The document discusses several key points about congenital hypothyroidism: 1) It describes five genes (DUOX2, PAX8, NKX2-1, FOXE1, SLC5A5) that are involved in thyroid development and hormone production, and can cause congenital hypothyroidism if mutated. 2) It analyzes the nucleotide sequences and protein structures of these genes and finds similarities that indicate they evolved from a common ancestor. 3) Congenital hypothyroidism is more common in Pakistan due to factors like high consanguinity rates, lack of newborn screening programs, and iodine deficiency. Early treatment is needed to prevent intellectual disabilities.

2. 
 Maria Javed
 Lecturer Biotechnology

3.  The thyroid gland which is butterfly shaped, located in front of the neck,
below the larynx.
 It consists of two lobes that are connected by the thyroid tissue which is
called isthmus.
 25g is the weight of the thyroid gland in adults and each lobe of the
thyroid gland is 5cm long 3cm wide and 2cm thick while 1.25 is the
height and width of the isthmus.

4.  Produce thyroid hormones T3-triiodothyronine and T4-thyroxine.
 Regulate metabolism
 Increase glucose metabolism
 Increase protein synthesis
 Regulate growth and tissue differentiation.
 Digestion.
 Bone growth.
 Muscle tone.
 Development of nerve cells.
 Produce thyroid hormones T3-triiodothyronine and T4-thyroxine.

7.  Hypothyroidism means low production of
thyroid hormones.
 Hyperthyroidism means high production of
thyroid hormones.
 Congenital hypothyroidism, Congenital means
(at birth) and hypo mean (low).

9.  Causes.
 There are some drugs that cause hypothyroidism are
Thalidomide, Stavudine, Interferon Alfa, Oral tyrosine kinase
inhibitor, Amiodarone, Bexarotene etc
 For the treatment of the Graves diseases the radioactive iodine (I-
131) is used which in result in permanent hyperthyroidism after
surgery within 3-6 month is also cause of hypothyroidism.
 In less developed countries the iodine deficiency is also the cause
of hypothyroidism.
 Treatment.
 is made by giving the synthetic made drug thyroid hormone from
the bovine and porcine thyroid gland (levothyroxine). It is orally
given to the patient. Levothyroxine contain T4 which is inactive
and is converted into the T3 into the blood stream so in this we
can regain the TH to its normal level

10.  Graves diseases, antibody (protein that protect us from bacteria or virus)
is produced by our immune system In thyroid gland the lumps or
nodules
 Inflammation
 Diet
 Treatment.
 For more sustainable diseases like Graves diseases the anti-thyroid drugs
are giving. It effect on thyroid gland for normal production of TH. Its
result occurs within few weeks. The drugs used are propylthiouracil and
methimazole. Side effects of these drugs are rashes, itching but in severe
symptoms like liver inflammation consult with the doctor The thyroid
gland is the only cell in our body that take-up the iodine. It is permanent
treatment of hyperthyroidism. Its result occurs within few months. The
radioactive iodine is given to the patient by mouth which is absorbed by
the thyroid cells and are killed or damaged. The side effect is that the
killing of the thyroid cells result in other thyroid diseases the
hypothyroidism.

11.  Congenital hypothyroidism is the low production of thyroid hormones from the
thyroid gland.it is more common in females than males. In most cases, the
congenital hypothyroidism is permanent or transient.
 The recent studies in Pakistan that are carried out at some local level like Aga
Khan University have shown the increased risk of congenital hypothyroidism
incidence in neonates. The most common preventable diseases of Pakistan are
congenital hypothyroidism that has an incidence rate 25 per-cent which is 3-4
per cent higher than in the West.
 The new born screening program can be initiated by the Quebec Canada
in 1972 show the incidence of 1/7000 new born. The blood from the heel
prick of the infant is carried on to the filter paper after 24 hours of birth
and the method used for the detection of level of thyroid hormones and
TSH can be detected by these sensitive and automated methods
(chemiluminesence, radioimmunoassay).

12.  In Pakistan the congenital hypothyroidism is high due to high rates of
consgunitity that is 46-61%.
 The delivery can be taken in home was 80% in midwife clinics and villages
 Unskilled birth attended
 No such lab work
 Appropriate apparatus
 Stortage of data
 Lack of screening programs
 Lack of education.
 Iodine deficiency,
 Absence or poor development of thyroid gland
 There are several genes that play role in the proper growth and development
of the thyroid gland. Mutations in each of these genes disrupt a step in thyroid
hormone synthesis, leading to abnormally low levels of these hormones.
 Most common genes of congenital hypothyroidism like SLC5A5,NKX2-
1,FOXE1PAX8,DUOX2 were studied in present research.

13.  When the hypothyroidism is confirmed that the thyroid replacement
therapy is initiated .The infant is given the levothyroxine either mix in
the milk or water and by syringe. The level of the dose can be checked
according to the symptoms of the infant and can be check-up after few
months of interval. The goal is to comeback the level of T4 and can
prevent the child from being mentally started throughout the life.

14.  DUOX2
 It is a member of NADPH oxidase family and glycoprotein is a protein that is
encoded by this gene. Thyropeoxidase, iodide transporter and hydrogen
peroxidase are the protein complexes that are located at the apical membrane
of thyroid follicular cells for the generation of thyroid hormones.
 DUOX2 gene is located on chromosome number 15 at a position 21.1
 FOXE1
 Intron less gene located on chromosome number 9 at position 22.33, encoded
the protein of the transcription factor fork head family. This encoded protein
plays an important role in the thyroid morphogenesis
 NIS (Sodium iodide symporter /SLC5A5 )
 is a glycoprotein which biosynthesis the thyroid hormones by transporting 1
iodide ion and 2 sodium ion into the thyroid follicular cells is the function of this
gene. For driving the solute into the cell the family members of this gene rely on
the Na ion electrochemical gradient. This gene also express in breast, colon and
ovary .It is located at chromosome number at chromosome 19 at position 13.11.

15. PAX8
 The PAX8 gene belongs to that family of gene that play an important role in the
formation of organs during embryonic development and tissue formation. For
thyroid hormones synthesis the PAX8 protein regulate genes that are involved
for their synthesis.PAX8 gene is located on chromosome number 2 at a position
14.1.
 NKX2-1
 gene make a protein called homeo- box protein Nkx2-1 located at
chromosome number 14 at a position of 13.3 , function as a transcription
factor, this protein is important for the thyroid gland, this protein also
controlled those genes

16. Gene sr. no. Official symbol Full name Primary source Gene type Chromosome
location
Also known as
DUOX2/THOX2 DUOX2 Dual oxidase 2 HGNC:HGNC:13273 Protein
coding
Chr 15 NC
000015.10
DUOX2,THOX2,
THOX1, TDH6,LNOX2.
PAX8 PAX8 Paired box 8 HGNC:HGNC:8622 Protein
coding
Chr 2 NC 000002.12 NO other name.
NKX2-1 TTF-1 NK2 homeobox 1 HGNC:HGNC:11825 Protein
coding
Chr 14 NC 000014.9 TTF-1, TTF-I,NKX2-
1,BCH,BHC.
FOXE1 FOXE1 Forkhead Box E-1 HGNC:HGNC:3806 Protein
coding
Chr 9 –NC
000009.12
TTF-2,
FOXE1,TITF2,HLKF5.
SLC5A5/NIS SLC5A5 Solute carrier
family 5 member
5,sodium iodie
symporter
HGNC:HGNC:11040 Protein
coding
Chr 19- NC
000019.10
TDH1,NIS,SLC5A5

17.  Nucleotide sequence of genes were collected from NCBI in FASTA format
to run the BLAST and search to see the homology.
 Genes that arise from a common ancestors are called orthologs,
Orthologous sequences of these genes were studied by using the OTTH
and ensemble tool. The complete dataset of gene clusters and associated
disease information was made available through an online searchable tool
named OrthoDisease (http://orthodisease.cgb.ki.se/).
 Ensemble tool explain the genes that they have common ancestor and
displayed in phylogenic tree (https://asia.ensembl.org/index.html).
 For find the general function of genes HGNG (OMIM) tool is used
(https;//www.omim.org/entry/188450).
 By using the “Multialin” and “Alibee” multiple alignment
(www.genebee.msu.su/services/malign_reduced.html) all five gene
sequences were aligned, results are shown in the form of phylogenetic
trees, and in the form of bioinformatics scoring matrices.
 Conserved domain database is also used to find the image of proteins of
each gene (https://www.ncbi.nlm.nih.gov/structure/cdd/wrpsb.cgi).

19.  >AF267981.1 Homo sapiens putative NADPH oxidase/peroxidase
DUOX2 mRNA, complete cds
 GGTCTGTCCTGAGCCGACACCTGCACAGTGGCGAGACCAAGGACCCAGAGAGAAAGGTGAGAGTGCAGCC
 GGGGAGGCTGAGGATCGGCGGAGCTGGAAGAGTGAGGGTGAAGGCAAGAAGTAGAGCACAGAAGCAAAGA
 TTTTAAGAGGAAAGAAGACATTTGAACCCAACACCACCCTAAACCACAGGCTGCAGGGTTGGCATGCTCC
 GTGCAAGACCAGAGGCACTGATGCTCCTGGGAGCTCTTCTGACTGGATCCCTGGGTCCATCGGGCAGTCA
 GGACGCACTCTCACTGCCCTGGGAAGTGCAGCGCTATGACGGCTGGTTTAACAACCTGAGGCACCACGAG
 CGTGGTGCTGTTGGCTGCCGGTTGCAGCGCCGCGTACCAGCCAATTACGCCGACGGTGTGTATCAGGCTC
 TGGAGGAGCCGCAGCTGCCCAACCCGCGCCGGCTCAGCAACGCAGCCACGCGGGGCATAGCCGGCCTGCC
 GTCGCTCCAC

20. Sr
number
.
Species. Type. Orthologue. Query %
yield.
1- Bushbabby
(Otolemur gamettii)
1-to-1 DUOX2(ENSOGAG000000127
62)
89.73%
2- Fruitfly
(Drosophilia
melanogaster)
1-to-
many
DUOX2(FBgn0031464) 37.73%
3- Horse
(Equus caballus)
1-to-1 DUOX2(ENSECAG000000177
64
87.60%
4- Cat
(Felis catus)
1-to-1 DUOX2(ENSFCA00000007561
)
83.98%
5- Chimpanzee
(Pan troglodytes)
1-to-1 DUOX2(ENSPTRG0000000702
6)
99.29%
6- Dog
(Canis lupus
familiaris)
1-to-1 DUOX2(ENSCAFG0000001369
3)
86.11%
7- Cow
(Bos taurus)
1-to-1 DUOX2(ENSBTAG0000001623
4)
87.47%
8- Pig
(Sus scrofa)
1-to-1 DUOX2(ENSSSCG0000000467
8)
83.66%
9- Sheep
(Ovis aries)
1-to-1 DUOX2(ENSOARG000000022
83)
41.21%
10- Rat
(Rattus norvegicus)
1-to-1 DUOX2(ENSRNOG000000173
95)
82.69%

22. 

24.  3D structure of protein DUOX2 of The Conserved Domain
Database is a resource for the annotation of functional units in
proteins (domains and motifs).
 In transcription regulators most of the family
members of the alpha –helical protein domain function
as a sequence-specific DNA binding domains. Winged
turn-helix domain is also includes in this superfamily

26.  Consensus sequences which are present in all five genes show some important
regulatory motifs that were involved in congenital hypothyroidism.
 1:“ACGGGTTCCCACTGCCCCCGGTCCGGGAGGTGACAAGACATGTCA”
 2:“CTTCCTGCAGAAAACAC”
 Two active domains were also present in most of the genes, central well
conserved DNA binding domain (DBD) (1) and a C-terminal ligand binding
domain (4). These domains can serve as important targets for drug designing

27. Scoring matrices:
help us in finding mutations, deletions, insertions, presence of new genes etc
Matrices DNARNA
NUCLEOTIDE DISTANCE MATRIX
A C D E F G H I K L M N P Q R S T V W Y
A 10
C 0 10
D 0 0 10
E 0 0 0 10
F 0 0 0 0 10
G 0 0 0 0 0 10
H 0 0 0 0 0 0 10
I 0 0 0 0 0 0 0 10
K 0 0 0 0 0 0 0 0 10
L 0 0 0 0 0 0 0 0 0 10
M 0 0 0 0 0 0 0 0 0 0 10
N 0 0 0 0 0 0 0 0 0 0 0 10
P 0 0 0 0 0 0 0 0 0 0 0 0 10
Q 0 0 0 0 0 0 0 0 0 0 0 0 0 10
R 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10
S 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10
T 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10
V 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10
W 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10
Y 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10

28.  Bioinformatics analysis of origin and function of each gene which utilizes 3D
motif structure provides insights into sequence/structure/function relationships
of different genes.
 Protein domain's remain conserved in molecular evolution so structural
abnormality, macromolecular structures and novel mutations will help in
understanding insight into diseases.
 Identification of orthologs is critical for reliable prediction of gene function in
newly sequenced genomes. Relationship between different orthologs will helps
in understanding convergent evolution.
 phylogenetic analysis identify genes that are correlated with evolutionary
changes in morphological, physiological, and developmental conditions. This will
provide entirely new opportunities to identify genes related to particular
phenotypes.

29.  Polymorphism of these genes will help in study thyroid related problems
in different populations.
 The environmental factors and endocrine disruptors affecting thyroid
hormones have not been studied extensively, its an open field of
research for young scientists.
 It is also observed that thyroid level may differ due to climatic changes
as well as food habit, Iodine intake, race and socio-economic conditions
of peoples belonging to different areas of the world. This phenomena
and signaling mechanism can also be studied according to our own
geographical area.
 We can find the new novel mutations in thyroid hormones .Further
studies will helps in understanding enzymatic mechanism