease, from greatest immune
response to the bacteria to the smallest immune response, called the RJ classification, is as
follows: Tuberculoid tuberculoid (TT), borderline tuberculoid (BT), borderline borderline
(BB), borderline lepromatous (BL), and lepromatous lepromatous (LL). Indeterminate
leprosy is used to describe a situation in which an initial skin lesion is present, but may
heal on its own. The patient’s immune system response will determine how the disease
progresses if the preliminary lesion fails to heal (Willacy and Tidy 2014).
In order for leprosy to be classified as indeterminate, the dermis remains unchanged, but
subcutaneous tissue contains characteristic changes. With these early lesions, the deep
dermal nerve needs to be biopsied and examined under a microscope for the presence of
lymphocytes, indicating leprosy. In the TT leprosy stage, macrophages have destroyed
some bacilli and the bacilli themselves are not easily seen in microscopic examination of
smears, because the person’s immune response at this stage is effective enough to limit the
number of bacilli (their lymphocytes are producing an effective amount of antibodies). In
BT leprosy patients, fewer lymphocytes (the person’s immune response is not as large) but
more epithelial cells are present at the site of infection than in TT. The dermis is very thin,
and usually the nerve has been partially destroyed by inflammation. Bacilli are typically
more prevalent in this stage.
BB leprosy is characterized by even more prevalent bacilli and even more visible nerve
damage. In this stage, some macrophages harbor bacilli rather than destroying them. The
patient’s immunity is not functioning adequately, with their Cell Mediated Immune
Response (CMI) at only 50% efficiency (only 50% of lymphocytes are functioning
correctly). Thus, around 50% of macrophages remain idle with bacilli in them. This
category includes 10-15% of newly-diagnosed leprosy patients. BL leprosy patients have
more lymphocytes present at the site of infection than BB patients, and more macrophages
than LL patients. The lymphocytes outnumber the macrophages, as the macrophages are
not activated well enough to destroy bacilli (Modlin et al. 1988). The nerves of patients at
7. 6
this stage typically undergo an onion-peel like thickening due to perincurial cell
proliferation (Job 1989). In LL leprosy, there is mild atrophy of a patient’s epidermis, and
many bacilli reside in each ineffective macrophage. When macrophages fill with too many
bacilli, they rupture, releasing more bacilli into the patient’s system. LL is the most serious
form of the disease, and is highly infective. LL patients harbor bacteria in their nasal
chambers and spread them by sneezing. They typically contain bacteria in all of their body
fluids except sweat. Even one bacterium may cause disease, and the disease is very slow to
develop (WHOa 2015).
SOCIAL ISSUES ASSOCIATED WITH LEPROSY
Leprosy, if left untreated for too long, can prove to be both a physically and socially
debilitating disease. Due to the social stigma attached to leprosy, it may be difficult for
family members of leprosy patients to find a spouse or even be hired for a job, for fear that
they are infected as well, which is not an unreasonable concern given the latency of the
disease. It is all the more challenging for leprosy patients themselves to find work, even
when cleared of active bacilli. Unfortunately, many people try to keep far away from those
who have lasting effects of leprosy infection such as deformities, rather than giving them
the love and care that they need, and many post-leprosy patients are forced into begging
and living on the streets. It thus becomes vital that leprosy patients receive an early
diagnosis of their disease to prevent progression into more serious stages that can cause
lifelong physical debilitations and stigma for them and their families. Similarly, family
members deserve the assurance of sensitive testing methods to either catch infections
early or prove that they are not infected.
However, research is still being conducted to determine the most effective diagnostic
method for the early onset of leprosy. Leprosy is a chronic infectious disease with a latent
phase of 3-20 years. It remains silent in the nerves at first, before later multiplying and
causing damage. There is currently no approved early diagnostic test for leprosy before
symptoms (patch formation) begin. Unfortunately, once a patch appears, the disease has
already progressed to an advanced state.
OTHER MAJOR DIFFICULTIES WITH THE LEPROSY DISEASE
Several other characteristics make leprosy a particularly difficult disease to diagnose and
treat. Firstly, the bacterial causative agent, Mycobacterium leprae, cannot be cultured in
vitro, so it is challenging to study. It is a Gram-negative bacterium that is only stained by
acid-fast stains, because its cell wall contains lots of lipids and is consequently too thick for
8. 7
the dark distinctive Gram stains to penetrate. This makes microscopic examination of the
bacteria difficult.
Another perplexing characteristic of leprosy is the still uncertain mechanism of
transmission. Although leprosy is believed to be only mildly contagious, one hypothesis is
that M. leprae is inhaled, and subsequently enters the circulatory system and is carried
throughout the body (Rees and McDougall 1977). Leprosy patients may release bacteria
into the environment through dust particles or airborne droplets by coughing or sneezing
(Turankar et al. 2013). Another possible route includes direct contact with leprosy
patients, including living with them. This is corroborated because people living in
households with leprosy patients are much more likely to subsequently develop the
disease (Lavania et al. 2012). In fact, the risk of leprosy is estimated to be 9 times higher for
people living in households with a leprosy patient and 4 times higher for those living in an
adjacent household, compared to the risk for the general populace (Fine et al. 1997). This
may be because leprosy patients harbor M. leprae even on unbroken skin, according to a
study where 80% of leprosy patients had M. leprae DNA in skin washings (Job et al. 2008).
Mycobacterium leprae may also be contracted from the environment, with humid
conditions favoring the bacteria’s multiplication (Desikan and Sreevasta 1995). Armadillos
and monkeys, inanimate objects, soil, and water have been hypothesized as possible
sources of human infection by M. leprae (Truman et al. 2011), with the latter two having
been proven to harbor slowly-reproducing bacilli (Matsuoka et al. 1999).
Unfortunately, an effective vaccine for leprosy has not yet been developed. Mycobacterium
tuberculi and M. leprae are in the same genus and a vaccine called BCG has been developed
that prevents tuberculosis at a rate of 30%, but only protects from leprosy at a rate of less
than 15%. However, a vaccine development project undertaken by the Infectious Disease
Research Institute and the American Leprosy Missions is currently underway (Science
Development 2014).
Currently, several single nucleotide polymorphisms (SNP’s, which are point mutations in
DNA) encode for genes that provide drug resistance for those M. leprae that contain these
mutations. These include SNP’s in genes that encode for active drug targets like DNA gyrase
(for ofloxacin), RNA polymerase β subunit (for rifampin) and dihydropteroate synthases
(folp) (for Dapsone) (Vedithi et al. 2014). These point mutations change the amino acid
sequence for the proteins they encode for, thus altering structure. This structural variance
disrupts the drug interactions with M. leprae protein drug targets, leading to drug
resistance (Lopez-Roa et al. 2006).
9. 8
FORMS OF BACTERIAL DETECTION
One way to detect the presence of M. leprae in the body is through performing a
Bacteriology Index, which involves scraping off a small amount of skin from an area on the
ear or an infected skin patch and putting the scrapings onto a glass slide to make a smear.
Following acid-fast staining by the Ziehl-Neelsen method, intact M. leprae cells are counted
(WHOc 2015). However, this is not a fool-proof method because the bacilli are not always
visible. For indeterminate (usually earlier) cases of leprosy, the biopsies can be quite
painful for the patient, because tissue samples need to be taken at least 1 cm deep. The
patient has already developed actively progressed leprosy by the time the procedure is
performed, so the Bacteriology Index does not allow for early diagnosis.
PCR detection of M. leprae involves targeting a unique bacterial gene, amplifying it using
PCR, and identifying it by agarose gel electrophoresis. The benefit of PCR testing is that M.
leprae genes can be detected in the patient before leprosy symptoms present themselves.
Bacterial DNA can be detected through PCR even if the bacterial cells are dead, exist in very
small numbers, or are not actively reproducing, and thus detecting M. leprae in a person’s
body does not necessarily mean that they have (or will develop) leprosy, as their body
could already be working towards destroying the bacteria (Shin et al. 2014). Determining if
they have developed the disease would require mRNA detection, which can be modified to
detect specifically living cells.
PURPOSE
I amplified the rlep gene (a gene very highly expressed for M. leprae) from DNA extracted
from both blood and slit skin samples of patients and contacts, and blood samples from
controls. I used gel electrophoresis to show the presence of the gene, with an expected
molecular weight of 129 bp for rlep. My goal was to see whether slit skin smear or blood
samples provide a better DNA source for the PCR detection of M. leprae DNA in patients and
contacts. Recent research suggests that because M. leprae is present in the circulatory
system before it travels to the peripheral areas of the body, DNA taken from blood samples
may allow earlier detection of leprosy (Wen et al. 2013). Therefore, I hypothesized that
PCR amplification of M. leprae DNA will therefore be positive for blood samples when they
may not for slit skin samples. This information is also valuable for reasons of patient
comfort, as slit skin smears are more invasive (thus greater risk) and can be an
uncomfortable process for the patient and are generally much less preferable than drawing
blood.
10. 9
MATERIALS AND METHODOLOGY
SAMPLE COLLECTION
Blood and slit skin samples were taken from 10 leprosy patients and 4 of their familial
contacts, and blood samples were taken from 10 controls. Before samples were collected,
consent was attained using Karigiri Hospital’s standard procedure (Appendix I). Medical
professionals at Karigiri then collected the samples, putting slit skin smears into micro-
centrifuge tubes and blood into glass tubes.
Table 1. New leprosy cases reported at SIH-R& LC in 2014. Samples were obtained
from a broad spectrum of newly diagnosed untreated leprosy patients, with roughly half
male and female, an age range of 19-73, BI’s ranging from 0 to 5+, both MB and PB forms,
and RJ classification ranging from TT to LL. Some information was not able to be
obtained, and samples for only four patient contacts were obtained. All patient contacts
were immediate family members. – Indicates the data was not obtained.
ID No. Age Sex Contact
relation
RJ
Classification
Bacteriological
Index (BI)
PB/MB
1 60 Female Sister BT 0 MB
2 47 Female NA TT 0 PB
3 19 Male NA BT 0 -
4 38 Male Wife LL 5+ MB
5 35 Male Son BT/IND 0 MB
6 73 Male NA BL 0 MB
7 38 Female NA BT 4+ MB
8 33 Female Husband BT 0 MB
9 - - NA - 0+ -
10 37 Female NA LL 1.5 MB
11. 10
BLOOD SAMPLE PROCESSING
Blood cells were allowed to settle to the bottom of the tubes. The serum was collected and
stored at -80° C, for other future experiments, and blood cells stored at 4°C. Parafilm was
placed around the caps of blood and serum samples.
DNA EXTRACTION
FROM BLOOD SAMPLE
The spin-column protocol titled Purification of Total DNA from Animal Blood or Cells in the
DNeasy Blood and Tissue Handbook was utilized to extract DNA from blood, using the
DNeasy® Blood and Tissue Kit (DNeasy® 2006). The extracted DNA was stored at -20° C.
See Appendix III.
FROM SLIT SKIN SMEAR SAMPLE
The slit skin smear samples were stored in 70% ethanol at 4° C, until DNA was extracted
from them using the spin-column protocol titled Purification of Total DNA from Animal
Tissues in the DNeasy Blood and Tissue Handbook, using the DNeasy Blood and Tissue Kit
(DNeasy® 2006). The extracted DNA was stored at -20° C. See Appendix III.
PCR (POLYMERASE CHAIN REACTION)
The UV light was switched on 10 minutes before starting the PCR process to destroy DNA
in the work area. The cooler with the PCR reagents and the ice block were both taken out,
and all reagents except Taq polymerase taken out of the cooler. PCR tubes and a conical
micro-centrifuge tube were placed into the ice block, and all PCR reagents thawed except
Taq polymerase (it never freezes). Each reagent was mixed before being added, and
replaced into the cooler after being added. Nuclease free water was pipetted into the
micro-centrifuge tube. Then the buffer was added, and then the dNTP’s, MgCl2, and forward
and reverse primers for rlep. The forward primer (PS 1) had the sequence 5’ –
TGCATGTCATGGCCTTGAGG – 3’. The reverse primer (PS 2) had the sequence 5’ –
CACCGATACCAGCGGCAGAA – 3’. rlep was chosen because thus far, rlep PCR is the most
sensitive available method for detecting M. leprae, able to detect as little as 10 bacilli (Jamil
1994). The Taq polymerase was added, and the reaction mixture was mixed using a pipet.
The micro-centrifuge tube was tapped to get all the liquid off the sides, and at least 18 µl of
the reaction mixture was dispensed into each PCR tube.
Each DNA sample (2µl), including the positive control, was added to and mixed in its PCR
tube. All tubes were placed into the thermocycler. The cycling conditions were as follows:
12. 11
initial denaturation of 95° C for 10 minutes followed by one cycle of 94° C for 2 minutes,
58° C for 2 minutes (primer annealing), and 72° C for 2 minutes (extension). This was then
followed by 94° C for 30 seconds (initial denaturation), 60° C for 30 seconds (primer
annealing), and 72° C for 45 seconds (extension) with a total of 40 cycles. The reaction was
terminated by 72° C for 10 minutes, and the tubes were held at 4° C until they were
separated on the gel.
GEL ELECTROPHORESIS
Orange G dye (7 µl) was pipetted onto parafilm for each PCR amplicon and the DNA ladder,
and a 7 µl amount of each PCR amplicon and DNA ladder added onto the dye. A pipet set to
14 µl was used to mix the amplicon and dye, and each mixture then loaded into a well on
the gel plate, after the gel was poured and set (2% agarose). The gel was run at 100 V for
20-25 minutes. The bands were detected on a UV transilluminator and computer software
linked to the camera was used to take pictures of the gel. These images were analyzed for
presence of the rlep gene sequence in separate wells, and PCR percent positivity was
calculated for each sample and subject type.
RESULTS
The presence of rlep genes was found by amplification (PCR) yielding a band that ran at
129 bp (Fig. 1). No other bands were observed in the gels. It appears that DNA from slit
skin samples provided better PCR amplification for the rlep gene target than DNA from
blood samples for leprosy patients, but sample type did not make much of a difference in
PCR amplification for leprosy patient contacts (Table 3). As expected, PCR positivity for the
rlep gene target was more likely to occur in leprosy patients rather than their contacts.
Amplicons from blood samples had a greater incidence of faint positivity. All positive
amplicons from slit skin samples were strong bands, while 15% of positive amplicons from
blood samples had faint bands in the gel (Fig. 1). Both of the two faint positive amplicons
from blood samples were from patients. This supports that slit skin samples allow for
stronger positive amplification of the rlep gene target for patients, but not necessarily for
contacts.
Only blood samples were taken from controls because of the absence of skin lesions, and
the ethical issues associated with taking tissue samples from non-patients. The percent PCR
positivity of rlep for these control subjects’ blood samples (20%) was significantly less than
that of blood samples from leprosy patients and their contacts (Table 3). For sample
13. 12
collection, both patients and contacts were observed to be less wary and experience less
pain during blood sample rather than slit skin sample collection.
All patients’ slit skin samples amplified rlep, and all blood samples but patient 008’s had
amplification for the rlep gene (Table 2). Samples were taken from patient 001, 004, 005,
and 008’s contacts. Contacts of 004 and 005 had rlep in both blood and slit skin samples,
while the contact of 001 had PCR positivity in only the blood sample and 008 in only the slit
skin sample (Table 2). Patients 004 and 005 were male and 001 and 008 were female
(Table 1). Patients 001, 004, 005, and 008 all had MB leprosy cases, and patients 001, 005,
and 008 all had RJ classification of BT with a BI of 0, while patient 004 deviated with an RJ
classification of LL and a BT of 5+ (Table 1). Although patient 004’s contact did show rlep in
both blood and DNA samples, patient 005’s contact did as well.
Figure 1. Blood DNA rlep PCR results 001C, 005C, 004C, 003, 005, 006, 001, 004, 007, 002.
Lane 1 – negative control; lane 2 – blank; lane 3 – positive control; lane 4 – patient 001
contact; lane 5 – patient 005 contact; lane 6 – patient 004 contact; lane 7 – patient 003; lane
8 – patient 005; lane 9 – patient 006; lane 10 – patient 001; lane 11 – patient 004; lane 12 –
patient 007; lane 13 – patient 002; lane 14 – blank. NC was not contaminated, and
amplification was achieved for PC, and all of the patient and contact samples. The positive
bands for patients 001 and 007 were quite faint. See Appendix III for other gel pictures.
Table 2. rlep PCR results. 8 of 9 leprosy patients’ blood samples were positive for the
rlep gene target from M. leprae, whereas all had positive slit skin samples. Of the contacts
who were sampled, only 2 had positive rlep detection from both sample procedures and
2 were positive in only one (slit skin or blood). Of the 10 control subjects who were only
tested with blood samples, 2 were positive.
1 2 3 4 5 6 7 8 9 10 11 12 13 14
NC PC 001C 005C 004C 003 005 006 001 004 007 002
129 bp
14. 13
Sample Slit skin Blood
Patient 001 Positive Positive
Patient 001 contact Negative Positive
Patient 002 Positive Positive
Patient 002 contact NA NA
Patient 003 Positive Positive
Patient 003 contact NA NA
Patient 004 Positive Positive
Patient 004 contact Positive Positive
Patient 005 Positive Positive
Patient 005 contact Positive Positive
Patient 006 Positive Positive
Patient 006 contact NA NA
Patient 007 Positive Positive
Patient 007 contact NA NA
Patient 008 Positive Negative
Patient 008 contact Positive Negative
Patient 009 Positive Positive
Patient 009 contact NA NA
Patient 010 Positive NA
Control 1 NA Positive
Control 2 NA Negative
Control 3 NA Negative
Control 4 NA Negative
Control 5 NA Negative
Control 6 NA Positive
Control 7 NA Negative
Control 8 NA Negative
Control 9 NA Negative
Control 10 NA Negative
Table 3. Comparison of slit skin vs. blood for patients (n=10), contacts (n=4), and
controls (n=10). PCR positivity for the rlep gene target in leprosy patients was slightly
more likely in slit skin rather than blood samples. PCR positivity for the rlep gene target
in leprosy patient contacts was equally likely for both blood and slit skin samples.
Slit skin Blood
15. 14
Patients 100% 90%
Contacts 75% 75%
Controls NA 20%
DISCUSSION
Most of the samples gave the same rlep result regardless of tissue, blood or slit skin. Slit
skin samples appeared to have greater PCR positivity for M. leprae DNA than blood samples
for leprosy patients (100% vs. 90%), but not for their contacts (75% vs. 75%) (Table 3).
This may be because for leprosy patients, the M. leprae bacteria has been present long
enough in the patient’s circulation to reach the cooler, peripheral areas of their body, so it
is sequestered in Schwann cells and is present more on their skin rather than in their
blood. For leprosy contacts, however, the bacteria have not been in their bodies long
enough to cause disease or migrate to their cooler areas (skin), so greater PCR positivity in
slit skin samples is not expected. However, the sample size for the study is too small render
statistical significance tests useful, so judgments cannot be made regarding if this
difference in sample type PCR positivity is at all significant.
As expected, greater PCR positivity was found for leprosy patients with both clinical
isolates in comparison to leprosy contacts (Table 3). Although leprosy patient contacts
have more exposure to M. leprae than the general populace, they will not inevitably harbor
it. Contacts with PCR positivity for M. leprae will not necessarily develop leprosy, as long as
they maintain a successful immune response before significant amounts of M. leprae
sequester in Schwann cells. However, those contacts who tested positive need to be
followed up and reassessed regularly for signs of leprosy. That way, the disease can be
caught and treated at an earlier stage before its effects have become debilitating.
Interestingly, blood sample PCR positivity of a contact has been found especially to
increase the likelihood of their developing leprosy, and thus patient 001, 004, and 005’s
contacts in particular should have medical follow up (Table 2) (Martinez et al. 2014).
Differences in band strength were also noted for amplicons from blood versus slit skin
samples. Two incidences of faint bands occurred in gels for blood sample amplicons from
two different patients, while the bands present for slit skin sample amplicons were never
faint. This, along with greater PCR positivity percentages for M. leprae DNA for slit skin
rather than blood samples taken from leprosy patients, serves to corroborate evidence
from past studies indicating blood samples are not as reliable for amplification of M. leprae
DNA in leprosy patients (Martinez et al. 2014).
16. 15
Amplification of M. leprae DNA was seen in only 20% of controls, which is a considerably
lower percentage than that achieved for the PCR positivity of both leprosy patients and
their contacts (Table 3). This result is expected, because the control subjects do not have a
leprosy patient in their household, and thus experience much less exposure to M. leprae
than those living with someone with an active leprosy infection. Nevertheless, since the
controls were staff workers at a leprosy hospital, who have spent time treating leprosy
patients and processing their clinical isolates, some control subjects indicate that they have
been exposed to M. leprae. The rate of postive results is thus not surprising and higher than
expected for the general population. These control subjects should be closely monitored for
signs of leprosy disease, just like the contacts with PCR positivity. Future studies could
involve using non-endemic controls.
It is interesting to note that disease classification status did not appear to have an effect on
PCR positivity for M. leprae for leprosy patient samples. This may be because leprosy
patients, regardless of the progression of their disease (TT to LL) or the number of bacteria
detected from their lesions under the microscope (BI) will harbor bacilli nonetheless, so RJ
classification and BI number should not actually make a difference with regard to PCR
positivity. PCR is only an indicator for the presence, not the number, of bacteria. Also, not
enough data was obtained to consider disease classification statuses of patients influential
PCR positivity factors.
However, intriguingly, gender of the leprosy patient did appear to affect the PCR positivity
of their contact (see Tables 1 and 2), with contacts of male leprosy patients being more
likely to harbor the bacteria than contacts of female leprosy patients. Nevertheless, the
samples from the two contacts of the female patients still did achieve amplification, just in
only one clinical isolate rather than both like the contacts of the male patients, and only
four contact samples were obtained total, so at best only a hint that gender of the patient
may affect likelihood of their contact to harbor M. leprae can be noted. No data was
achieved about the lifestyles of any of the contacts and their possible interaction with other
sources of leprosy infection, so it would be interesting to follow up with a future study
involving more patient contacts and information about the contacts’ other sources of
leprosy exposure.
Because the study only involved 10 patients, 4 contacts, and 10 controls, and not all
epidemiological and disease classification information was obtained for the patients,
comprehensive conclusions cannot be drawn from this study. Time (only five weeks for the
experiment), availability of newly diagnosed untreated patients, and access to and consent
issues with patient contacts all proved to be limits to the experiment. For this reason, only
percent PCR positivity for rlep was reported for data analysis rather than other more
complete statistical analyses such as a Chi-Square Test that are more fitting for larger
17. 16
samples sizes. However, this study provides a basis for future experiments testing rlep PCR
sensitivity of various clinical isolates utilizing a larger sample size. Other types of patient
samples such as urine and nasal swabs should be tested for sensitivity and reliability
(Martinez et al. 2014). Also, larger blood samples could be taken in the future, to see if
increasing the amount of cells from which DNA is extracted has an effect on rlep PCR
positivity.
Regardless of these limitations, several interesting findings have been obtained that
prompt future research questions. It would be beneficial to repeat this study with a larger
sample size of leprosy contacts to see if a difference in PCR postivity of M. leprae between
slit skin and blood samples can be obtained, since this positivity was found to be the same
in this study. It also would be interesting to obtain a larger sample size of leprosy patients
and see whether PCR positivity in blood and slit skin samples varies according to RJ
classification. The idea behind this is that in earlier stages, the M. leprae has not reached the
cooler areas of the body yet, and so will be present more in the blood, while for later stages,
the M. leprae has achieved this migration, and will be present more on the skin. Similarly,
experiments could be performed to test to see if percent PCR positivity varies between
blood and slit skin samples according to BI as well, since it would be expected that patients
with a larger BI will have a larger PCR positivity for slit skin rather than blood samples due
to the larger amount of bacteria that has been detected on their skin.
ACKNOWLEDGEMENTS
I would like to thank Dr. Sundeep Chaitanya Vedithi and Ms. Madhusmita Das of Karigiri
Hospital for serving as my advisors throughout this project, and teaching me all of the
necessary skills. I also would like to thank Professors Anne Walter and Mike Swift of St. Olaf
College for their assistance in editing this paper. I thank the Director of Karigiri Hospital,
Dr. Mannam Ebenezer, for welcoming us and permitting the procurement of necessary
supplies. I also thank the doctors at Karigiri Hospital for taking samples for use in this
project, and I thank the participants who provided samples for this study.
18. 17
LITERATURE CITED
Bennett, B. H., D. L. Parker and M. Robson. 2008. Leprosy: Steps Along the Journey of Eradication. Public Health
Reports 123(2):198-205.
Cherath, L. and R. Frey, eds. 2006. Gale Encyclopedia of Medicine, 3rd ed. Thomson Gale, 2006.
Costandi, Mo. "Leprosy spreads by reprogramming nerve cells into migratory stem cells." The Guardian, January
17, 2013.
Desikan, K. and Sreevasta. 1995. Extended studies on the viability of Mycobacterium leprae outside the human
body. Leprosy Review 66(4):287-295.
DNeasy® Blood and Tissue Handbook. 2006.
http://mvz.berkeley.edu/egl/inserts/DNeasy_Blood_&_Tissue_Handbook.pdf.
Fine, P.E., J.A. Sterne, J.M. Ponnighaus, L. Bliss, J. Saui, A. Chihana, M. Munthali and D.K. Warndorff. 1997.
Household and dwelling contact as risk factors for leprosy in northern Malawi. American Journal of
Epidemiology 146(1):91-102.
Jamil, S., S.M. Wilson, M. Hacket, R. Hussain and N.G. Stoker. 1994. A colorimetric PCR method for the detection
of M. leprae in skin biopsies from leprosy patients. International Journal of Leprosy and other
Mycobacterial Diseases 62(4):512-20.
Job, C.K. 1989. Nerve damage in leprosy. International Journal of Leprosy and Mycobacterial Diseases 57(2):532-9.
Job, C.K., J. Jayakumar, M. Kearney and T.P. Gillis. 2008. Transmission of leprosy: a study of skin and nasal
secretions of household contacts of leprosy patients using PCR. The American Journal of Tropical
Medicine and Hygiene 78(3):518-21.
Lavania, M., R.P. Turankar, S. Karri, V.S. Chaitanya, U. Sengupta and R.S. Jadhav. 2012. Cohort study of the
seasonal effect of nasal carriage and the prescence of Mycobacterium leprae in an endemic area in the
general population. Clinical Microbiology and Infection 19(10):970-4.
Lopez-Roa, R., M. Fafutis-Morris and M. Masanori. 2006. A drug resistant leprosy case detected by DNA sequence
analysis from a relapsed Mexican leprosy patient. Review of Latinoamerican Microbiology 48(3-4):256-
259.
Martinez, A. N., C. Talhari, M.O. Moraes and S. Talhari. 2014. PCR-Based Techniques for Leprosy Diagnosis:
From the Laboratory to the Clinic. PLoS Neglected Tropical Diseases 8(4):e2655.
Matsuoka, M., S. Izumi, T. Budiawan, N. Nakata and K. Saeki. 1999. Mycobacterium leprae DNA in daily using
water as a possible source of leprosy infection. Indian Journal of Leprosy 71(1):61-67.
Modlin, R. L., J. Melancon-Kaplan, S. M. Young, C. Pirmez, H. Kino, J. Convit, T.H. Rea and B.R. Bloom. 1988.
Learning from lesions: Patterns of tissue inflammation in leprosy. Medical Sciences 85(4):1213-1217.
Moubasher, A., N. Kamel, H. Zedan and D. Raheem. 1998. Cytokines in leprosy, I. Serum cytokine profile in
leprosy. International Journal of Dermatology 37(10):733-740.
19. 18
NLEP. NLEP – Progress Report for the year 2009-10 ending on 31st March 2010. New Delhi, 2010. Central
Leprosy Division. Directorate General of Health Services.
http://nlep.nic.in/pdf/ProgressReport31March2009-10.pdf.
NLEP. NLEP – Progress Report for the year 2011-12. New Delhi, 2012. Central Leprosy Division. Directorate
General of Health services. http://nlep.nic.in/pdf/ProgressReport2011-12.pdf.
Rai, D., H.S. Malhotra, R.K. Garg, M.M. Goel, K.P. Malhotra, V. Kumar, A.K. Singh, A. Jain, N. Kohli and S.K.
Singh. 2013. Nerve abscess in primary neuritic leprosy. Leprosy Review 84(2):136-140.
Rees, R.J. and A.C. McDougall. 1977. Airborne infection with Mycobacterium leprae in mice. Journal of Medical
Microbiology 10(1):63-68.
Science Development, "Trial Set for World's First Leprosy Vaccine," 2014.
Shin, I., J. Ray, V. Gupta, M. Ilgu, J. Beasley, L. Benedickson, S. Mehanovic, G.A. Kraus and M. Nilsen-Hamilton.
2014. Live-cell imaging of Pol II promoter activity to monitor gene expression with RNA IMAGEtag
reporters. Nucleic Acids Research doi: 10.1093/nar/gku297.
Singh, M., S. Radhakrishnan, K.M. Patil, and M.R.S. Reddy. 2000. Medical diagnostic techniques and procedures.
Narosa Publishing House, New Delhi, India.
Truman, R.W., P. Singh, R. Sharma, P. Busso, J. Rougemont, A. Paniz-Mondolfi, A. Kapopoulou, S. Brisse, D.M.
Scollard, T.P. Gillis and S.T. Cole. 2011. Probable zoonotic leprosy in the southern United States. New
English Journal of Medicine 364:1626-1633.
Turankar, R. P., M. Lavania, V.S. Chaitanya, U. Sengupta, J. Darlong, F. Darlong, K.S. Siva Sai and R.S. Jadhav.
2013. Single nucleotide polymorphism-based molecular typing of M. leprae. Clinical Microbiology and
Infection 20(3):O142-9.
Vedithi, S. C., M. Lavania, M. Kumar, P. Kaur, R.P. Turankar, I. Singh, A. Nigam and U. Sengupta. 2014. A report
of rifampin-resistant leprosy from northern and eastern India: identification and in silico analysis of
molecular interactions. Medical Microbiology and Immunology DOI: 10.1007/s00430-014-0354-1
Wadee, A.A., R. Anderson and A.R. Rabson. 1988. Clofazimine reverses the inhibitory effect of Mycobacterium
tuberculosis derived factors on phagocyte intracellular killing mechanisms. The Journal of Antimicrobial
Chemotherapy 21(1):65-74.
Wen, Y., Y. Xing, L.C. Yuan, J. Liu, Y. Zhang and H.Y. Li. 2013. Whole-blood nested-PCR amplification of M.
leprae-specific DNA for early diagnosis of leprosy. The American Journal of Tropical Medicine and
Hygiene 88(5):918-922.
Willacy, H. and C. Tidy. Patient. "Leprosy." Last modified May 21, 2014. http://www.patient.co.uk/doctor/leprosy-
pro.
WHOa. World Health Organization. "Classification of Leprosy." Last modified 2015.
http://www.who.int/lep/classification/en/.
WHOb. World Health Organization. "Leprosy." Last modified January 2014.
http://www.who.int/mediacentre/factsheets/fs101/en/.
20. 19
WHOc. World Health Organization. "Microbiology of M. leprae." Last modified 2015.
http://www.who.int/lep/microbiology/en/.
21. 20
APPENDIX I: CONSENT FORM
MOLECULAR BIOLOGY AND IMMUNOLOGY DIVISION
The Schieffelin Institute of Health Research & Leprosy Centre (SIH R & LC)
Karigiri, Vellore, Tamil Nadu 632106, India
INFORMED CONSENT FORM
Title of Project: ______________________________________________________
Principal Investigator: ______________________________________________________
Other Investigators: ______________________________________________________
Participant’s Name:
We invite you to take part in a research study on:
_____________________________________________________________________________
_____________________________________________________________________________
Which seeks to identify a more effective means of diagnosis and treatment of Leprosy. Taking
part in this study is entirely voluntary. If you decide to participate you must sign this form to
show that you want to take part.
The purpose of this research study is to
_______________________________________________________________________
Place of Sample
Collection:______________________________________________________________
You will be asked to provide a sample of______________________________________at
the time of recruitment and once/twice/ during the course of study if required. The blood
will be taken with a sterile syringe from your arm during your standard clinic visit. The
biopsy sample will be collected in an aseptic surgical theater by a clinician and slit skin
scrapings will be taken with a sterile blade from your ear lobe.
22. 21
You samples will be used in the current research study and might also be used for future
research projects:
________ I consent to my sample being saved for future research.
________ I do not consent my samples being saved for future research.
Important notes:
The procedures for sample collection will be performed by experienced
clinicians/technicians however in case of any unexpected injury, the cost towards the
treatment of that injury will be charged to SIH-R&LC Karigiri.
If you agree to take part in this study, your involvement will last approximately 15
minutes for the blood draw and 30 min for a Biopsy Sample.
Your research records that are reviewed, stored, and analyzed at Molecular Biology Lab
will be kept in a secured area in the computers in the office section of the laboratory.
You will not lose any legal rights by signing this form.
Taking part in this research study is voluntary. If you choose to take part, you have the right
to stop at any time. If you decide not to participate or if you decide to stop taking part in
the research at a later date, there will be no penalty.
Your clinical data will be accessed from the hospital patient database for a period of 2
years. Further information regarding this is given in the separate form for “Authorization
to use Health Information for Research Purposes”.
Signature and Consent/Permission to be in the Research
Before making the decision regarding enrollment in this research you should have:
Discussed this study with an investigator,
Reviewed the information in this form, and
Had the opportunity to ask any questions you may have.
Authorization to Use Your Health Information for Research Purposes
Your signature below means that you have received this information, have asked the questions
you currently have about the research and those questions have been answered and you
authorize us to utilize your samples for research purposes and your health information which will
only be used as required or allowed by law.
Participant: By signing this consent form, you indicate that you are voluntarily choosing to take
part in this research.
_____________________________ __________ ______ ________
Signature of Participant Date Time Name
23. 22
Person Explaining the Research: Your signature below means that you have explained and
answered any queries regarding the research to the participant/participant representative.
______________________________ _________ ________ ____________
Signature of person who Date Time Name
explained this research
_____________________________ _________ ________ ____________
Signature of a witness Date Time Name
For any Queries:
Molecular Biology Lab: Directorate:
Dr. Sundeep Chaitanya. V Dr. Mannam Ebenezer
Research Officer Director
(SIH R & LC), Karigiri, Vellore, (SIH R & LC), Karigiri, Vellore,
Tamil Nadu, 632106, India Tamil Nadu, 632106, India
Office: +91 416 2274227 Extn: 2249 Office: +91 416 2274221
Email: sundeepchaitanya@gmail.com Email:
directorate@karigiri.org
24. 23
APPENDIX II: GEL PICTURES
Figure 2. rlep PCR results: slit skin smears 001, 002, 004, 005, 001C, 004C
Lane 1 – blank; lane 2 – negative control; lane 3 – blank; lane 4 – positive control; lane 5 –
blank; lane 6 – patient 001; lane 7 – patient 002; lane 8 – patient 004; lane 9 – patient 005;
lane 10 – patient 001 contact; lane 11 – patient 004 contact, lanes 12 and 13 – other
samples not part of the project; lane 14 – blank. NC was not contaminated, and
amplification was achieved for PC, all patients, and contact of 004.
Figure 3. Slit skin smear PCR: 003, 005C, 007, 008, 008C
Lane 1 – negative control; lane 2 – blank; lane 3 – positive control; lane 4 – blank; lane 5 –
patient 003; lane 6 – patient 005 contact; lane 7 – patient 006; lane 8 – patient 007; lane 9 –
patient 008; lane 10 – patient 008 contact; lanes 11-14 – blank. NC was not contaminated,
and all patient and contact samples achieved amplification.
1 2 3 4 5 6 7 8 9 10 11 12 13 14
NC PC 001 002 004 005 001C 004C S1 S2
129 bp
1 2 3 4 5 6 7 8 9 10 11 12 13 14
NC PC 003 005C 006 007 008 008C
129 bp
25. 24
Figure 4. Blood sample PCR (008, 008C, and controls).
Lane 1 – negative control; lane 2 – positive control; lane 3 – patient 008; lane 4 – patient
008 contact; lane 5 – control 7; lane 6 – control 1; lane 7 – control 2; lane 8 – control 3; lane
9 – control 4; lane 10 – control 5; lane 11 – control 6; lane 12 – control 8; lane 13 – control
9; lane 14 – control 10. NC was not contaminated, and amplification was achieved for 2
(lane 6 & 11) of the controls but neither the patient nor contact.
Figure 5. Blood and slit skin smear samples 009 and 010.
Lane 1 – negative control; lane 2 – blank; lane 3 – patient 009’s blood sample; lane 4 –
patient 009’s slit skin sample; lanes 5 – patient 010’s slit skin sample, 6-7 – patient samples
unrelated to the project; lane 8 – blank; lane 9 – positive control; lane 10 – ladder; lanes 11-
14 - blank. NC was not contaminated, and amplification was achieved for the patients,
contact, and DNA from other samples.
1 2 3 4 5 6 7 8 9 10 11 12 13 14
NC PC 008 008C 7 1 2 3 4 5 6 8 9 10
129 bp
1 2 3 4 5 6 7 8 9 10 11 12 13 14
NC 009B 009S 010 PC MW Ladder
129 bp
200 bp
100 bp
26. 25
APPENDIX III: DETAILED LABORATORY PROTOCOL AND MATERIALS LIST FOR RLEP PCR
AMPLIFICATION OF M. LEPRAE DNA EXTRACTED FROM BLOOD AND SLIT SKIN SAMPLES
MATERIALS
SAMPLE COLLECTION
Consent forms
Pen or stamp pad
Micro centrifuge tubes
Glass tubes
Labels
70% ethanol
BLOOD SAMPLE PROCESSING
70% ethanol
Pipet
Micro centrifuge tubes
Sodium hypochlorite
Parafilm
DNA EXTRACTION
96-100% ethanol
Proteinase K
Buffers (ATL, AL, AW1, AW2, AE)
Vortex Mixer
Incubator
DNeasy Mini spin column
2 ml collection tube
Centrifuge
Pipets
Conical micro-centrifuge tubes
Marker
PCR (POLYMERASE CHAIN REACTION)
DNA primers for rlep; forward and reverse
27. 26
Thermal cycler
MgCl2
Taq polymerase
dNTP’s
Nuclease-free water
PCR tubes
10X PCR buffer
Pipets
Conical micro-centrifuge tube
Marker
DNA templates (from samples and positive control)
GEL ELECTROPHORESIS
2% Agarose gel
Tris-Borate-EDTA buffer
Orange G stain
Ethidium bromide
UV transilluminator
PCR products
Pipet
Electrophoresis unit
Parafilm
METHODS
SAMPLE COLLECTION
1. Consent was achieved (waiver form signed with either signature via pen or fingerprint via stamp pad)
before collection of each sample
2. Medical professionals collected the sample (slit skin smears into micro-centrifuge tubes, blood into glass
tubes)
3. Tubes were labeled
BLOOD SAMPLE PROCESSING
1. Withdraw serum from blood samples using 1000 µl pipet tip
2. Put into labeled micro-centrifuge tubes
3. Discard tips into sodium hypochloride
28. 27
4. Put parafilm around the caps of blood and serum samples
5. Store serum at -80 degrees C and blood at 4 degrees C
DNA EXTRACTION
From blood sample
1. Vortex samples to unclog blood
2. Pipet 100 µls of blood (using 1000 µl pipet) into micro-centrifuge tube (may have to cut off the pipet tip
if blood is too thick)
3. Add 20 µls of Proteinase K (jetting into the blood – need to change the tip after each sample); ensure
mixing of each reagent before use
4. Add 100 µls of PBS
5. Vortex (3-4 shots) to mix thoroughly
6. Add 200 µls AL buffer (changing tips with each sample)
7. Incubate at 60 degrees C until evening; vortex every hour (at least 3-5 times)
8. Add 200 µls 96-100% ethanol and vortex thoroughly
9. Label DNeasy Mini spin columns
10. Pipet mixture into DNeasy Mini spin column in 2 ml collection tube.
11. Centrifuge at 8000 rpm for 1 min. Check to see that the filter is clean; repeat this step otherwise
12. Discard flow-through (make sure that spin column doesn’t come into contact with flow-through)
13. Add 500 µls Buffer AW 1 (don’t touch the pipet tip to the tube)
14. Centrifuge for 1 min. at 8000 rpm (centrifuge for longer if material resides above the filter)
15. Discard flow-through (repeat steps 15 and 16 if material resides above the filter)
16. Add 500 µls of Buffer AW 2
17. Centrifuge for 3 min at 14,000 rpm
18. Discard flow through and collection tube
19. Transfer spin column to new collection tube
20. Add 200 µl Buffer AE for elution
21. Incubate for 1 min. at room temperature
22. Centrifuge for 1 min. at 8000 rpm
23. Discard spin column
24. Pipet flow-through into labeled conical micro-centrifuge tubes
25. Store extracted DNA at -20 degrees C
From slit skin smear sample
1. Store slit skin smear in 70% ethanol at 4 degrees C
1. Centrifuge for 20 min at 10,000 rpm to make pellet
2. Discard supernatant
3. Dry samples in incubator for 6-12 hours at 37 degrees C
4. Add 180 µls of Buffer ATL, trying to get material off the sides of the tube
5. Add 20 µls of proteinase K
6. Mix by vortexing for 10 min. until all material is off the sides of the tube
7. Incubate at 60 degrees C for 6 hours
8. Vortex samples for 15 sec
9. Add 200 µls Buffer AL (put pipet all the way down to prevent bubbles)
10. Vortex thoroughly
29. 28
11. Add 200 µls 96-100% ethanol
12. Vortex thoroughly
13. Label DNeasy Mini spin columns
14. Pipet samples into DNeasy Mini spin columns in a 2 ml collection tube (don’t touch the filter with the
pipet tip)
15. Centrifuge at 8000 rpm for 1 min.
16. Discard flow-through (don’t touch the bottom of the spin column to collection tube)
17. Add 500 µls of Buffer AW 1
18. Centrifuge for 1 min. at 8000 rpm
19. Discard flow-through
20. Add 500 µls of Buffer AW 2
21. Centrifuge for 3 min at 14,000 rpm
22. Discard flow through and collection tube
23. Transfer spin columns to new 2 ml collection tubes
24. Add 200 µls Buffer AE for elution
25. Incubate samples for 1 min at room temperature
26. Centrifuge for 1 min at 8000 rpm
27. Discard spin columns
28. Pipet flow-through into new labeled conical micro-centrifuge tubes
29. Store extracted DNA at -20 degrees C
PCR (POLYMERASE CHAIN REACTION)
1. Switch on the UV light 10 minutes before mixing PCR reagents
1. Calculate PCR reagent quantities
2. Turn off UV light and wait another 10 minutes
3. Take DNA out of fridge to thaw
4. Put on lab coat and gloves in PCR room only
5. Take out cooler with PCR reagents and ice block
6. Take all reagents out of cooler except Taq polymerase
7. Take out PCR tubes and conical micro-centrifuge tube; place into ice block
8. Thaw all PCR reagents except Taq polymerase
9. Pipet nuclease free water into micro-centrifuge tube first, adding extra to allow for pipet errors; put
back into cooler
10. Add buffer to micro-centrifuge tube; replace into cooler (mix each reagent before adding it)
11. Add dNTP’s, MgCl2, and forward and reverse primers; put reagents back into cooler
12. Add Taq polymerase (don’t need to mix beforehand)
13. Set pipet to amount larger than reaction mixture; mix all reagents (should see a froth)
14. Tap micro-centrifuge tube to get all liquid off the sides
15. Set pipet to 18 µls and dispense reaction mixture into each PCR tube (if extra remains in micro-
centrifuge tube, divide this up among the PCR tubes)
16. Close the negative control tube
17. Carry all PCR tubes over to PCR lab
18. Make sure sample DNA is thawed; add DNA to each PCR tube whilst labeling the tubes
19. Use pipet to mix reagents in each tube; tap to get all of the liquid off the sides
20. Take out Positive control DNA and thaw
21. Add PC DNA to labeled PC PCR tube; mix reagents and tap to get liquid down
30. 29
22. Label NC PCR tube
23. Put PCR tubes into thermocycler; select the rlep PCR program
24. Return DNA and cooler to refrigerators
25. Switch on the UV light in the PCR workbench
GEL ELECTROPHORESIS
1. Place a 7 µl dot of dye on parafilm for each PCR amplicon and DNA ladder
1. Place a 7 µl amount of each PCR amplicon and DNA ladder onto each dot of dye, using the same pipet tip
and a pipet set to 14 µls to mix after the amplicon is added. Change the pipet tip with each amplicon
2. Load the liquid from each dot into well on gel plate (don’t load the first well) after amplicon and dye is
sufficiently mixed. Leave 1 well of space between amplicons and NC; make sure that the order of PC, NC,
amplicons and ladder is noted
3. Attach the wires and set the voltage to 100 V; push start
4. When gel is done running (20-25 min.), place gel in UV transilluminator
5. Use computer software linked to camera to take and view gel pictures; save them
31. 30
PERSONAL REACTION TO PROJECT
Overall, I had a great time at Karigiri. It was exciting to be working on a molecular biology
project, which is something that I have always wanted to do, and especially to be working
on something with such clinical importance for the people there. Although leprosy is not a
very visible disease to us in developed nations, it is still a huge issue in several developing
countries, India included.
Our advisors at Karigiri, Dr. Sundeep and Ms. Madhusmita, were not only really kind, but
also very knowledgeable and helpful. Angela and I had known very little about leprosy
before coming to Karigiri, but because of them, we now have learned so much. They were
really patient when teaching us new skills, and did a great job of informing us what they
expected and giving us a projected schedule for the research. While they did quite a lot of
work in terms of planning the project for us, they also made sure that we were the ones
actually performing each step of the project. They also made sure that we understood
exactly what we were doing with our work, and the theories behind DNA extraction, PCR,
gel electrophoresis, etc. so that we weren’t just performing processes without grasping
why they were necessary. While they did a great job of maintaining a serious work
environment in the lab, outside of the lab we had a lot of fun together, and even more so
than our supervisors, they were our friends. The equipment in the lab was quite new and
high-quality, since Karigiri was in the process of revamping their molecular biology lab.
The A/C in the lab was also much appreciated.
Aside from our supervisors, most all the other staff we met at Karigiri were really sweet
and helpful. Dr. Esther Rita even took the time to help me identify the parasites from my
previous project. Angela and I made friends with several of the doctors there, like Dr. Katie
and Dr. Andrew, and the director, Dr. Mannam Ebenezer, was also a friendly man. It was
great to become friends with Valsa Augustine as well and to be welcomed so graciously into
her home, and to get to know all of the pleasantly sociable interns at the hospital. The
doctors who assisted in taking samples for our projects were more than happy to help us
out, and the guesthouse staff for the most part were really attentive to our needs. It was
wonderful to in such a spiritual environment and be surrounded by such strong Christians.
Angela and I really enjoyed the many Christmas functions that took place and the
decorations that were put up. It was hard to be away from home during the holiday season,
but the festive spirit at Karigiri helped put us into the Christmas mood a little more. It
seemed like there was always something fun happening every weekend, whether it was a
children’s show, a Christmas play, or a staff Christmas party. The shopping trip bus on the
weekends also made it easier to get off the hospital campus. The trails all around the
32. 31
hospital really facilitated running, and the location of the hospital, with all of the
surrounding mountains, was very beautiful.
One of the only issues was that the molecular lab was relatively new and growing, so there
was a lot of equipment that we had to wait quite a long time for, and sometimes there
would be mechanical issues with the equipment once it arrived. There were a lot of snakes
around the hospital campus, partially because the grass was allowed to grow for so long, so
it was always a little scary to have to watch out for them. One member of the dining hall
staff at the guesthouse was a little too controlling in trying to make sure that we came to
meals right on time, when that wasn’t always possible due to work or social activities.
I believe that the hospital should direct more funding to the molecular biology lab at
Karigiri since the projects they are undertaking are so important for the development of
new ways to detect M. leprae in patients’ systems without painful biopsies. I think that they
are really doing quite a bit of very important work and should be getting the recognition
they deserve. I also suggest that the dining staff at the guesthouse could be a bit more
flexible with regard to their guests’ schedules. Sometimes the doctors are seeing patients
and can’t come to meals on time, and sometimes because of work, the lab personnel can’t
make it on time either. All guests do pay for the meals, however, so it would be nice if they
could keep the food out for a bit longer than the scheduled time and also not get angry at
guests for being late because it most often is due to extenuating circumstances outside of
their control. Another option would be to leave parcels for those who did not come to a
meal on time that the guests can pick up when they arrive, so that the staff workers also
don’t have to have their day set back due to waiting for guests to come to meals. The dining
hall staff could also just leave out some basic food options for latecomers, like fruit,
chappatis and hard-boiled eggs.