Gold Nanoparticle as Biosensor
         Nanogold &Quantum Dot
                   as
            Novel Biosensors
                                                                                     www.nanopartz.com/Gold_Nanorods.htm

                   Amornpun Sereemaspun, MD. PhD.
                                E-mail : amornpun.s@gmail.com
                                   Nanobiomedicine Laboratory
                                                                    • Nano gold (Colloidal Gold)
                                         Department of Anatomy         – Nanometer-sized particles of gold in a fluid
                                             Faculty of Medicine       – Size 1-100 nm.
                                        Chulalongkorn University
                                                                       – Intense red or yellowish color




         Why Gold Nanoparticles ?                                      Gold Nanoparticles Synthesis
•   Easy to synthesis                                                         reduction                                stabilization
•   Protocol have been approved (J. Turkevich et al. 1951)            Au3+
                                                                         +
                                                                                                         Au0                                            Au0
•   Stable in room temperature
•   Red color ;easy to monitor or detect
•   Biocompatibility
•   Can conjugate with nucleic acid or protein




                                                                                          From; http://www.nature.com/nprot/journal/v3/n2/fig_tab/nprot.2008.1_F2.html




           Gold Nanoparticles and                                        Optical Properties of Nanogold
                Biomolecules




                                                                               webexhibits.org                                      www.azonano.com

• Nanogold size is similar to many cellular objects
• Gold surface can be coated by various biomolecules               • The optical properties of gold nanoparticles can be
                                                                     tuned carefully by controlling their size and shape
Basic optical properties of        Optical Properties of AuNPs
      nanoparticles




                                                                                                                   8




   NanoGold As Products                        NanoGold As Products

                              Lateral flow strip test




                                          From http://microgravity.hq.nasa.gov/general_info/homeplanet_lite.html




                                                             Leptospirosis

                              • A worldwide common
                                zoonosis in mammalian
                              • Spirochete-born disease
                              • Empirical diagnosis-based
                              • Staining – Gram unstainable
                                         – Silver stain OK
                              • Culture – special media,
                                          Take times
CFU

   Leptospirosis                                                 106                                 Urine Pregnancy Test
                                                             5 ×105
                                                                                    Nanogold Comparision with comercial kit
                                                                   105
Dot-Blot ELISA
                                                              5 ×104


                                                                   104




AuNP

       control 10   102   104      105                  106                  CFU
                                                                                                                              Rojanathanes R. et al. 2008 Taiwan OB-GYN
                                                                                                                                                     2008,




  Fluorescence-based detection of                                                          Nanogold and DNA Detection
           protein kinase




                                                                                                                                                Kiley et al.(Nanomedicine. 2008)


                                                                                    Mirkin et al. (Science 1997 ) reported DNA sandwich hybridization
                                                                                    assay using DNA-nanogold conjugate.

                                Kim, Y.-P., et al., Biosens. Bioelectron. (2007),                                                                                          16




                     Lateral Flow Strip Test

Microchromatographic-based
                                                                                                Conjugate probe      test line probe        Control line probe




                                http://www.rapid-diagnostics.org/index.htm

                                                                                                                                                            Control line
                                                                                                                                                            Control line
                                                                                                                                         Test line
                                                                                                                                         Test line

                                                                                                              Sample pad
                                                                                                              Sample pad      Conjugate probe
                                                                                                                              Conjugate probe
Lateral flow nucleic acid test strips                            Lateral flow nucleic acid test strips

Xun et al. (Anal. Chem. 2009)                                  Ioannis et al. (Anal. Chem. 2007)
applied nucleic acid biosensor                                 reported the first dry-reagent
based on the oligonucleotide                                   dipstick assay for SNP
functionalized Au-NPs and                                      genotyping by primer extension
lateral flow for the detection of
human genomic DNA directly
with a detection limit of 2.5
µg/mL (1.25 fM)




                                                                                                                                 20




                                    (Zhao et al., PNAS,2004)
                                                                                                      (Wang et al., Bioconjugate Chem, 2007)




                                                                                 What Are Quantum Dots?

                                                                   • Crystalline fluorophores
                                                                   • CdSe semiconductor core/ ZnS Shell
                                                                   • Unique Spectral properties
                                                                       – Broad absorption
                                                                       – Narrow emission
                                                                       – Wavelength depends on size



                                                                                  3 nm



(Rosi et al., Science, 2006)
QDs vs. Other Fluorescence                                                                    QDs vs. Other Fluorescence

• Photostability (quantum dots do not photobleach)                                                                                      •   Broader excitation spectrum and
                                                                                                                                            narrower emission spectrum

                                                                                                                                        •   No spectral overlap between dots
                                                                                                                                            of different size




       Quantum dots conjugate - red
       Alexa 488 conjugate   - green
                                          Wu et al. Nature; 2003
                                                                                                                                                             Jaiswal & Simon 2004




          Conjugating quantum dots to biomolecules                                                                    Quantum dots

                                          Avidin
• Avidin or protein-G with positively
  charged tail conjugated to negatively
  charged DHLA coat of quantum dots




                    protein G




                       Summary                                                                                        Future Outlook
 • Gold Nanoparticle are key components of numerous                    •      Development of QD lasers at communication wavelengths
                                                                       •      Gain and stimulated emission from QDs in polymers
   assays for biologically analytes, including proteins,
                                                                                – Polymeric optoelectronic devices?
   nucleic acids, small molecules and metal ions.                      •      Probe fundamental physics
 • Colorimetric assays provide a sensitive test                        •      Quantum computing schemes (exciton states as qubits)
                                                                                – Basis for solid-state quantum computing?
 • Gold nanoparticle improve the performance of                        •      Biological applications
   many conventional assays.                                           •      Material engineering
                                                                                – How to make QDs cheaply and easily with good control?
                                                                       •      Let’s not forget the electronic applications too!
                                                                       •      Lots to do!


                                                                   C. Seydel. Quantum dots get wet. Science, 300, p. 80-81, Apr 2003.
Methylation probe
                                                                                                                                                                                                          T       C
                                                                                                                                                                       MT
                                                                                                                                                                       G

                                                                                                                                                                       UTG
                                         Thank you                                                                                                                                               Methylation probe

                                                                                                                                                                         Probe                                                       Sequence
                                                                                                                                            AuNP-Probe              Met                          5’-thiol-TTTTTTTTTTACCTTACCCGCTCCATCGCG -3’
                                                                                                                                            Test line (T)           Met’                         5’-TCACTAACCGCTCCTCAAACAAATACG-TEG-biotin-3’
                                                                                                                                            Control (C)             Met Com                      5’-biotin- TTTTTTTTTTCGCGATGGAGCG GGTAAGGT-3’

                                                                                                                                                                   AuNPs-Probe: Methylation-probe 15 µL
                                                                                                                                                                   Test line(T): 1/10 Streptavidin-Biotin-Probe (Methylation)
                                                                                                                                                                   Control line(C): 1/10 Streptavidin-Biotin-Probe (Control)
                                                                                                                                                                   Hybridization buffer: 6XSSC, 0.5% SDS, 50% Formamide




Condition adjustment of new unmethylation biotin-probe                                                                                       Condition adjustment of new methylation biotin-probe
 0.1 µM Synthetic target                                                                            T C                                       0.1 µM Synthetic target
  (Met or Unmet) 10 µl                                               MT                                                                        (Met or Unmet) 10 µl                                         MT                                T C
                                    Hybridization
                                      buffer 1                       G                                                                                                                                    MTG
                                                                     UTG                                                                                                                                    UTG
        Add 90 µl                                                                                                                                    Add 90 µl                                            G
   Hybridization buffer             Hybridization                    MT                                                                         Hybridization buffer                                        MT
                                                                                                                                                                                                          UTG
                                      buffer 2
                                                                     G
                                                                     UTG                                                                                                                                    G
                                                              MTG=methylation target, UTG=unmethylation target                                                                                            MTG=methylation target, UTG=unmethylation target
   Apply mixture to                                                                                                                              Apply mixture to
     sample pad                                            Probe      µl                        MTG=methSequence                                   sample pad                                           Probe    µl                                   Sequence
                             AuNP-Probe                   Unmet       15                        ylation
                                                                           5 -thiol-TT TTT TTT TTC ACA ACT AAC CTT ACC CAC TCC ATC ACA -3                                   AuNP-Probe                  Met       15   5 -thiol-TTT TTT TTT TAC CTT ACC CGC TCC ATC GCG -3
                             Test line (T) 1/10           Unmet       1    5 -CAT CAA ACA TCT CCA ACA ACC ACT CCA C-TEG-biotin-3                                            Test line (T) 1/10          Met       1    5 -CGT CAA ACA TCT CCG ACG ACC GC-TEG-biotin-3
                             Control (C) 1/10             Unmet       1    5 -biotin-TTTTTTTTTTTGTGATGGAGTGGGTAAGGTTAGTTGTG-3                                               Control (C) 1/10            Met       1    5 -biotin- T TTT TTT TTT CGC GAT GGA GCG GG TAA GGT-3
                             Hybridization buffer 1       6×SSC, 1%BSA, 0.01% SDS, 0.2% Tween-20,                                                                           Hybridization buffer 2     6XSSC, 1% BSA, 0.01% SDS, 0.2% tween 20, 50% Formamide
                             Hybridization buffer 2       6XSSC, 1% BSA, 0.01% SDS, 0.2% tween 20, 50% Formamide




     Result: Buffer 2 can reduce non specific hybridization




 Condition adjustment of strip test with genomic DNA                                                                                                        Condition adjustment of SRY strip test
    DNA 5 µl
(treat bisulfite)                                                                                T C                                        1 µg DNA(Male)                                                                                T         C
                                                          B
                                                              MT
            Denature                                          G                                                              Met                            Denature                                                                ZP3 SRY
            at 100oC, 5 min                               N MTUTG                                                                                           at 100oC, 5 min
                                                            G
                                                          B   MT
            Chill in ice, 15 min                            UTG                                                              Unmet                          Chill in ice, 10 min

                                                          N   G                                                                             Apply DNA to
Apply DNA to
                                                                    B=Bisulfite treatment DNA, N=No treatment DNA
 sample pad                                                                                                                                  sample pad                                                 Probe     µl                                 Sequence
                                                                                                                                                                                       AuNP-Probe       SRY       10     5 -thiol-T TTT TTT TTT GAT GAT TAC AGT CCA GCT GTG CAA G-3
                                                  Probe       µl                                    Sequence                                                                                                             5 -thiol-TTT TTT TTT TAG CCA TCC TGA GAC GTC CGT ACA-3
                                                                                                                                                                                                        ZP3       10
                              AuNP-Probe          Unmet        15     5 -thiol-TT TTT TTT TTC ACA ACT AAC CTT ACC CAC TCC ATC ACA -3
                                                                                                                                                                                       Test line (T)    SRY       1     5 -GAA TAT TCC CGC TCT CCG GAG AAG TTT TTT TTT T-biotin-3
Apply buffer to                                    Met         15     5 -thiol-TTT TTT TTT TAC CTT ACC CGC TCC ATC GCG -3
                                                                                                                                            Apply buffer to                                1/10         ZP3       1     5 -GCC CGT ACT GGT GGA GTG TCA TTT TTT TTT T-biotin-3
                              Test line (T)       Unmet        1      5 -CAT CAA ACA TCT CCA ACA ACC ACT CCA C-TEG-biotin-3
 sample pad                      1/10              Met         1      5 -CGT CAA ACA TCT CCG ACG ACC GC-TEG-biotin-3
                                                                                                                                             sample pad                                 Control (C)     SRY       1     5 -biotin-TT TTT TTT TTC TTG CAC AGC TGG ACT GTA ATC ATC-3
                                                                                                                                                                                                                        5 -biotin-TTT TTT TTT TTG TAC GGA CGT CTC AGG ATG GCT-3
                                                                                                                                                                                           1/10         ZP3       1
                               Control (C)        Unmet        1      5 -biotin-TTTTTTTTTTTGTGATGGAGTGGGTAAGGTTAGTTGTG-3
                                                                      5 -biotin- T TTT TTT TTT CGC GAT GGA GCG GG TAA GGT-3                                                            Hybridization     6×SSC, 1%BSA, 0.2% Tween-20, 0.01% SDS
                                  1/10             Met         1                                                                                                                          buffer
                              Hybridization       6×SSC, 1%BSA, 0.2% Tween-20, 0.01% SDS
                                 buffer
                                                                                                                                                               Result: SRY test line appear red band

Bio-Material

  • 1.
    Gold Nanoparticle asBiosensor Nanogold &Quantum Dot as Novel Biosensors www.nanopartz.com/Gold_Nanorods.htm Amornpun Sereemaspun, MD. PhD. E-mail : amornpun.s@gmail.com Nanobiomedicine Laboratory • Nano gold (Colloidal Gold) Department of Anatomy – Nanometer-sized particles of gold in a fluid Faculty of Medicine – Size 1-100 nm. Chulalongkorn University – Intense red or yellowish color Why Gold Nanoparticles ? Gold Nanoparticles Synthesis • Easy to synthesis reduction stabilization • Protocol have been approved (J. Turkevich et al. 1951) Au3+ + Au0 Au0 • Stable in room temperature • Red color ;easy to monitor or detect • Biocompatibility • Can conjugate with nucleic acid or protein From; http://www.nature.com/nprot/journal/v3/n2/fig_tab/nprot.2008.1_F2.html Gold Nanoparticles and Optical Properties of Nanogold Biomolecules webexhibits.org www.azonano.com • Nanogold size is similar to many cellular objects • Gold surface can be coated by various biomolecules • The optical properties of gold nanoparticles can be tuned carefully by controlling their size and shape
  • 2.
    Basic optical propertiesof Optical Properties of AuNPs nanoparticles 8 NanoGold As Products NanoGold As Products Lateral flow strip test From http://microgravity.hq.nasa.gov/general_info/homeplanet_lite.html Leptospirosis • A worldwide common zoonosis in mammalian • Spirochete-born disease • Empirical diagnosis-based • Staining – Gram unstainable – Silver stain OK • Culture – special media, Take times
  • 3.
    CFU Leptospirosis 106 Urine Pregnancy Test 5 ×105 Nanogold Comparision with comercial kit 105 Dot-Blot ELISA 5 ×104 104 AuNP control 10 102 104 105 106 CFU Rojanathanes R. et al. 2008 Taiwan OB-GYN 2008, Fluorescence-based detection of Nanogold and DNA Detection protein kinase Kiley et al.(Nanomedicine. 2008) Mirkin et al. (Science 1997 ) reported DNA sandwich hybridization assay using DNA-nanogold conjugate. Kim, Y.-P., et al., Biosens. Bioelectron. (2007), 16 Lateral Flow Strip Test Microchromatographic-based Conjugate probe test line probe Control line probe http://www.rapid-diagnostics.org/index.htm Control line Control line Test line Test line Sample pad Sample pad Conjugate probe Conjugate probe
  • 4.
    Lateral flow nucleicacid test strips Lateral flow nucleic acid test strips Xun et al. (Anal. Chem. 2009) Ioannis et al. (Anal. Chem. 2007) applied nucleic acid biosensor reported the first dry-reagent based on the oligonucleotide dipstick assay for SNP functionalized Au-NPs and genotyping by primer extension lateral flow for the detection of human genomic DNA directly with a detection limit of 2.5 µg/mL (1.25 fM) 20 (Zhao et al., PNAS,2004) (Wang et al., Bioconjugate Chem, 2007) What Are Quantum Dots? • Crystalline fluorophores • CdSe semiconductor core/ ZnS Shell • Unique Spectral properties – Broad absorption – Narrow emission – Wavelength depends on size 3 nm (Rosi et al., Science, 2006)
  • 5.
    QDs vs. OtherFluorescence QDs vs. Other Fluorescence • Photostability (quantum dots do not photobleach) • Broader excitation spectrum and narrower emission spectrum • No spectral overlap between dots of different size Quantum dots conjugate - red Alexa 488 conjugate - green Wu et al. Nature; 2003 Jaiswal & Simon 2004 Conjugating quantum dots to biomolecules Quantum dots Avidin • Avidin or protein-G with positively charged tail conjugated to negatively charged DHLA coat of quantum dots protein G Summary Future Outlook • Gold Nanoparticle are key components of numerous • Development of QD lasers at communication wavelengths • Gain and stimulated emission from QDs in polymers assays for biologically analytes, including proteins, – Polymeric optoelectronic devices? nucleic acids, small molecules and metal ions. • Probe fundamental physics • Colorimetric assays provide a sensitive test • Quantum computing schemes (exciton states as qubits) – Basis for solid-state quantum computing? • Gold nanoparticle improve the performance of • Biological applications many conventional assays. • Material engineering – How to make QDs cheaply and easily with good control? • Let’s not forget the electronic applications too! • Lots to do! C. Seydel. Quantum dots get wet. Science, 300, p. 80-81, Apr 2003.
  • 6.
    Methylation probe T C MT G UTG Thank you Methylation probe Probe Sequence AuNP-Probe Met 5’-thiol-TTTTTTTTTTACCTTACCCGCTCCATCGCG -3’ Test line (T) Met’ 5’-TCACTAACCGCTCCTCAAACAAATACG-TEG-biotin-3’ Control (C) Met Com 5’-biotin- TTTTTTTTTTCGCGATGGAGCG GGTAAGGT-3’ AuNPs-Probe: Methylation-probe 15 µL Test line(T): 1/10 Streptavidin-Biotin-Probe (Methylation) Control line(C): 1/10 Streptavidin-Biotin-Probe (Control) Hybridization buffer: 6XSSC, 0.5% SDS, 50% Formamide Condition adjustment of new unmethylation biotin-probe Condition adjustment of new methylation biotin-probe 0.1 µM Synthetic target T C 0.1 µM Synthetic target (Met or Unmet) 10 µl MT (Met or Unmet) 10 µl MT T C Hybridization buffer 1 G MTG UTG UTG Add 90 µl Add 90 µl G Hybridization buffer Hybridization MT Hybridization buffer MT UTG buffer 2 G UTG G MTG=methylation target, UTG=unmethylation target MTG=methylation target, UTG=unmethylation target Apply mixture to Apply mixture to sample pad Probe µl MTG=methSequence sample pad Probe µl Sequence AuNP-Probe Unmet 15 ylation 5 -thiol-TT TTT TTT TTC ACA ACT AAC CTT ACC CAC TCC ATC ACA -3 AuNP-Probe Met 15 5 -thiol-TTT TTT TTT TAC CTT ACC CGC TCC ATC GCG -3 Test line (T) 1/10 Unmet 1 5 -CAT CAA ACA TCT CCA ACA ACC ACT CCA C-TEG-biotin-3 Test line (T) 1/10 Met 1 5 -CGT CAA ACA TCT CCG ACG ACC GC-TEG-biotin-3 Control (C) 1/10 Unmet 1 5 -biotin-TTTTTTTTTTTGTGATGGAGTGGGTAAGGTTAGTTGTG-3 Control (C) 1/10 Met 1 5 -biotin- T TTT TTT TTT CGC GAT GGA GCG GG TAA GGT-3 Hybridization buffer 1 6×SSC, 1%BSA, 0.01% SDS, 0.2% Tween-20, Hybridization buffer 2 6XSSC, 1% BSA, 0.01% SDS, 0.2% tween 20, 50% Formamide Hybridization buffer 2 6XSSC, 1% BSA, 0.01% SDS, 0.2% tween 20, 50% Formamide Result: Buffer 2 can reduce non specific hybridization Condition adjustment of strip test with genomic DNA Condition adjustment of SRY strip test DNA 5 µl (treat bisulfite) T C 1 µg DNA(Male) T C B MT Denature G Met Denature ZP3 SRY at 100oC, 5 min N MTUTG at 100oC, 5 min G B MT Chill in ice, 15 min UTG Unmet Chill in ice, 10 min N G Apply DNA to Apply DNA to B=Bisulfite treatment DNA, N=No treatment DNA sample pad sample pad Probe µl Sequence AuNP-Probe SRY 10 5 -thiol-T TTT TTT TTT GAT GAT TAC AGT CCA GCT GTG CAA G-3 Probe µl Sequence 5 -thiol-TTT TTT TTT TAG CCA TCC TGA GAC GTC CGT ACA-3 ZP3 10 AuNP-Probe Unmet 15 5 -thiol-TT TTT TTT TTC ACA ACT AAC CTT ACC CAC TCC ATC ACA -3 Test line (T) SRY 1 5 -GAA TAT TCC CGC TCT CCG GAG AAG TTT TTT TTT T-biotin-3 Apply buffer to Met 15 5 -thiol-TTT TTT TTT TAC CTT ACC CGC TCC ATC GCG -3 Apply buffer to 1/10 ZP3 1 5 -GCC CGT ACT GGT GGA GTG TCA TTT TTT TTT T-biotin-3 Test line (T) Unmet 1 5 -CAT CAA ACA TCT CCA ACA ACC ACT CCA C-TEG-biotin-3 sample pad 1/10 Met 1 5 -CGT CAA ACA TCT CCG ACG ACC GC-TEG-biotin-3 sample pad Control (C) SRY 1 5 -biotin-TT TTT TTT TTC TTG CAC AGC TGG ACT GTA ATC ATC-3 5 -biotin-TTT TTT TTT TTG TAC GGA CGT CTC AGG ATG GCT-3 1/10 ZP3 1 Control (C) Unmet 1 5 -biotin-TTTTTTTTTTTGTGATGGAGTGGGTAAGGTTAGTTGTG-3 5 -biotin- T TTT TTT TTT CGC GAT GGA GCG GG TAA GGT-3 Hybridization 6×SSC, 1%BSA, 0.2% Tween-20, 0.01% SDS 1/10 Met 1 buffer Hybridization 6×SSC, 1%BSA, 0.2% Tween-20, 0.01% SDS buffer Result: SRY test line appear red band