The document discusses the Velvet and Curtain assembly algorithms. It provides an overview and then goes into more detail on the de Bruijn graph approach used by Velvet to assemble short reads into contiguous sequences. It discusses how Velvet builds the de Bruijn graph from k-mers and provides examples of adding reads to the graph. It also covers extensions for handling biology complexities like repeats and errors. Finally, it briefly discusses different types of sequencing reads that can be used as inputs.
Customization of LES turbulence model in OpenFOAMmmer547
This slide is the distribution material on the seminar, "Customization of LES turbulence model in OpenFOAM". (June 13 2015 "OpenCAE Local User Group @ Kansai")
http://ofbkansai.sakura.ne.jp/
This document is the distribution material on "Code-Saturne beginner seminar". (November 1 2014 "OpenCAE Study Meeting @ Kansai")
http://ofbkansai.sakura.ne.jp/
Since our inception in the year, 2002, we, 'Say Velvet & Fashion' are engaged in manufacturing and supplying a diverse range of Velvet Powder & Fabric, Sarees and Flock Printing Machine. Besides, delighting our customers with an enticing range of sarees and fabrics, we are engaged in offering Flock and Embroidery Job Works.
Customization of LES turbulence model in OpenFOAMmmer547
This slide is the distribution material on the seminar, "Customization of LES turbulence model in OpenFOAM". (June 13 2015 "OpenCAE Local User Group @ Kansai")
http://ofbkansai.sakura.ne.jp/
This document is the distribution material on "Code-Saturne beginner seminar". (November 1 2014 "OpenCAE Study Meeting @ Kansai")
http://ofbkansai.sakura.ne.jp/
Since our inception in the year, 2002, we, 'Say Velvet & Fashion' are engaged in manufacturing and supplying a diverse range of Velvet Powder & Fabric, Sarees and Flock Printing Machine. Besides, delighting our customers with an enticing range of sarees and fabrics, we are engaged in offering Flock and Embroidery Job Works.
Francesca Gottschalk - How can education support child empowerment.pptxEduSkills OECD
Francesca Gottschalk from the OECD’s Centre for Educational Research and Innovation presents at the Ask an Expert Webinar: How can education support child empowerment?
Biological screening of herbal drugs: Introduction and Need for
Phyto-Pharmacological Screening, New Strategies for evaluating
Natural Products, In vitro evaluation techniques for Antioxidants, Antimicrobial and Anticancer drugs. In vivo evaluation techniques
for Anti-inflammatory, Antiulcer, Anticancer, Wound healing, Antidiabetic, Hepatoprotective, Cardio protective, Diuretics and
Antifertility, Toxicity studies as per OECD guidelines
Safalta Digital marketing institute in Noida, provide complete applications that encompass a huge range of virtual advertising and marketing additives, which includes search engine optimization, virtual communication advertising, pay-per-click on marketing, content material advertising, internet analytics, and greater. These university courses are designed for students who possess a comprehensive understanding of virtual marketing strategies and attributes.Safalta Digital Marketing Institute in Noida is a first choice for young individuals or students who are looking to start their careers in the field of digital advertising. The institute gives specialized courses designed and certification.
for beginners, providing thorough training in areas such as SEO, digital communication marketing, and PPC training in Noida. After finishing the program, students receive the certifications recognised by top different universitie, setting a strong foundation for a successful career in digital marketing.
A Strategic Approach: GenAI in EducationPeter Windle
Artificial Intelligence (AI) technologies such as Generative AI, Image Generators and Large Language Models have had a dramatic impact on teaching, learning and assessment over the past 18 months. The most immediate threat AI posed was to Academic Integrity with Higher Education Institutes (HEIs) focusing their efforts on combating the use of GenAI in assessment. Guidelines were developed for staff and students, policies put in place too. Innovative educators have forged paths in the use of Generative AI for teaching, learning and assessments leading to pockets of transformation springing up across HEIs, often with little or no top-down guidance, support or direction.
This Gasta posits a strategic approach to integrating AI into HEIs to prepare staff, students and the curriculum for an evolving world and workplace. We will highlight the advantages of working with these technologies beyond the realm of teaching, learning and assessment by considering prompt engineering skills, industry impact, curriculum changes, and the need for staff upskilling. In contrast, not engaging strategically with Generative AI poses risks, including falling behind peers, missed opportunities and failing to ensure our graduates remain employable. The rapid evolution of AI technologies necessitates a proactive and strategic approach if we are to remain relevant.
A workshop hosted by the South African Journal of Science aimed at postgraduate students and early career researchers with little or no experience in writing and publishing journal articles.
A review of the growth of the Israel Genealogy Research Association Database Collection for the last 12 months. Our collection is now passed the 3 million mark and still growing. See which archives have contributed the most. See the different types of records we have, and which years have had records added. You can also see what we have for the future.
Operation “Blue Star” is the only event in the history of Independent India where the state went into war with its own people. Even after about 40 years it is not clear if it was culmination of states anger over people of the region, a political game of power or start of dictatorial chapter in the democratic setup.
The people of Punjab felt alienated from main stream due to denial of their just demands during a long democratic struggle since independence. As it happen all over the word, it led to militant struggle with great loss of lives of military, police and civilian personnel. Killing of Indira Gandhi and massacre of innocent Sikhs in Delhi and other India cities was also associated with this movement.
Executive Directors Chat Leveraging AI for Diversity, Equity, and InclusionTechSoup
Let’s explore the intersection of technology and equity in the final session of our DEI series. Discover how AI tools, like ChatGPT, can be used to support and enhance your nonprofit's DEI initiatives. Participants will gain insights into practical AI applications and get tips for leveraging technology to advance their DEI goals.
2024.06.01 Introducing a competency framework for languag learning materials ...Sandy Millin
http://sandymillin.wordpress.com/iateflwebinar2024
Published classroom materials form the basis of syllabuses, drive teacher professional development, and have a potentially huge influence on learners, teachers and education systems. All teachers also create their own materials, whether a few sentences on a blackboard, a highly-structured fully-realised online course, or anything in between. Despite this, the knowledge and skills needed to create effective language learning materials are rarely part of teacher training, and are mostly learnt by trial and error.
Knowledge and skills frameworks, generally called competency frameworks, for ELT teachers, trainers and managers have existed for a few years now. However, until I created one for my MA dissertation, there wasn’t one drawing together what we need to know and do to be able to effectively produce language learning materials.
This webinar will introduce you to my framework, highlighting the key competencies I identified from my research. It will also show how anybody involved in language teaching (any language, not just English!), teacher training, managing schools or developing language learning materials can benefit from using the framework.
Introduction to AI for Nonprofits with Tapp NetworkTechSoup
Dive into the world of AI! Experts Jon Hill and Tareq Monaur will guide you through AI's role in enhancing nonprofit websites and basic marketing strategies, making it easy to understand and apply.
2024 State of Marketing Report – by HubspotMarius Sescu
https://www.hubspot.com/state-of-marketing
· Scaling relationships and proving ROI
· Social media is the place for search, sales, and service
· Authentic influencer partnerships fuel brand growth
· The strongest connections happen via call, click, chat, and camera.
· Time saved with AI leads to more creative work
· Seeking: A single source of truth
· TLDR; Get on social, try AI, and align your systems.
· More human marketing, powered by robots
ChatGPT is a revolutionary addition to the world since its introduction in 2022. A big shift in the sector of information gathering and processing happened because of this chatbot. What is the story of ChatGPT? How is the bot responding to prompts and generating contents? Swipe through these slides prepared by Expeed Software, a web development company regarding the development and technical intricacies of ChatGPT!
Francesca Gottschalk - How can education support child empowerment.pptxEduSkills OECD
Francesca Gottschalk from the OECD’s Centre for Educational Research and Innovation presents at the Ask an Expert Webinar: How can education support child empowerment?
Biological screening of herbal drugs: Introduction and Need for
Phyto-Pharmacological Screening, New Strategies for evaluating
Natural Products, In vitro evaluation techniques for Antioxidants, Antimicrobial and Anticancer drugs. In vivo evaluation techniques
for Anti-inflammatory, Antiulcer, Anticancer, Wound healing, Antidiabetic, Hepatoprotective, Cardio protective, Diuretics and
Antifertility, Toxicity studies as per OECD guidelines
Safalta Digital marketing institute in Noida, provide complete applications that encompass a huge range of virtual advertising and marketing additives, which includes search engine optimization, virtual communication advertising, pay-per-click on marketing, content material advertising, internet analytics, and greater. These university courses are designed for students who possess a comprehensive understanding of virtual marketing strategies and attributes.Safalta Digital Marketing Institute in Noida is a first choice for young individuals or students who are looking to start their careers in the field of digital advertising. The institute gives specialized courses designed and certification.
for beginners, providing thorough training in areas such as SEO, digital communication marketing, and PPC training in Noida. After finishing the program, students receive the certifications recognised by top different universitie, setting a strong foundation for a successful career in digital marketing.
A Strategic Approach: GenAI in EducationPeter Windle
Artificial Intelligence (AI) technologies such as Generative AI, Image Generators and Large Language Models have had a dramatic impact on teaching, learning and assessment over the past 18 months. The most immediate threat AI posed was to Academic Integrity with Higher Education Institutes (HEIs) focusing their efforts on combating the use of GenAI in assessment. Guidelines were developed for staff and students, policies put in place too. Innovative educators have forged paths in the use of Generative AI for teaching, learning and assessments leading to pockets of transformation springing up across HEIs, often with little or no top-down guidance, support or direction.
This Gasta posits a strategic approach to integrating AI into HEIs to prepare staff, students and the curriculum for an evolving world and workplace. We will highlight the advantages of working with these technologies beyond the realm of teaching, learning and assessment by considering prompt engineering skills, industry impact, curriculum changes, and the need for staff upskilling. In contrast, not engaging strategically with Generative AI poses risks, including falling behind peers, missed opportunities and failing to ensure our graduates remain employable. The rapid evolution of AI technologies necessitates a proactive and strategic approach if we are to remain relevant.
A workshop hosted by the South African Journal of Science aimed at postgraduate students and early career researchers with little or no experience in writing and publishing journal articles.
A review of the growth of the Israel Genealogy Research Association Database Collection for the last 12 months. Our collection is now passed the 3 million mark and still growing. See which archives have contributed the most. See the different types of records we have, and which years have had records added. You can also see what we have for the future.
Operation “Blue Star” is the only event in the history of Independent India where the state went into war with its own people. Even after about 40 years it is not clear if it was culmination of states anger over people of the region, a political game of power or start of dictatorial chapter in the democratic setup.
The people of Punjab felt alienated from main stream due to denial of their just demands during a long democratic struggle since independence. As it happen all over the word, it led to militant struggle with great loss of lives of military, police and civilian personnel. Killing of Indira Gandhi and massacre of innocent Sikhs in Delhi and other India cities was also associated with this movement.
Executive Directors Chat Leveraging AI for Diversity, Equity, and InclusionTechSoup
Let’s explore the intersection of technology and equity in the final session of our DEI series. Discover how AI tools, like ChatGPT, can be used to support and enhance your nonprofit's DEI initiatives. Participants will gain insights into practical AI applications and get tips for leveraging technology to advance their DEI goals.
2024.06.01 Introducing a competency framework for languag learning materials ...Sandy Millin
http://sandymillin.wordpress.com/iateflwebinar2024
Published classroom materials form the basis of syllabuses, drive teacher professional development, and have a potentially huge influence on learners, teachers and education systems. All teachers also create their own materials, whether a few sentences on a blackboard, a highly-structured fully-realised online course, or anything in between. Despite this, the knowledge and skills needed to create effective language learning materials are rarely part of teacher training, and are mostly learnt by trial and error.
Knowledge and skills frameworks, generally called competency frameworks, for ELT teachers, trainers and managers have existed for a few years now. However, until I created one for my MA dissertation, there wasn’t one drawing together what we need to know and do to be able to effectively produce language learning materials.
This webinar will introduce you to my framework, highlighting the key competencies I identified from my research. It will also show how anybody involved in language teaching (any language, not just English!), teacher training, managing schools or developing language learning materials can benefit from using the framework.
Introduction to AI for Nonprofits with Tapp NetworkTechSoup
Dive into the world of AI! Experts Jon Hill and Tareq Monaur will guide you through AI's role in enhancing nonprofit websites and basic marketing strategies, making it easy to understand and apply.
2024 State of Marketing Report – by HubspotMarius Sescu
https://www.hubspot.com/state-of-marketing
· Scaling relationships and proving ROI
· Social media is the place for search, sales, and service
· Authentic influencer partnerships fuel brand growth
· The strongest connections happen via call, click, chat, and camera.
· Time saved with AI leads to more creative work
· Seeking: A single source of truth
· TLDR; Get on social, try AI, and align your systems.
· More human marketing, powered by robots
ChatGPT is a revolutionary addition to the world since its introduction in 2022. A big shift in the sector of information gathering and processing happened because of this chatbot. What is the story of ChatGPT? How is the bot responding to prompts and generating contents? Swipe through these slides prepared by Expeed Software, a web development company regarding the development and technical intricacies of ChatGPT!
Product Design Trends in 2024 | Teenage EngineeringsPixeldarts
The realm of product design is a constantly changing environment where technology and style intersect. Every year introduces fresh challenges and exciting trends that mold the future of this captivating art form. In this piece, we delve into the significant trends set to influence the look and functionality of product design in the year 2024.
How Race, Age and Gender Shape Attitudes Towards Mental HealthThinkNow
Mental health has been in the news quite a bit lately. Dozens of U.S. states are currently suing Meta for contributing to the youth mental health crisis by inserting addictive features into their products, while the U.S. Surgeon General is touring the nation to bring awareness to the growing epidemic of loneliness and isolation. The country has endured periods of low national morale, such as in the 1970s when high inflation and the energy crisis worsened public sentiment following the Vietnam War. The current mood, however, feels different. Gallup recently reported that national mental health is at an all-time low, with few bright spots to lift spirits.
To better understand how Americans are feeling and their attitudes towards mental health in general, ThinkNow conducted a nationally representative quantitative survey of 1,500 respondents and found some interesting differences among ethnic, age and gender groups.
Technology
For example, 52% agree that technology and social media have a negative impact on mental health, but when broken out by race, 61% of Whites felt technology had a negative effect, and only 48% of Hispanics thought it did.
While technology has helped us keep in touch with friends and family in faraway places, it appears to have degraded our ability to connect in person. Staying connected online is a double-edged sword since the same news feed that brings us pictures of the grandkids and fluffy kittens also feeds us news about the wars in Israel and Ukraine, the dysfunction in Washington, the latest mass shooting and the climate crisis.
Hispanics may have a built-in defense against the isolation technology breeds, owing to their large, multigenerational households, strong social support systems, and tendency to use social media to stay connected with relatives abroad.
Age and Gender
When asked how individuals rate their mental health, men rate it higher than women by 11 percentage points, and Baby Boomers rank it highest at 83%, saying it’s good or excellent vs. 57% of Gen Z saying the same.
Gen Z spends the most amount of time on social media, so the notion that social media negatively affects mental health appears to be correlated. Unfortunately, Gen Z is also the generation that’s least comfortable discussing mental health concerns with healthcare professionals. Only 40% of them state they’re comfortable discussing their issues with a professional compared to 60% of Millennials and 65% of Boomers.
Race Affects Attitudes
As seen in previous research conducted by ThinkNow, Asian Americans lag other groups when it comes to awareness of mental health issues. Twenty-four percent of Asian Americans believe that having a mental health issue is a sign of weakness compared to the 16% average for all groups. Asians are also considerably less likely to be aware of mental health services in their communities (42% vs. 55%) and most likely to seek out information on social media (51% vs. 35%).
AI Trends in Creative Operations 2024 by Artwork Flow.pdfmarketingartwork
This article is all about what AI trends will emerge in the field of creative operations in 2024. All the marketers and brand builders should be aware of these trends for their further use and save themselves some time!
A report by thenetworkone and Kurio.
The contributing experts and agencies are (in an alphabetical order): Sylwia Rytel, Social Media Supervisor, 180heartbeats + JUNG v MATT (PL), Sharlene Jenner, Vice President - Director of Engagement Strategy, Abelson Taylor (USA), Alex Casanovas, Digital Director, Atrevia (ES), Dora Beilin, Senior Social Strategist, Barrett Hoffher (USA), Min Seo, Campaign Director, Brand New Agency (KR), Deshé M. Gully, Associate Strategist, Day One Agency (USA), Francesca Trevisan, Strategist, Different (IT), Trevor Crossman, CX and Digital Transformation Director; Olivia Hussey, Strategic Planner; Simi Srinarula, Social Media Manager, The Hallway (AUS), James Hebbert, Managing Director, Hylink (CN / UK), Mundy Álvarez, Planning Director; Pedro Rojas, Social Media Manager; Pancho González, CCO, Inbrax (CH), Oana Oprea, Head of Digital Planning, Jam Session Agency (RO), Amy Bottrill, Social Account Director, Launch (UK), Gaby Arriaga, Founder, Leonardo1452 (MX), Shantesh S Row, Creative Director, Liwa (UAE), Rajesh Mehta, Chief Strategy Officer; Dhruv Gaur, Digital Planning Lead; Leonie Mergulhao, Account Supervisor - Social Media & PR, Medulla (IN), Aurelija Plioplytė, Head of Digital & Social, Not Perfect (LI), Daiana Khaidargaliyeva, Account Manager, Osaka Labs (UK / USA), Stefanie Söhnchen, Vice President Digital, PIABO Communications (DE), Elisabeth Winiartati, Managing Consultant, Head of Global Integrated Communications; Lydia Aprina, Account Manager, Integrated Marketing and Communications; Nita Prabowo, Account Manager, Integrated Marketing and Communications; Okhi, Web Developer, PNTR Group (ID), Kei Obusan, Insights Director; Daffi Ranandi, Insights Manager, Radarr (SG), Gautam Reghunath, Co-founder & CEO, Talented (IN), Donagh Humphreys, Head of Social and Digital Innovation, THINKHOUSE (IRE), Sarah Yim, Strategy Director, Zulu Alpha Kilo (CA).
Trends In Paid Search: Navigating The Digital Landscape In 2024Search Engine Journal
The search marketing landscape is evolving rapidly with new technologies, and professionals, like you, rely on innovative paid search strategies to meet changing demands.
It’s important that you’re ready to implement new strategies in 2024.
Check this out and learn the top trends in paid search advertising that are expected to gain traction, so you can drive higher ROI more efficiently in 2024.
You’ll learn:
- The latest trends in AI and automation, and what this means for an evolving paid search ecosystem.
- New developments in privacy and data regulation.
- Emerging ad formats that are expected to make an impact next year.
Watch Sreekant Lanka from iQuanti and Irina Klein from OneMain Financial as they dive into the future of paid search and explore the trends, strategies, and technologies that will shape the search marketing landscape.
If you’re looking to assess your paid search strategy and design an industry-aligned plan for 2024, then this webinar is for you.
5 Public speaking tips from TED - Visualized summarySpeakerHub
From their humble beginnings in 1984, TED has grown into the world’s most powerful amplifier for speakers and thought-leaders to share their ideas. They have over 2,400 filmed talks (not including the 30,000+ TEDx videos) freely available online, and have hosted over 17,500 events around the world.
With over one billion views in a year, it’s no wonder that so many speakers are looking to TED for ideas on how to share their message more effectively.
The article “5 Public-Speaking Tips TED Gives Its Speakers”, by Carmine Gallo for Forbes, gives speakers five practical ways to connect with their audience, and effectively share their ideas on stage.
Whether you are gearing up to get on a TED stage yourself, or just want to master the skills that so many of their speakers possess, these tips and quotes from Chris Anderson, the TED Talks Curator, will encourage you to make the most impactful impression on your audience.
See the full article and more summaries like this on SpeakerHub here: https://speakerhub.com/blog/5-presentation-tips-ted-gives-its-speakers
See the original article on Forbes here:
http://www.forbes.com/forbes/welcome/?toURL=http://www.forbes.com/sites/carminegallo/2016/05/06/5-public-speaking-tips-ted-gives-its-speakers/&refURL=&referrer=#5c07a8221d9b
ChatGPT and the Future of Work - Clark Boyd Clark Boyd
Everyone is in agreement that ChatGPT (and other generative AI tools) will shape the future of work. Yet there is little consensus on exactly how, when, and to what extent this technology will change our world.
Businesses that extract maximum value from ChatGPT will use it as a collaborative tool for everything from brainstorming to technical maintenance.
For individuals, now is the time to pinpoint the skills the future professional will need to thrive in the AI age.
Check out this presentation to understand what ChatGPT is, how it will shape the future of work, and how you can prepare to take advantage.
A brief introduction to DataScience with explaining of the concepts, algorithms, machine learning, supervised and unsupervised learning, clustering, statistics, data preprocessing, real-world applications etc.
It's part of a Data Science Corner Campaign where I will be discussing the fundamentals of DataScience, AIML, Statistics etc.
Time Management & Productivity - Best PracticesVit Horky
Here's my presentation on by proven best practices how to manage your work time effectively and how to improve your productivity. It includes practical tips and how to use tools such as Slack, Google Apps, Hubspot, Google Calendar, Gmail and others.
The six step guide to practical project managementMindGenius
The six step guide to practical project management
If you think managing projects is too difficult, think again.
We’ve stripped back project management processes to the
basics – to make it quicker and easier, without sacrificing
the vital ingredients for success.
“If you’re looking for some real-world guidance, then The Six Step Guide to Practical Project Management will help.”
Dr Andrew Makar, Tactical Project Management
3. Overview
• De Bruijn Graph
• Velvet
• Theory
• Practice
• Data formats and quality
• Velvet
• Simulation data
• Multiple insert lengths
• Curtain
• Theory
• Practice
3 25.04.11 Velvet / Curtain
4. De Bruijn graph
• A concept in combinatorial mathematics
• In combinatorics, de bruijn graph is usually fully connected
• http://en.wikipedia.org/wiki/De_Bruijn_graph
• de bruijn sequence
• Related concept
• Path through graph
• Velvet
• de Bruijn inspired graph structure
4 25.04.11 Velvet / Curtain
5. De Bruijn graph (Velvet)
• Representation of
• a sequence based on short words (k-mers)
• overlaps between words
• K-mer: word of length k
• K=5
GCCTTCCA
• k-1 overlap
GCCTT GCCTT GCCTT
CCTTC CCTTC CCTTC
CTTCC CTTCC
TTCCA
...
GCCTTCCA GCCTTCCA GCCTTCCA
5 25.04.11 Velvet / Curtain
6. De Bruijn graph (Velvet)
GCCTTCCAATTT
GCCTTCAAATTT
C A
CTTC TTCC .....
CAATT
T
CCT TC
G CT
C AATTT
A A
CTTC TTCA ..... AAATT
6 25.04.11 Velvet / Curtain
20. Example
After simplification…
GATT
AGAT
GATCCGATGAG AGAA
GCTCTAG
TAGTCGA CGAG
GAGGCT GGCT TAGA AGAGA AGACAG
GCTTTAG
CGACGC
20 25.04.11 Velvet / Curtain
21. Example
Tips removed…
AGAT
GATCCGATGAG
GCTCTAG
TAGTCGA CGAG
GAGGCT GGCT TAGA AGAGA AGACAG
GCTTTAG
21 25.04.11 Velvet / Curtain
22. De Bruijn graph biology extensions (Velvet)
• Handling of reverse strand
• DNA is read in two directions
• Paired-end data
• Handling small differences, which are “uninteresting”
• Errors in sequencing technology
• Memory
• regularly use 80, 100GB real memory
• easily get to 1TB real memory requirements
22 25.04.11 Velvet / Curtain
23. Read variety
• Short reads ~75bp
• Illumina / Solexa
• SOLiD (colour space)
• Long reads 500-1000 bp
• 454 read
• Sanger capillary reads
• Paired-end reads
• Short reads
• short insert length
• Mate pair reads
• Short reads
• long insert length
23 25.04.11 Velvet / Curtain
29. Example
Bubbles removed… by TourBus
AGAT
GATCCGATGAG
TAGTCGA CGAG
GAGGCT GGCT GCTTTAG TAGA AGAGA AGACAG
29 25.04.11 Velvet / Curtain
30. Example
Final simplification…
AGATCCGATGAG
TAGTCGAG GAGGCTTTAGA AGAGACAG
30 25.04.11 Velvet / Curtain
31. Example
TAGTCGAGGCTTTAGATCCGATGAGGCTTTAGAGACAG
Final simplification…
AGATCCGATGAG
TAGTCGAG GAGGCTTTAGA AGAGACAG
One possible walk through the graph ...
TAGTCGAG
GAGGCTTTAGA
AGATCCGATGAG
GAGGCTTTAGA
AGAGACAG
31 25.04.11 Velvet / Curtain
34. N50
• N50 is the length of the smallest contig
• contains the fewest (largest) contigs
• combined length represents at least 50% of the assembly
• N10
• > 10 % of the largest contigs
http://www.broadinstitute.org/crd/wiki/index.php/N50
34 25.04.11 Velvet / Curtain
35. Velvet practical: Part 1
• Compile
• Single end (ERX001300)
• K-mer length
• Coverage cut-offs
• Whole genome sequence as input???
• Staphylococcus aureus MRSA252
35 25.04.11 Velvet / Curtain
36. Velvet algorithms
• Long read information
• Rock Band
• Velvet parameters
• -long_mult_cutoff
36 25.04.11 Velvet / Curtain
37. Velvet algorithms
• Paired-end information
• Pebble
• Velvet parameters
• -min_pair_count
Once all distances and variance computed,
Simple greedy extension from main contigs out
37 25.04.11 Velvet / Curtain
38. Paired-end in Velvet
• Hugely improves quality of assembly
• Insert length greater than repeat
• greater than the length of the most common genomic repeat
• Mixed insert length improves results
• Short: helps for local assembly
• Long: get over repeats
• Large genomes
• Very memory intensive
• Calculation intensive
38 25.04.11 Velvet / Curtain
41. Quality score
• Velvet does NOT use quality score!!!
• Error correction of de Bruijn graph
• p
• the probability that the corresponding base call is incorrect
• Phred quality score
• 10 -> 1 in 10
• 40 -> 1 in 10,000.
• Odds ratio
• earlier versions of solexa pipeline
• differs mainly at lower levels
41 25.04.11 Velvet / Curtain
42. Quality encoding
• !''*((((***+))%%%
• One value per base
• Integer mapping based on ASCII encoding
• probability of incorrect base call
• Sanger format • Illumina 1.5+
• Phred score • Phred score
• ASCII 33 – 126 -> 0 – 93 • ASCII 59 – 126 -> -5 – 62
• Rarely exceeds 60 • Only 2 – 40 expected
• ! = 33 -> 0 • ! = 33 -> (does not exist)
• b = 66 -> 33 • b = 66 -> 2
42 25.04.11 Velvet / Curtain
47. Velvet modules
• Columbus (since Velvet 1.0)
• use reference sequence
• assist with alignment information
• local re-sequencing
• structural variants
47 25.04.11 Velvet / Curtain
48. Velvet modules
• Oases
• De novo transcriptome assembler
• uses preliminary Velvet assembly
• clusters contigs into loci
• construct transcript isoforms using paired-end / long read
information
• confidence score: describes uniqueness of a transcript in a locus
48 25.04.11 Velvet / Curtain
49. Read Simulation - Why?
• Controlling the data
• Contamination
• Coverage distribution
• Sequencing errors
• Genome size
• Insert length
• Insert length distribution
49 25.04.11 Velvet / Curtain
54. Curtain
• assembly pipeline
• Paired-end assembly for large genomes
• Group related Contigs
• Uses velvet to assemble groups of related reads
• Iterative approach
54 25.04.11 Velvet / Curtain
55. Curtain
Genome assembly Pipeline
Curtain
Contigs
Map Group Fill
Assemble Collect
Reads Contigs Bins
55 25.04.11 Velvet / Curtain
56. Curtain
Curtain Contigs
Map Group Fill
AssembleCollect
Reads Contigs Bins
• Set of input Contigs
• Use established assemblers
• Velvet unpaired
• Cortex
• SGA
• ...
56 25.04.11 Velvet / Curtain
57. Curtain
Curtain Contigs
Map Group Fill AssembleCollect
Reads Contigs Bins
• Map reads to input contigs
• SAM file support
• bwa
• maq
57 25.04.11 Velvet / Curtain
58. Curtain
Curtain Contigs
Map Group Fill AssembleCollect
Reads Contigs Bins
• Group Contigs using Paired-end information
1 2 3 4 5
bin mapping read & read pair
58 25.04.11 Velvet / Curtain
59. Curtain
Curtain Contigs
Map Group Fill
Reads Contigs Bins AssembleCollect
• Assemble each bin
• Run velvet using paired-end information
• bin specific parameters
• Run each bin individually velvet
• Highly parallelizable
• Collect results
• Start next iteration ………………….
Results
59 25.04.11 Velvet / Curtain
60. Curtain
• Low memory footprint
• Scalable for large genomes
• Make use of cluster
• Available
• www.ebi.ac.uk/egt
• http://code.google.com/p/curtain/
• Future announcements
• http://groups.google.com/group/curtain-assembler
• Future work
• Long read support
60 25.04.11 Velvet / Curtain
61. Curtain practical
• Run Curtain for Staphylococcus
• Simulation data
61 25.04.11 Velvet / Curtain