Matthew Yachts, Inc.Matthew Yachts, located in Montauk, Lo.docxalfredacavx97
Matthew Yachts, Inc.
Matthew Yachts, located in Montauk, Long Island, manufactured sailing yachts of all
descriptions. The company had begun by building custom-designed yachts for a largely New
York-based clientele. Custom-designed yachts still accounted for three-fifths of Matthew’s unit
sales and four-fifths of its dollar sales and earnings. Over the years, as Matthew Yachts’
reputation for quality design and workmanship spread, sales broadened to cover all of the
eastern seaboard.
In an effort to capitalize on this increased recognition and to secure a piece of the fastest
growing market in sailing, Matthew Yachts began manufacturing a new standard, fixed-design
craft. Matthew attacked only the high end of this market, as the boat measured 37 feet long.
Nevertheless, even this end of the market was more price-sensitive and less conscious of
performance than Matthew Yacht’s custom-design customers were.
All of the company’s yachts were manufactured at the Montauk plant and shared the
same equipment and skilled labor force. Custom designs were given priority in scheduling, and
the new boat was rotated into the schedule only when demand slackened. As sales of the fixed-
design boat increased, however, scheduling the new boat on a regular basis became
necessary.
Matthew Yachts were built basically from the bottom up. Fabricating hulls was the first
step. Increasingly, fiberglass hulls were demanded for their speed and easy maintenance.
Afterward came the below-deck woodworking, followed by the fiberglass and woodworking on
the deck itself. The masts were turned and drilled separately. Masts and hull were then joined
and the finish work completed.
Over the past year, as the fixed-design craft continued its steady increase in sales, costs
and deliveries began to slide precipitously, especially on the fixed-design yachts. During this
period, when push came to shove, construction of the fixed-design craft always yielded time and
resources to the higher-profit-margin custom designs. As a result, many fixed-design yachts
were strewn around the yard in various stages of construction. Moreover, space in the existing
shipyard was becoming scarce, and a plant expansion of one sort or another appeared
inevitable.
Case Questions
1. Should Matthew Yachts, Inc. stay in the business of building standard, fixed-design
yachts? Why or why not?
2. Describe what the company should do to improve their processes were they are to
remain in this business?
Note: Be specific when answering these questions and use information provided in the
context of this learning module.
T
o fully implement evidence-
based practice (EBP),
nurses need to have both
a spirit of inquiry and a culture
that supports it. Inour first article
in this series (“Igniting a Spirit of
Inquiry:AnEssential Foundation
for Evidence-Based Practice,”
November 2009),we defined a
spirit of inquiry as “an ongoing
curiosity about the best evidence
toguide clinic.
Formal Essays - 9+ Examples, Format, Sample | Examples. 23+ Profile Essay Examples On A Person Tips - scholarship. How to Write a Profile Essay? Profile Essay Example, Tips & More.
Reproducibility, preregistration, etc.: Making good science even betterAlex Holcombe
Reproducibility problems afflict many sciences, including psychology. The problems are, to some extent, rooted in the criteria for and process of scientific publication. In response, many journals, funders and professional societies have begun incentivising change. For example, study preregistration, although traditionally used only by clinical trials researchers, is becoming more common. In this seminar, you will learn how it is now used even in basic experimental psychology, and how you can take advantage of preregistration and other new practices to smooth your path to publication and dissemination of your work. Bring your laptop (optional), walk with me through preregistering a study, and also learn how sites such as Open Science Framework facilitate project management and collaboration. One object of this seminar is to spark discussion of how we can all make our already wonderful system of science even better.
Matthew Yachts, Inc.Matthew Yachts, located in Montauk, Lo.docxalfredacavx97
Matthew Yachts, Inc.
Matthew Yachts, located in Montauk, Long Island, manufactured sailing yachts of all
descriptions. The company had begun by building custom-designed yachts for a largely New
York-based clientele. Custom-designed yachts still accounted for three-fifths of Matthew’s unit
sales and four-fifths of its dollar sales and earnings. Over the years, as Matthew Yachts’
reputation for quality design and workmanship spread, sales broadened to cover all of the
eastern seaboard.
In an effort to capitalize on this increased recognition and to secure a piece of the fastest
growing market in sailing, Matthew Yachts began manufacturing a new standard, fixed-design
craft. Matthew attacked only the high end of this market, as the boat measured 37 feet long.
Nevertheless, even this end of the market was more price-sensitive and less conscious of
performance than Matthew Yacht’s custom-design customers were.
All of the company’s yachts were manufactured at the Montauk plant and shared the
same equipment and skilled labor force. Custom designs were given priority in scheduling, and
the new boat was rotated into the schedule only when demand slackened. As sales of the fixed-
design boat increased, however, scheduling the new boat on a regular basis became
necessary.
Matthew Yachts were built basically from the bottom up. Fabricating hulls was the first
step. Increasingly, fiberglass hulls were demanded for their speed and easy maintenance.
Afterward came the below-deck woodworking, followed by the fiberglass and woodworking on
the deck itself. The masts were turned and drilled separately. Masts and hull were then joined
and the finish work completed.
Over the past year, as the fixed-design craft continued its steady increase in sales, costs
and deliveries began to slide precipitously, especially on the fixed-design yachts. During this
period, when push came to shove, construction of the fixed-design craft always yielded time and
resources to the higher-profit-margin custom designs. As a result, many fixed-design yachts
were strewn around the yard in various stages of construction. Moreover, space in the existing
shipyard was becoming scarce, and a plant expansion of one sort or another appeared
inevitable.
Case Questions
1. Should Matthew Yachts, Inc. stay in the business of building standard, fixed-design
yachts? Why or why not?
2. Describe what the company should do to improve their processes were they are to
remain in this business?
Note: Be specific when answering these questions and use information provided in the
context of this learning module.
T
o fully implement evidence-
based practice (EBP),
nurses need to have both
a spirit of inquiry and a culture
that supports it. Inour first article
in this series (“Igniting a Spirit of
Inquiry:AnEssential Foundation
for Evidence-Based Practice,”
November 2009),we defined a
spirit of inquiry as “an ongoing
curiosity about the best evidence
toguide clinic.
Formal Essays - 9+ Examples, Format, Sample | Examples. 23+ Profile Essay Examples On A Person Tips - scholarship. How to Write a Profile Essay? Profile Essay Example, Tips & More.
Reproducibility, preregistration, etc.: Making good science even betterAlex Holcombe
Reproducibility problems afflict many sciences, including psychology. The problems are, to some extent, rooted in the criteria for and process of scientific publication. In response, many journals, funders and professional societies have begun incentivising change. For example, study preregistration, although traditionally used only by clinical trials researchers, is becoming more common. In this seminar, you will learn how it is now used even in basic experimental psychology, and how you can take advantage of preregistration and other new practices to smooth your path to publication and dissemination of your work. Bring your laptop (optional), walk with me through preregistering a study, and also learn how sites such as Open Science Framework facilitate project management and collaboration. One object of this seminar is to spark discussion of how we can all make our already wonderful system of science even better.
FREE 6+ Descriptive Essay Samples in PDF. ⚡ How do you define yourself essay. How others perceive you, and how .... How To Start A Descriptive Essay – Telegraph. Assignment 3: Self Description Essay - Activity 3: Self= Description .... My personal descriptive essays. Descriptive Essay Examples College. Narrative Essay: My self essay in english for university students. 014 Essay Example Descriptive Person Writing First Sample About Pdf Sca .... FREE 9+ Descriptive Essay Examples in PDF | Examples. School essay: Self descriptive essay. 30 Sample Of Descriptive Essay | Example Document Template. Descriptive Narrative Essay Example Lovely 23 Free Essay Examples .... Descriptive Essay Writing: Person, Event Celebration | Descriptive .... Descriptive Words: 700+ Describing Words in English (with Useful .... 008 How To Write Essay About Yourself Describing Myself Sample For .... 024 Essay Example Of Descriptive Examples Paragraphs And Chart ~ Thatsnotus. Essay Describing Yourself Examples – Telegraph. School essay: Example of descriptive essay about yourself. School essay: Example of descriptive paragraph about yourself. 002 Essay Example Maxresdefault Narrative ~ Thatsnotus. School Essay: Descriptive essays on a person. 008 Essay Example Describing Yourself As Student On Describe Writing An .... 026 Describe Yourself Essay Example Introduce Myself Scholarship Sample .... 020 Describe Yourself Essay Example Poem 30 Fabulous Old Broad ~ Thatsnotus. Descriptive Essay Introduction Sample | Templates at .... College Essay: Short descriptive essay sample pdf. Descriptive Essay – 6+ Free Samples, Examples, Format Download. Descriptive Essay Template - 8+ Free Word, PDF Documents Download. Awesome Describe Yourself Essay ~ Thatsnotus.
Running Head Evidence based Practice, Step by Step Asking the Cl.docxtodd271
Running Head: Evidence based Practice, Step by Step: Asking the Clinical Question: A Key Step in Evidence based Practice 1
Evidence based Practice, Step by Step: Asking the Clinical Question: A Key Step in Evidence based Practice 9
Please review APA for header sections for the title page and subsequent pages. Thanks.
Evidence based Practice, Step by Step: Asking the Clinical Question: A Key Step in Evidence based Practice Comment by Doreen Farley: Please shorten your title here and in your header section. Thank. In the header section the title cannot be greater than 50 characters including spaces in APA.
Student’s Name:
Institution:
Abstract
The ability to evaluate the advantages of a quantitative setup research article is an essential mastery for authorities and investigators of all controls, including nursing, to judge the uprightness and estimation of the evidence and conclusions made in an article. At the point when all is said in done, this aptitude is customized for a few experts and masters who starting at now have a tolerable working data of investigation logic, including hypothesis headway, assessing frameworks, ponder layout, testing procedures and instrumentation, data social occasion and data organization, estimations, and clarification of revelations. For graduate understudies and junior workforce who still can't seem to confront these capacities, completing a formally made article assess can be a significant methodology to hone such states of mind. Nevertheless, focal data investigation techniques are as yet required remembering the true objective to be viable. Since there are few dispersed instances of assessing outlines, this article gives the sound judgment reasons for coordinating a formally created quantitative investigation article examine while giving a handbag to show the measures and structure. Exactly when passed on in a setting of minding and an unfaltering authoritative culture, the most surprising nature of thought and best patient outcomes can be accomplished. The inspiration driving this plan is given to sustain the data and states of mind they need to execute EBP dependably, with additional consideration. Articles will appear predictably to allow you a chance to intertwine information as you move in the direction of executing EBP at your establishment. Moreover, we've booked "Ask the Authors" call-ins predictably to give a quick line to the pros to enable you to determine questions. Comment by Doreen Farley: This assignment did not call for an abstract. Just your title page, PICOT question and your six articles with abstracts and no reference section.
Type of Clinical Question Comment by Doreen Farley: I am not sure what all of this is. Also, just taking a quick look there is a lot of information in this text that does not have in-text citation. Please take this into account and ensure that when you write your next assignments that all information is correctly cited.
It is important to put .
This bachelor thesis is focused on the relationship between intrinsic and extrinsic motivation and
employee performance. The thesis is a literature research and thus a review by the work of others.
In earlier research on this topic conducted by Vroom (1964) was concluded that a positive
correlation between motivation and performance did not exist. However, later research proved
that it is indeed possible to motivate employees intrinsically and extrinsically to perform well. It
appears that when the organisation provides certain job characteristics, employees can be
motivated to perform well in the organisation. And it also appeared that intrinsic factors have
more effect on the relationship than extrinsic factors.
How to Write a Discussion Essay - Complete Writing Guide. IELTS Discuss Both Views Essay Structure + Sample Answers. How To Write A Discussion Essay — IELTS ACHIEVE. IELTS Discussion essay model answer and analysis.. How to Improve Your Academic Writing with the Right Essay Structure?. How to Structure an Essay: A Guide for College Students. Discursive Essay Structure - Mrs. Wiseman's MYP International English 9. Discussion Essay Discuss both sides and give your opinion essays. How to Write & Structure a Dissertation; A Complete Step by Step Guide. 10 Easy Steps: How to Write a Discussion Essay in 2024. Structure Of Argumentative Essay – Telegraph. Example Discussion Essay. Discussion Essay Structure Worksheets - Get Started. IELTS Discussion Essays – Step-by-Step Instructions – IELTS Jacky. How to structure a discussion essay. Discussion Structure - Studyladder Interactive Learning Games. Discussion essay structure. Essay writing - Understanding essay types. Writing: A discussion essay - Institut Pedraforca English Corner. How to write an essay. Types of questions and structure. Opinion Questions (Agree or Disagree .... 5 Clear and Easy Ways to Write an Academic Essay - wikiHow - IELTS .... History Essay: Structure of essay.
Small Cell Lung Cancer (400 Words) - PHDessay.com. The Causes of Lung Cancer Essay Example | Topics and Well Written .... Causes of lung cancer essay. Fantastic Lung Cancer Research Essay ~ Museumlegs. (PDF) Lung Cancer. Lung cancer uk essay writing - homeworktidy.x.fc2.com. Lung Cancer Policy Term Paper Example | Topics and Well Written Essays .... ≫ Understanding Lung Cancer Free Essay Sample on Samploon.com. Numerous Lung Cancer Cases Worldwide Essay Example | Topics and Well .... Lung cancer research paper writeenglishcheapessay.download. NCCN Non-Small Cell Lung Cancer Guidelines Update (Slides With Transcript). Stage 1 Lung Cancer: Symptoms, Treatment And Life Expectancy - Macs Clinic. Essay on Cancer | Cancer Essay for Students and Children in English - A .... (PDF) MRI in lung cancer: A pictorial essay. Lung cancer biology - sample paper - essay. Lung Cancer Research Paper - Research Paper Examples - EssayEmpire. Introduction lung cancer essay - articlehealthkart.x.fc2.com. Primary lung cancer Essay Example | Topics and Well Written Essays .... The Study of Lung Cancer Essay Example | Topics and Well Written Essays .... What is Lung Cancer Essay Example | Topics and Well Written Essays .... Cause And Effect Essays On Lung Cancer Free Essays. Lung Cancer. Lung cancer introduction essay. Introduction and Conclusion to Cancer .... Top Cancer Essay ~ Thatsnotus. ᐅ Essays On Lung Cancer
Macheo Payne competed his doctoral dissertation in December 2012. This is the final draft copy of his work on suspension of black males and effective practices in the classroom.
1. Use Postman” to test API at httpspostman-echo.coma. UseAbbyWhyte974
1. Use “Postman” to test API at https://postman-echo.com/
a. Use GET, POST, PUT, DELETE methods
b. Use global variables
c. Create test script
d. Import any API from other websites
2. Try to use “Rest Assured” Library to test API at https://reqres.in/ (only for GET and POST methods)
Upload screenshots to the system.
Identifying Data & Reliability
Ms. Jones, a 28-year-old African American
female , is present into the hospital beacuse
of an infected wound on her foot. Her
speech is clear and concise and well-
structured. Throughout the interview, she
maintain eye contact while freely sharing
information.
N/A
General Survey
Ms. Jones is stting upright on the exam
table, alert and oriented x3, friendly and well
nourished. She is calm and appropriately
dressed for the weather.
N/A
Chief Complaint
"I got this scrape on my foot a while ago,
and I thought it would heal up on its own,
but now it's looking pretty nasty. And the
pain is killing me!"
N/A
History Of Present Illness
One week ago, Ms. Tina was going down
her steps with no shoes and stumbled
scratching her right foot on the edge of the
step and was taken to the emergency room
by her mother where an x-ray was
performed and the site showed no
abnormality. They cleaned her injuries and
Tremadol was reccomended for pain and
she was told to remain off of her foot and to
keep it very clean and dry at all times as she
was realeased home. her foot became
swollen 2 days aglo as the pain exacerbated
and she saw grayish whte pus draining from
the wound and that is when she started
taking Tramadol. She rated her agony of
pain as a 7 out of 10 on her wounded foot
nevertheless; she says it emanates to her
whole foot and that there was drainage
initially when the episode previoulsy began.
Ms. Tina has been cleaning the injury with
cleanser and soap and applying Neosporin
to the wound two times each day and
occasionaly applied peroxide. The pain was
depicted as throbbing and very still and
sometimes sharp shooting pain or torment
when she puts weight on her foot. She can
not accomadate her tennis shoes on her
right foot so she had been wearing flip
tumbles or slippers everyday. The pai pills
have eased the excruciating pain for few
hours and she reported having fever. She
has lost 10 pounds in barley a month
accidentally and has work for two days as
she reported. She denied any ongoing
sickness and feels hungrier than expected.
Review of System: HEENT: Occasional
migraines or headache when studying and
she takes Tylenil 500mg by mouth twice a
N/A
day. Ms. Tina reports more awful vision in
the course of recent months ands no
contact or restorative lenses. She denies
any congestions, hearing problem or soar
throat however, she admits infrequent
running nose. Neurological: Occasional
migrain revealed, no dizziness, syncope,
loss of motivation, ataxia, loss of tingling in
her extremities or furthest point.
Respiratory: No brevity or shortness of
breath, hac k or cough or sputum.
Cardiovasc ...
1. Use the rubric to complete the assignment and pay attention tAbbyWhyte974
1. Use the rubric to complete the assignment and pay attention to the points assigned to each section of the paper.
2. Use the format of the paper to organize your paper.
3. Use the samples of essay critiques as guidelines when completing this assignment.
4. Students are asked to critique Jules Ferry’s French Colonial Expansion, not to write a paper about Jules Ferry.
5. Identify a fact (see rubric) means that you take a sentence or paragraph in the assigned reading that you find very interesting and cite it as highlighted in yellow in the samples of primary papers and analyze it. In other words, you come up with your own interpretation of that fact.
6. Do not summarize the five facts but instead quote them as written in the assigned reading and highlighted in yellow in the samples of papers.
Jules Ferry (1832-1893):
On French Colonial Expansion
Ferry was twice prime minister of France, from [1880-1881, 1883-1885]. He is especially remembered for
championing laws that removed Catholic influence from most education in France and for promoting a vast extension
of the French colonial empire.
The policy of colonial expansion is a political and economic system ... that can be connected to three sets of ideas:
economic ideas; the most far-reaching ideas of civilization; and ideas of a political and patriotic sort.
In the area of economics, I am placing before you, with the support of some statistics, the considerations that justify
the policy of colonial expansion, as seen from the perspective of a need, felt more and more urgently by the
industrialized population of Europe and especially the people of our rich and hardworking country of France: the need
for outlets [for exports]. Is this a fantasy? Is this a concern [that can wait] for the future? Or is this not a pressing
need, one may say a crying need, of our industrial population? I merely express in a general way what each one of
you can see for himself in the various parts of France. Yes, what our major industries [textiles, etc.], irrevocably
steered by the treaties of 18601 into exports, lack more and more are outlets. Why? Because next door Germany is
setting up trade barriers; because across the ocean the United States of America have become protectionists, and
extreme protectionists at that; because not only are these great markets ... shrinking, becoming more and more
difficult of access, but these great states are beginning to pour into our own markets products not seen there before.
This is true not only for our agriculture, which has been so sorely tried ... and for which competition is no longer
limited to the circle of large European states.... Today, as you know, competition, the law of supply and demand,
freedom of trade, the effects of speculation, all radiate in a circle that reaches to the ends of the earth.... That is a
great complication, a great economic difficulty; ... an extremely serious problem. It is so serious ...
More Related Content
Similar to 1 Dissertation Manuscript Submitted to North
FREE 6+ Descriptive Essay Samples in PDF. ⚡ How do you define yourself essay. How others perceive you, and how .... How To Start A Descriptive Essay – Telegraph. Assignment 3: Self Description Essay - Activity 3: Self= Description .... My personal descriptive essays. Descriptive Essay Examples College. Narrative Essay: My self essay in english for university students. 014 Essay Example Descriptive Person Writing First Sample About Pdf Sca .... FREE 9+ Descriptive Essay Examples in PDF | Examples. School essay: Self descriptive essay. 30 Sample Of Descriptive Essay | Example Document Template. Descriptive Narrative Essay Example Lovely 23 Free Essay Examples .... Descriptive Essay Writing: Person, Event Celebration | Descriptive .... Descriptive Words: 700+ Describing Words in English (with Useful .... 008 How To Write Essay About Yourself Describing Myself Sample For .... 024 Essay Example Of Descriptive Examples Paragraphs And Chart ~ Thatsnotus. Essay Describing Yourself Examples – Telegraph. School essay: Example of descriptive essay about yourself. School essay: Example of descriptive paragraph about yourself. 002 Essay Example Maxresdefault Narrative ~ Thatsnotus. School Essay: Descriptive essays on a person. 008 Essay Example Describing Yourself As Student On Describe Writing An .... 026 Describe Yourself Essay Example Introduce Myself Scholarship Sample .... 020 Describe Yourself Essay Example Poem 30 Fabulous Old Broad ~ Thatsnotus. Descriptive Essay Introduction Sample | Templates at .... College Essay: Short descriptive essay sample pdf. Descriptive Essay – 6+ Free Samples, Examples, Format Download. Descriptive Essay Template - 8+ Free Word, PDF Documents Download. Awesome Describe Yourself Essay ~ Thatsnotus.
Running Head Evidence based Practice, Step by Step Asking the Cl.docxtodd271
Running Head: Evidence based Practice, Step by Step: Asking the Clinical Question: A Key Step in Evidence based Practice 1
Evidence based Practice, Step by Step: Asking the Clinical Question: A Key Step in Evidence based Practice 9
Please review APA for header sections for the title page and subsequent pages. Thanks.
Evidence based Practice, Step by Step: Asking the Clinical Question: A Key Step in Evidence based Practice Comment by Doreen Farley: Please shorten your title here and in your header section. Thank. In the header section the title cannot be greater than 50 characters including spaces in APA.
Student’s Name:
Institution:
Abstract
The ability to evaluate the advantages of a quantitative setup research article is an essential mastery for authorities and investigators of all controls, including nursing, to judge the uprightness and estimation of the evidence and conclusions made in an article. At the point when all is said in done, this aptitude is customized for a few experts and masters who starting at now have a tolerable working data of investigation logic, including hypothesis headway, assessing frameworks, ponder layout, testing procedures and instrumentation, data social occasion and data organization, estimations, and clarification of revelations. For graduate understudies and junior workforce who still can't seem to confront these capacities, completing a formally made article assess can be a significant methodology to hone such states of mind. Nevertheless, focal data investigation techniques are as yet required remembering the true objective to be viable. Since there are few dispersed instances of assessing outlines, this article gives the sound judgment reasons for coordinating a formally created quantitative investigation article examine while giving a handbag to show the measures and structure. Exactly when passed on in a setting of minding and an unfaltering authoritative culture, the most surprising nature of thought and best patient outcomes can be accomplished. The inspiration driving this plan is given to sustain the data and states of mind they need to execute EBP dependably, with additional consideration. Articles will appear predictably to allow you a chance to intertwine information as you move in the direction of executing EBP at your establishment. Moreover, we've booked "Ask the Authors" call-ins predictably to give a quick line to the pros to enable you to determine questions. Comment by Doreen Farley: This assignment did not call for an abstract. Just your title page, PICOT question and your six articles with abstracts and no reference section.
Type of Clinical Question Comment by Doreen Farley: I am not sure what all of this is. Also, just taking a quick look there is a lot of information in this text that does not have in-text citation. Please take this into account and ensure that when you write your next assignments that all information is correctly cited.
It is important to put .
This bachelor thesis is focused on the relationship between intrinsic and extrinsic motivation and
employee performance. The thesis is a literature research and thus a review by the work of others.
In earlier research on this topic conducted by Vroom (1964) was concluded that a positive
correlation between motivation and performance did not exist. However, later research proved
that it is indeed possible to motivate employees intrinsically and extrinsically to perform well. It
appears that when the organisation provides certain job characteristics, employees can be
motivated to perform well in the organisation. And it also appeared that intrinsic factors have
more effect on the relationship than extrinsic factors.
How to Write a Discussion Essay - Complete Writing Guide. IELTS Discuss Both Views Essay Structure + Sample Answers. How To Write A Discussion Essay — IELTS ACHIEVE. IELTS Discussion essay model answer and analysis.. How to Improve Your Academic Writing with the Right Essay Structure?. How to Structure an Essay: A Guide for College Students. Discursive Essay Structure - Mrs. Wiseman's MYP International English 9. Discussion Essay Discuss both sides and give your opinion essays. How to Write & Structure a Dissertation; A Complete Step by Step Guide. 10 Easy Steps: How to Write a Discussion Essay in 2024. Structure Of Argumentative Essay – Telegraph. Example Discussion Essay. Discussion Essay Structure Worksheets - Get Started. IELTS Discussion Essays – Step-by-Step Instructions – IELTS Jacky. How to structure a discussion essay. Discussion Structure - Studyladder Interactive Learning Games. Discussion essay structure. Essay writing - Understanding essay types. Writing: A discussion essay - Institut Pedraforca English Corner. How to write an essay. Types of questions and structure. Opinion Questions (Agree or Disagree .... 5 Clear and Easy Ways to Write an Academic Essay - wikiHow - IELTS .... History Essay: Structure of essay.
Small Cell Lung Cancer (400 Words) - PHDessay.com. The Causes of Lung Cancer Essay Example | Topics and Well Written .... Causes of lung cancer essay. Fantastic Lung Cancer Research Essay ~ Museumlegs. (PDF) Lung Cancer. Lung cancer uk essay writing - homeworktidy.x.fc2.com. Lung Cancer Policy Term Paper Example | Topics and Well Written Essays .... ≫ Understanding Lung Cancer Free Essay Sample on Samploon.com. Numerous Lung Cancer Cases Worldwide Essay Example | Topics and Well .... Lung cancer research paper writeenglishcheapessay.download. NCCN Non-Small Cell Lung Cancer Guidelines Update (Slides With Transcript). Stage 1 Lung Cancer: Symptoms, Treatment And Life Expectancy - Macs Clinic. Essay on Cancer | Cancer Essay for Students and Children in English - A .... (PDF) MRI in lung cancer: A pictorial essay. Lung cancer biology - sample paper - essay. Lung Cancer Research Paper - Research Paper Examples - EssayEmpire. Introduction lung cancer essay - articlehealthkart.x.fc2.com. Primary lung cancer Essay Example | Topics and Well Written Essays .... The Study of Lung Cancer Essay Example | Topics and Well Written Essays .... What is Lung Cancer Essay Example | Topics and Well Written Essays .... Cause And Effect Essays On Lung Cancer Free Essays. Lung Cancer. Lung cancer introduction essay. Introduction and Conclusion to Cancer .... Top Cancer Essay ~ Thatsnotus. ᐅ Essays On Lung Cancer
Macheo Payne competed his doctoral dissertation in December 2012. This is the final draft copy of his work on suspension of black males and effective practices in the classroom.
Similar to 1 Dissertation Manuscript Submitted to North (20)
1. Use Postman” to test API at httpspostman-echo.coma. UseAbbyWhyte974
1. Use “Postman” to test API at https://postman-echo.com/
a. Use GET, POST, PUT, DELETE methods
b. Use global variables
c. Create test script
d. Import any API from other websites
2. Try to use “Rest Assured” Library to test API at https://reqres.in/ (only for GET and POST methods)
Upload screenshots to the system.
Identifying Data & Reliability
Ms. Jones, a 28-year-old African American
female , is present into the hospital beacuse
of an infected wound on her foot. Her
speech is clear and concise and well-
structured. Throughout the interview, she
maintain eye contact while freely sharing
information.
N/A
General Survey
Ms. Jones is stting upright on the exam
table, alert and oriented x3, friendly and well
nourished. She is calm and appropriately
dressed for the weather.
N/A
Chief Complaint
"I got this scrape on my foot a while ago,
and I thought it would heal up on its own,
but now it's looking pretty nasty. And the
pain is killing me!"
N/A
History Of Present Illness
One week ago, Ms. Tina was going down
her steps with no shoes and stumbled
scratching her right foot on the edge of the
step and was taken to the emergency room
by her mother where an x-ray was
performed and the site showed no
abnormality. They cleaned her injuries and
Tremadol was reccomended for pain and
she was told to remain off of her foot and to
keep it very clean and dry at all times as she
was realeased home. her foot became
swollen 2 days aglo as the pain exacerbated
and she saw grayish whte pus draining from
the wound and that is when she started
taking Tramadol. She rated her agony of
pain as a 7 out of 10 on her wounded foot
nevertheless; she says it emanates to her
whole foot and that there was drainage
initially when the episode previoulsy began.
Ms. Tina has been cleaning the injury with
cleanser and soap and applying Neosporin
to the wound two times each day and
occasionaly applied peroxide. The pain was
depicted as throbbing and very still and
sometimes sharp shooting pain or torment
when she puts weight on her foot. She can
not accomadate her tennis shoes on her
right foot so she had been wearing flip
tumbles or slippers everyday. The pai pills
have eased the excruciating pain for few
hours and she reported having fever. She
has lost 10 pounds in barley a month
accidentally and has work for two days as
she reported. She denied any ongoing
sickness and feels hungrier than expected.
Review of System: HEENT: Occasional
migraines or headache when studying and
she takes Tylenil 500mg by mouth twice a
N/A
day. Ms. Tina reports more awful vision in
the course of recent months ands no
contact or restorative lenses. She denies
any congestions, hearing problem or soar
throat however, she admits infrequent
running nose. Neurological: Occasional
migrain revealed, no dizziness, syncope,
loss of motivation, ataxia, loss of tingling in
her extremities or furthest point.
Respiratory: No brevity or shortness of
breath, hac k or cough or sputum.
Cardiovasc ...
1. Use the rubric to complete the assignment and pay attention tAbbyWhyte974
1. Use the rubric to complete the assignment and pay attention to the points assigned to each section of the paper.
2. Use the format of the paper to organize your paper.
3. Use the samples of essay critiques as guidelines when completing this assignment.
4. Students are asked to critique Jules Ferry’s French Colonial Expansion, not to write a paper about Jules Ferry.
5. Identify a fact (see rubric) means that you take a sentence or paragraph in the assigned reading that you find very interesting and cite it as highlighted in yellow in the samples of primary papers and analyze it. In other words, you come up with your own interpretation of that fact.
6. Do not summarize the five facts but instead quote them as written in the assigned reading and highlighted in yellow in the samples of papers.
Jules Ferry (1832-1893):
On French Colonial Expansion
Ferry was twice prime minister of France, from [1880-1881, 1883-1885]. He is especially remembered for
championing laws that removed Catholic influence from most education in France and for promoting a vast extension
of the French colonial empire.
The policy of colonial expansion is a political and economic system ... that can be connected to three sets of ideas:
economic ideas; the most far-reaching ideas of civilization; and ideas of a political and patriotic sort.
In the area of economics, I am placing before you, with the support of some statistics, the considerations that justify
the policy of colonial expansion, as seen from the perspective of a need, felt more and more urgently by the
industrialized population of Europe and especially the people of our rich and hardworking country of France: the need
for outlets [for exports]. Is this a fantasy? Is this a concern [that can wait] for the future? Or is this not a pressing
need, one may say a crying need, of our industrial population? I merely express in a general way what each one of
you can see for himself in the various parts of France. Yes, what our major industries [textiles, etc.], irrevocably
steered by the treaties of 18601 into exports, lack more and more are outlets. Why? Because next door Germany is
setting up trade barriers; because across the ocean the United States of America have become protectionists, and
extreme protectionists at that; because not only are these great markets ... shrinking, becoming more and more
difficult of access, but these great states are beginning to pour into our own markets products not seen there before.
This is true not only for our agriculture, which has been so sorely tried ... and for which competition is no longer
limited to the circle of large European states.... Today, as you know, competition, the law of supply and demand,
freedom of trade, the effects of speculation, all radiate in a circle that reaches to the ends of the earth.... That is a
great complication, a great economic difficulty; ... an extremely serious problem. It is so serious ...
1. True or false. Unlike a merchandising business, a manufacturingAbbyWhyte974
1. True or false. Unlike a merchandising business, a manufacturing business uses multiple inventory accounts to reflect the cost of raw materials, partially completed goods, and finished goods.
TRUE
FALSE
2.5 points
QUESTION 2
1. For a manufacturing business, the finished goods inventory account reflects the cost of what?
Shipping
Partially completed goods
Completed goods
Raw materials
2.5 points
QUESTION 3
1. Super Goods, an electronics retailer, purchases $80,000 worth of computers from a manufacturer in Taiwan. The terms of the purchase are FOB shipping point. Freight costs total $9,000. The goods are shipped on June 1 and delivered on June 15. On June 1, which two accounts should be debited by Super Goods in the following journal entry? Date Account Dr. Cr. 6-01-XX 80000.00 9000.00 Accounts Payable 89000.00
Inventory and Freight-out
Accounts Receivable and Freight-out
Inventory and Freight-in
Accounts Receivable and Freight-in
2.5 points
QUESTION 4
1. At the time of shipment, goods that are purchased FOB shipping point are
reported on the seller's balance sheet.
considered the responsibility of the buyer.
designated as freight-out.
categorized as partially completed inventory.
2.5 points
QUESTION 5
1. On February 15, a buyer purchases $30,000 worth of goods from a manufacturer. The manufacturer offers the buyer a 3% discount ($900) if payment for the goods is made within 10 days. The buyer pays for the merchandise on February 20. In a journal entry, the seller should debit ________ and credit ________ for $900.
Sales; Purchase Discounts
Accounts Receivable; Sales
Sales; Accounts Receivable
Accounts Payable; Inventory
2.5 points
QUESTION 6
1. A buyer receives a sales discount from a seller for paying for purchased goods within a specific period of time. In what way does the sales discount affects the buyer?
Reducing freight-in costs
Reducing the cost of inventory
Increasing freight-out costs
Increasing the cost of inventory
2.5 points
QUESTION 7
1. For a manufacturing business, the __________ inventory account reflects the cost of products that have been manufactured and are ready to be sold.
Raw materials
Work-in-process
Freight-in
Finished goods
2.5 points
QUESTION 8
1. Which term refers to goods that a merchandising business purchases and resells?
Inputs
Frieght
Supplies
Inventory
2.5 points
QUESTION 9
1. On February 15, a buyer purchases $10,000 worth of goods from a manufacturer, who spent $5,000 to manufacture the goods. The terms of sale are FOB shipping point, and shipping costs are $800. The goods will be shipped on June 1. The manufacturer must make two journal entries on June 1. In the second journal entry, the manufacturer should debit ________ and credit ________. Date Account Dr. Cr. 6-01-XX Accounts Receivable 10,000.00 Cash 800.00 Sales 10,000.00 Date Account Dr. Cr. 6-01-XX 5,000.00 5,000.00
Cash; Cost of Goods Sold
Cost of Goods Sold; ...
1. Top hedge fund manager Sally Buffit believes that a stock with AbbyWhyte974
1. Top hedge fund manager Sally Buffit believes that a stock with the same market risk as the S&P 500 will sell at year-end at a price of $46. The stock will pay a dividend at year-end of $3.00. Assume that risk-free Treasury securities currently offer an interest rate of 2.4%.
Average rates of return on Treasury bills, government bonds, and common stocks, 1900–2017 (figures in percent per year) are as follows.
Portfolio
Average Annual
Rate of Return (%)
Average Premium (Extra return
versus Treasury bills) (%)
Treasury bills
3.8
Treasury bonds
5.3
1.5
Common stocks
11.5
7.7
a. What is the discount rate on the stock? (Enter your answer as a percent rounded to 2 decimal places.)
b. What price should she be willing to pay for the stock today? (Do not round intermediate calculations. Round your answer to 2 decimal places.)
2. Assume these are the stock market and Treasury bill returns for a 5-year period:
Year
Stock Market Return (%)
T-Bill Return (%)
2013
33.30
0.12
2014
13.20
0.12
2015
−3.50
0.12
2016
14.50
0.07
2017
23.80
0.09
Required:
a. What was the risk premium on common stock in each year?
Year
Risk Premium
2013
%
2014
%
2015
%
2016
%
2017
%
·
b. What was the average risk premium?
Average risk premium
%
c. What was the standard deviation of the risk premium? (Ignore that the estimation is from a sample of data.)
Standard deviation
%
3. A stock is selling today for $50 per share. At the end of the year, it pays a dividend of $2 per share and sells for $59.
Required:
a. What is the total rate of return on the stock?
b. What are the dividend yield and percentage capital gain?
c. Now suppose the year-end stock price after the dividend is paid is $44. What are the dividend yield and percentage capital gain in this case?
4.
You purchase 100 shares of stock for $40 a share. The stock pays a $2 per share dividend at year-end.
a. What is the rate of return on your investment if the end-of-year stock price is (i) $38; (ii) $40; (iii) $46? (Leave no cells blank - be certain to enter "0" wherever required. Enter your answers as a whole percent.)
Stock Price
Rate of Return
38
%
40
%
46
%
b. What is your real (inflation-adjusted) rate of return if the inflation rate is 3%? (Do not round intermediate calculations. Enter your answers as a percent rounded to 2 decimal places. Negative amounts should be indicated by a minus sign.)
Stock Price
Real Rate of Return
38
%
40
%
46
%
5. Consider the following scenario analysis:
Rate of Return
Scenario
Probability
Stocks
Bonds
Recession
0.30
−8
%
21
%
Normal economy
0.50
22
%
9
%
Boom
0.20
32
%
9
%
a. Is it reasonable to assume that Treasury bonds will provide higher returns in recessions than in booms?
multiple choice
· No
· Yes
b. Calculate the expected rate of return and standard deviation for each investment. (Do not round intermediate calculations. Enter your answers as a percent rounded to 1 deci ...
1. This question is on the application of the Binomial optionAbbyWhyte974
1. This question is on the application of the Binomial option
pricing model.
PKZ stock is currently trading at 100. Over three-months it will either
go up by 6% or down by 5%. Interest rates are zero.
a. [25 marks] Using a two period binomial model to construct a delta-
hedged portfolio, price a six month European call option on PKZ
stock with a strike price of £105.
b. [3 Marks] Using your answer from the first part, together with the
put-call parity, price a put option on the same stock with same
strike and expiry.
COMP0041 SEE NEXT PAGE
2
2. This question is on the Binomial method in the limit δt → 0.
[40 Marks] The binomial model for pricing options leads to the for-
mula
V (S,t) = e−rδt [qV (US,t + δt) + (1 − q) V (DS,t + δt)]
where
U = eσ
√
δt, D = e−σ
√
δt, q =
erδt −D
U −D
.
V (S,t) is the option value, t is the time, S is the spot price, σ is volatil-
ity and r is the risk-free rate.
By carefully expanding U,D,q as Taylor series in δt or
√
δt (as appro-
priate) and then expanding V (US,t + δt) and V (DS,t + δt) as Taylor
series in both their arguments, deduce that to O (δt) ,
∂V
∂t
+
1
2
σ2S2
∂2V
∂S2
+ rS
∂V
∂S
− rV = 0.
COMP0041 SEE NEXT PAGE
3
3. This question is on probability and Monte Carlo
a. Consider theprobabilitydensity function p (x) fora randomvariable
X given by
p (x) =
{
µ exp (−µx) x ≥ 0
0 x < 0
where µ (> 0) is a constant.
i. [15 Marks] Show that for this probability density function
E
[
eθX
]
=
(
1 −
θ
µ
)−1
Hint: You may assume µ > θ in obtaining this result.
ii. [20 Marks] By expanding
(
1 −
θ
µ
)−1
as a Taylor series, show
that
E [xn] =
n!
µn
, n = 0, 1, 2, ....
iii. [15 Marks] Hence calculate the skew and kurtosis for X.
COMP0041 CONTINUED ON NEXT PAGE
4
b. [32 Marks] An Exchange Option gives the holder the right to
exchange one asset for another. The discounted payoff for this
contract V is
V = e−rT max (S1 (T) −S2 (T) , 0) .
The option price is then given by θ = E [V ] where
Si (t) = Si (0) e
(r−12σ
2
i )t+σiφi
√
t
for i = 1, 2, and φi ∼ N (0, 1) with correlation coeffi cient ρ.
Youmayassumethatauniformrandomnumbergenerator isavail-
able. Use a Cholesky factorisation method to show(
φ1
φ2
)
=
(
1 0
ρ
√
1 −ρ2
)(
x1
x2
)
,
where
(
x1
x2
)
is a vector of independent N (0, 1) variables and
has the same distribution as
(
φ1
φ2
)
.
Give a Monte Carlo simulation algorithm that makes use of anti-
thetic variates for the estimation of θ.
COMP0041 SEE NEXT PAGE
5
4. This question is on finite differences
a. [30 Marks] Consider a forward difference operator, ∆, such that
∆V (S) = V (S + h) −V (S) , (4.1)
where h is an infinitessimal. By introducing the operators
D ≡
∂
∂S
; D2 ≡
∂2
∂S2
show that
∆ ≡ ehD −1 (4.2)
where 1 is the identity operator. Hint: start by doing a Taylor
expansion on V (S + h) .
By rearranging (4.2) show that
D =
1
h
(
∆ −
∆2
2
+
∆3
3
−
∆4
4
+ O
(
∆5
))
.
Hence obtain the second order approximation for
∂V
...
1. Tiktaalik
https://www.palaeocast.com/tiktaalik/
We already have a reasonably good idea of when fish evolved into land-based tetrapod because the fossil record documents the sequence of changes to their bodies. One of the most iconic specimens is Tiktaalik, a "transitional" fossil dating to around 375 million years ago. Tiktaalik is special, because though it retains many fish-like characteristics, it also possesses wrist bones, suggesting that it could support itself on its front limbs. Fossils from rocks older than Tiktaalik lack these wrist bones and are generally more fish-like. Fossils from younger rocks include more tetrapod-like species, with distinct digits and limbs.
Walking fish help people understand how we left the ocean. Our ancestors' transition out of the water and onto the land was a pivotal moment in evolution. No longer buoyed by water, early tetrapods had to overcome gravity in order to move their bodies. Exactly how those early pioneers first evolved the fundamental capacity to walk has fascinated scientists for many years.
2. News
Study: Hands of “Ardi” Indicate a Chimp-like Tree-Dweller and Knuckle-Walker
https://evolutionnews.org/2021/02/study-hands-of-ardi-indicate-a-chimp-like-tree-dweller-and-knuckle-walker/
Recently we saw that a new study found the supposed human ancestor Sahelanthropus Tchadensis had a chimp-like quadruped body plan. It therefore should not be considered a human ancestor. The hominin fossil Ardipithecus ramidus, or “Ardi,” has been going through a similar evolution. Initially, Ardi was widely called the “oldest human ancestor,” due to its supposed skeletal traits that indicated an early bipedal (upright walking) species. Lead researcher Tim White even called Ardi the “Rosetta stone for understanding bipedalism.” But after Ardi was officially announced, other papers strongly challenged the claim that Ardi was bipedal. One article in Science commented that “All of the Ar. ramidus bipedal characters cited also serve the mechanical requisites of quadrupedality.” Another review in Nature strongly argued that “the claim that Ardipithecus ramidus was a facultative terrestrial biped is vitiated because it is based on highly speculative inferences about the presence of lumbar lordosis and on relatively few features of the pelvis and foot.”
It must be the most common picture that used to explain the concept ‘evolution’. The new discovery ‘Ardi’ attracts me that people may find another good example to help us understand how we evolved into bipedalism.
3. Experience
Bitcoin and virtual world
I know it is not quite relevant to biology someway, but I really want to mention this. Bitcoin is a type of cryptocurrency. There are no physical bitcoins, only balances kept on a public ledger that everyone has transparent access to. All bitcoin transactions are verified by a massive amount of computing power. Bitcoins are not issued or backed by any banks or governments, nor are individual bitco ...
1. This week, we learned about the balanced scorecard and dashboarAbbyWhyte974
1. This week, we learned about the balanced scorecard and dashboard reporting, performance measurement, sources of revenues for different types of healthcare organizations, and financial and strategic planning initiatives. For your Unit 3 Complete assignment, write a narrative essay (minimum 1,200 words) in which you first discuss the use of the income statement, in general, for decision-making. Then, calculate the net operating income and operating margin for this year and last year using the table information below and discuss what these figures mean for the company (i.e. what ‘story’ do they tell the reader). Use at least three scholarly sources and remember to demonstrate a thorough understanding of the READ and ATTEND sections in your essay. Cite your sources using APA format.
Table 3
HEALTH CAMPAIGNS:
CREATING & EVALUATING
Day 33
Review
Ch. 8 Review
Activity
Homework
AGENDA:
1.
2.
3.
4.
Public Health
Public health: prevention of disease and illness among groups of people.
Creation of public policy regarding health issues and tracks diseases
_________________
Public health services (CDC)
(Lillie; Mattson & Hall, 2011)
Health Campaigns
Health campaign
Seeks to promote public health
Targets beliefs, attitudes, or behaviors
________- acceptance of something as
true or not
______- positive or negative feeling
about something
________-actions
____________
Goes beyond health education to involve
health information and environmental
support/resources for health
(Lillie; Mattson & Hall, 2011)
Messaging Model for Health COM Campaigns
4 phases of the health campaign process
1. Establish a working group and ____________
2. Strategic planning from____________
3. _________________ and evaluation
4. ______________on process evaluation and outcome
evaluation
(Lillie; Mattson & Hall, 2011)
Messaging Model for Health COM Campaigns
(Mattson & Hall, 2011, p. 253)
Phase 1: Establish a
Working Group
_________: core team for
strategic planning and advising
Includes stakeholders, health
experts, organizational
officials, community partners
_________: orgs and
businesses who have an interest in
the campaign
Provide resources:
(Lillie; Mattson & Hall, 2011)
Phase 2: Strategic
Planning
Strategic plan: campaign goal and
plan of action
_______ analysis:
S_______ and
w______of campaign team
(internal to team)
O_____ and t______
(external to campaign)
Ex. grassroots support or
resistant audience
__________: research to
form strategies, select target
audiences, and develop marketing
strategies
(Lillie; Mattson & Hall, 2011)
Phase 2: Strategic
Planning
CONT.
Needs assessment: process to
understand and determine a
community’s/population’s
health issues
Pre-campaign gather info from
Key informants
community forum
survey
_________: already
existing statistics
(Lillie; Mattson & Hall, 2011)
Phase 2: Strategic
Planning
CONT.
Messaging process: after determining
baseline attitudes, beliefs, and behavi ...
1. The company I chose was Amazon2.3.4.1) Keep iAbbyWhyte974
1. The company I chose was Amazon
2.
3.
4.
1) Keep in mind that the data includes Amazon and competitors
2) Example(For reference only)
Table showing FedEx’s stock quote
Item
Value
Interpretation and brief explanation
Current market price
$274.48
This is the price of FedEx stock that it sells for on the free stock market at as of now. Anyone wishing to purchase the company’s stock will have to pay the $274.48. This market value will habitually vary all through the exchange day as investors sell and buy the Fed Ex stock. The price will increase if more traders want to buy it and decrease or drop as traders begin selling more of the company’s stock.
Market capitalization
$72.076 Billion
This the stock price multiplied by the number of equity shares outstanding. So it is the price above multiplied by the number of FedEx’s hares outstanding
Beta
1.39 (5 year Monthly)
Beta is a measure of how a separate asset shifts when the general stock market decreases or increases(Beta, 2011). In simple it is measure of a risk associated with an asset's risk in relation to the whole market (for instance, the S&P500 index). It is a measure of FedEx’s stock relative volatility. FedEx’s beta is more than meaning it is less stable. If S&P 500 Index has a base of let’s say 1 and this index changes by 3% then the stock of FedEx will as well change by 4.17% (1.39 X 3%).
PE Ratio
40.41
In general, a great P/E ratio shows that investors anticipate for greater pays. Though, a security with a great P/E ratio is not certainly a superior investment than one with a lesser P/E ratio (Park, 2020). On the other hand, when a corporation's security has a small P/E ratio, it might have an indication that the stock is underestimated. In light of FedEx’s PE ratio of 40.41 its means that the stock was trading at around 40 times the earnings. This ratio is more than the overall ration in the S&P 500 Index meaning the company share is not overvalued.
EPS
$6.79
This is computed by dividing the net earnings attributable to the shareholders by the number of outstanding equity shares. This point outs the amount a corporation makes from each share. This item is important in determining the stock prices particularly when calculating the P/E ratio. $6.79 shows that each FedEx common stock earns around $6.79.
Earning date
December 16th 2020
This is the date of when a company will release its next financial reports. So, FedEx will have its next financial statements released on 16th December 2020. On this day there are expected large movements of its underlying.
Forward Dividend Yield
2.60 (0.93%)
This forward yield is an approximation of a year's dividend stated as a ratio of the present stock price. The year's expected dividend is determined by taking a security’s most latest actual dividend disbursement and annualizing it. The forward dividend yield is computed by dividing a year's value of future dividend disbursements by a stock's present share price. It is a corporation's pr ...
1. Think about a persuasive speech that you would like to present AbbyWhyte974
1. Think about a persuasive speech that you would like to present on a topic of your choice. The speech can be for any context and any length, but it must be persuasive.
2. See the list of example speech occasions and purposes for inspiration, if needed.
3. Plan your speech, considering what your introduction, main points, and conclusion will include.
4. Organize your speech, following the structure of Monroe’s Motivated Sequence. Your speech should include an introduction, body, and conclusion. The introduction should contain your key message. The body should cover your main topics and support to back up your main points. Make sure that all support is relevant and from credible sources. Your conclusion should summarize your main points and provide a call to action.
5. Create notes or bullet points that you can refer to while presenting your speech.
6. Practice presenting your speech. Aim for a speech that is 3 to 5 minutes in length.
7. Before filming, review the rubric to ensure that you understand how you will be evaluated.
8. Film yourself presenting the speech. Be sure that you can be easily seen and heard, and direct your speech to the camera.
9. Review your video to ensure that you can be seen and heard. Refilm as needed.
10. Review the checklist and requirements to ensure that your Touchstone is complete.
11. Upload your video using the blue button at the top of this page.
...
1. The two properties about a set of measurements of a dependent vAbbyWhyte974
1. The two properties about a set of measurements of a dependent variable that we are most interested in describing are:
a.
frequency and average.
b.
average and correlation.
c.
central tendency and dispersion.
d.
histograms and polygons.
2. The ________________ is the sum of all the scores divided by the number of scores.
a.
median
b.
mean
c.
mode
d.
standard deviation
3. The generally preferred measure of central tendency is usually the
a.
range
b.
mean
c.
standard deviation
d.
Median
4. Which of the following is the most useful descriptive statistic for measuring dispersion?
a.
Range
b.
Variance
c.
mean deviation
d.
standard deviation
5. The standard deviation is
a.
the square of the variance.
b.
the square root of the variance.
c.
smaller than the mean.
d.
the difference between the highest and lowest scores.
6. If the mean I.Q. is 100 and the standard deviation of I.Q. scores is 15, then an I.Q. of 130 will have a z score (or standard score) of
a.
1.00
b.
0.00
c.
2.00
d.
-2.00
7. Inferential statistics allow you to decide whether a difference between the experimental and the control group is due to _______________ or ________________.
a.
manipulation; chance
b.
manipulation; experimental error
c.
sampling error; independent variable
d.
independent variable; experimental error
8. The null hypothesis suggests that the two samples come from ___________ distribution(s), and the experimental hypothesis suggests that the two samples come from _____________ distribution(s).
a.
different; different
b.
different; the same
c.
the same; different
d.
the same; the same
9. The power of a statistical test refers to its ability to
a.
reject false null hypotheses.
b.
reject false experimental hypotheses.
c.
reject true null hypotheses.
d.
reject true experimental hypotheses.
10. Simple analysis of variance is used in designs having
a.
one independent variable
b.
more than one independent variable
c.
more than one independent variable (IV) but less than four IVs
d.
more than one dependent variable
11. The number of participants in a study is denoted by
a.
s.
b.
n.
c.
z.
d.
r.
12. A _____________ is a complete set of measurements.
a.
sample
b.
population
c.
random sampling
d.
parameter
13. _____________ is one way of ensuring that a sample is representative of the population.
a.
The two-tailed test
b.
The between-subjects design
c.
The sign test
d.
Random sampling
14. If we conduct an experiment on average young, white, college males, inferential statistics allow us to generalize to the population of
a.
average young, white, college males.
b.
college male students.
c.
college students.
d.
young adults.
15. If we apply an alpha level of .05, and there really is no effect of the experimental manipulation, then one should make a Type I error
a.
5% of the time.
b.
10% of the time.
c.
15% of the time.
d.
95% of the time.
16. Which of the following would be considered the most conservative alpha level ...
1. The Danube River flows through 10 countries. Name them in the sAbbyWhyte974
1. The Danube River flows through 10 countries. Name them in the spaces in the table below. One is answered for you! 10 pts.
1. Germany
5
9
2
6
10
3
7
4
8
2. There are at least 192 towns and cities along the Danube River. List fivemajor cities from five different countries - no 2 cities can be from the same country. One is done for you! 10 pts.
City
Country
Vienna
Austria
3. The narrator of the video calls the Danube River “Europe’s most important water artery.” What is the importance of the river to the region? List three. 3 points
4. Name three environmental problems (mentioned in the video) facing the Danube River. 3pts
5. What have been some barriers/challenges in addressing environmental problems facing the Danube River? Name three. 3 points
6. The narrator states, “Danube used to shape people’s lives 1000 years ago…. now, people shape life of the Danube” In what ways are humans “shaping the life” of the Danube River? Name two ways and be specific. 4 points
7. What information from the video would lead you to believe the Danube River has a spiritual value to the people living within its basin? 2 pts
8. Name two sets of countries where Danube River (is) forms the border.
Set 1: ________________________________ (2 countries)
Set 2: _____________________________________ (2 countries)
4 points
9. Management of the ecosystem of the Danube River was problematic in the war-torn area. What is the evidence in the video of the impact of war on Danube River ecosystem? Name two. 2 points
10. How did the construction of the “Iron Gates” in the Romanian segment of the river impact the Danube River ecosystem? 2 points
11. What specific human activities have impacted fish life in the river? Name three. 3 points
12. Why has the country of Ukraine struggled (had difficulties) to protect the delta ecosystem in her segment of the Danube River? 2 points
13. Write down two geographical facts from the video that surprised you and say why? HINT: First, write down the facts, then say why you are surprised. Here is an example of a geographic fact about New York City that I learned from a video: The video stated that 37% of the NYC population comes from another country – that was not a surprise, but, I did not expect that there more than 800 languages spoken in the city. I knew New York City was multicultural but not to that extent. Those are real facts straight from the video. You get it!
14. What was the takeaway for you? What conclusions can you draw from watching the video? 2-3 sentences – in your own words. HINT: Answer should reflect a deep intellectual thought process. Here is an example of a takeaway from a video about the Amazon tropical rainforest, “Evidence from the video seems to indicate a correlation between increasing environmental degradation in the Amazon basin and the fuel demands of Western countries.”
2 points
...
1. The 3 genes that you will compare at listed below. Take a look.AbbyWhyte974
1. The 3 genes that you will compare at listed below. Take a look. I’ve colored ‘the header region’ of each so that you can distinguish one from the other. DO NOT CHANGE THE FORMAT. DO NOT ADD TEXT OF ANY SORT. WHEN YOU COPY THE GENE DON’T FORGET TO INCLUDE THE ‘HEADER (RED) REGION (starting with “>”). The ‘>’ symbol tells the software the start of the gene. and the red region DESCRIBES THE GENE (SEQUENCE).
2. Using your computer, open the program (used to compare them). The link is http://multalin.toulouse.inra.fr/multalin/ (cut and paste link into your browser)
3. Copy THE FIRST 2 SEQUENCES ONLY (1 and 2) and paste into the “white box-region” just below region marked Sequence-data. Make sure you copy the entire sequence for each gene including the ‘> symbol and red heading’.
4. Click the region below the box marked “Start MultiAlin’. This starts your comparison
5. Examine results. Make note of the colors. If the colors are ‘alike’ that means the sequences are similar. THIS PROGRAM USES COLOR TO DETERMINE HOW SIMILAR 2 SEQUENCES ARE.SAME COLOR MEANS THEY ARE SIMILAR.
6. Use the back-space button and return to the original screen. Delete the sequences in the white box. This allows for a new comparison.
7. Paste sequences 2 and 3 in the box. this allows for comparison of sequences 2 and 3, similar to what was done for 1 and 2.
8. Click the “Start MultiAlin” just like before.
9. Note the color- scheme. Compare what you observed for 1 and 2. Which are more similar 1 and 2, or 2 and 3?
10. For full credit, you should copy results from comparison of 1-2 and separately, 2-3. Doesn’t matter if you don’t have color printer.
11. Or… at the bottom of the image page, there is a command --- “Results as a gif file’. It is located under the region marked, ‘AVAILABLE FILES’… Click on this (Results as a gif file’) and print your results. Staple the first comparison to the second, and turn in. or give as computer file. Which ever are more convenient? Tell me which 2 comparisons (ie, genes) are more alike.
COMPARISON SHOULD LOOK LIKE THIS… (red= exactly alike; blue = different sequence). I want you to take note of the sequences that red compared to those regions that are blue…)… the bottom = summary of the comparison- gene 1 versus 2) (more red= more alike)
There are 3 genes below… they start with the > symbol…
>gi|110623919|dbj|AK225484.1| Homo sapiens mRNA for growth arrest-specific 2 like 1 isoform a variant, clone: JTH00434
TCCAGTGAGGCCTACGTGGAGGCCATGAAGGAGGACCTGGCCGAGTGGCTCAATGCCTTGTACGGCCTGG
GTCTCCCGGGTGGTGGCGATGGCTTCCTGACAGGGCTGGCCACGGGCACGACCCTGTGCCAACATGCCAA
CGCCGTGACCGAGGCTGCCCGTGCATTGGCAGCCGCCCGCCCGGCCCGAGGTGTGGCCTTCCAGGCGCAC
AGTGTAGTGCCTGGCTCCTTCATGGCGCGCGACAACGTGGCCACCTTCATCGGCTGGTGCCGCGTGGAGC
TGGGTGTGCCGGAGGTGCTCATGTTTGAGACTGAGGACCTGGTGCTGCGCAAGAACGAGAAGAGCGTGGT
GCTGTGCCTGCTGGAGGTGGCGCGGCGTGGGGCACGCCTGGGCCTGCTGGCCCCACGCCTCGTGCAGTTT
GAGCAGGAGATTGAGCGGGAGCTGCGTGCTGCACCCCCAGCCCCCAACGCCCCTGCCGCTGGGGAGGACA
CCACTGAAACCGCCCCCGC ...
1. Student and trainer detailsStudent details Full nameStuAbbyWhyte974
1. Student and trainer details
Student details
Full name:
Student ID:
Contact number:
Email address:
Trainer details
Full name:
2. Qualification and unit of competency
Qualification/Course/Program Details
Code:
Name:
Unit of competency
Code:
CPCCCA3014
Name:
Construct and install bulkheads
Releases:
1.0
Release date:
27/Nov/2020
3. Assessment Submission Method
☐ By hand to trainer/assessor ☐ By email to trainer/assessor
☐ Online submission via Learning Management System (LMS)
☐ Any other method _________________________________________________
(Please describe here)
4. Student declaration
· I have read and understood the information in the Unit Requirements prior to commencing this Student Pack
· I certify that the work submitted for this assessment pack is my own. I have clearly referenced any sources used in my submission. I understand that a false declaration is a form of malpractice;
· I have kept a copy of this Student Pack and all relevant notes, attachments, and reference material that I used in the production of this Student Pack;
· For the purposes of assessment, I give the trainer/assessor permission to:
· Reproduce this assessment and provide a copy to another member of staff; and
· Take steps to authenticate the assessment, including communicating a copy of this assessment to a plagiarism checking service (which may retain a copy of the assessment on its database for future plagiarism checking).
Student signature: ________________________________
Date: ____/_____/______________
5. Assessment Plan
The student must be assessed as satisfactory in each of the following assessment methods in order to demonstrate competence in a variety of ways.
Evidence number/ Task number
Assessment method/ Type of evidence/ Task name
Sufficient evidence recorded/Outcome
Assessment task 1
Knowledge Test (KT)
S / NS (First Attempt)
S / NS (Second Attempt)
Assessment task 2
Skill Test (ST)
S / NS (First Attempt)
S / NS (Second Attempt)
Outcome
C ☐ NYC ☐
Date assessed:
Trainer signature:
6. Completion of the Assessment Plan
Your trainer is required to fill out the Assessment Plan Outcome records above, when:
· You have completed and submitted all the requirements for the assessment tasks for this cluster or unit of competency.
· Your work has been reviewed and assessed by your trainer/assessor.
· You have been assessed as either satisfactory or unsatisfactory for each assessment task within the unit of competency.
· You have been provided with relevant and detailed feedback.
Every assessment has a “Feedback to Student” section used to record the following information. Your trainer/assessor must also ensure that all sections are filled in appropriately, such as:
· Result of Assessment (satisfactory or unsatisfactory)
· Student name, signature and date
· Assessor name, signature and date
· Relevant and detailed feedback
7. U ...
1. Student uses MS Excel to calculate income tax expense or refundAbbyWhyte974
1. Student uses MS Excel to calculate income tax expense or refund, taxable income, and total taxes using the full-cost method for transfer pricing. There are no errors.
2. Student uses MS Excel to calculate income tax expense or refund, taxable income, and total taxes using the variable-cost method for transfer pricing. There are no errors.
3. Student produces a thorough and detailed Word document that incorporates specific details from the MS Excel spreadsheet, a detailed recommendation based on those specific details as to how the organization should proceed is included, and the recommendation is justified with at least 3 examples from the week's resources and/or additional research in the Walden Library.
4. Writing exhibits strong evidence of thoughtful critical analysis and thinking; careful examination is made of assumptions and possible biases, with detailed supporting rationale. Writing synthesizes the classroom experiences and content; analyzes patterns or connections between theory and practice; and draws logical conclusions based on well-reasoned arguments. New questions are presented based on synthesis of ideas and input.
5. Writing is clear, logical, well-organized and appropriate. Work is free from spelling and grammar/syntax errors. Tone is professional and free from bias (i.e., sexism, racism). There are no errors.
6. Student effectively and directly integrates discussion/assignment content with relevant and compelling personal experiences, additional research, or current events from credible news sources. Specifically adds a new and/or different insight or perspective on the subject area(s) being discussed or treated in the assignment.
7. Student demonstrates full adherence to scholarly or credible reference requirements and adheres to APA style with respect to source attribution and references. There are no APA errors.
CASE STUDY—BEWARE: One Emergency May Hide Another!
A hospital submitted a report to the State Board of Nursing reporting that an RN had been terminated after the death of a patient following surgery for a tubal pregnancy.
THE NURSE'S STORY—SALLY SIMMS, RN
I had worked the medical-surgical units at the General Hospital ever since graduating from my nursing program 4 years before. This was the worst night, the worst shift, of my nursing career.
I was assigned to care for eight patients that night, which is not an unusual number of patients, but they all were either fresh post-ops or so very sick. Four patients had just had surgery that day. One patient was on a dopamine drip to maintain his blood pressure, so he needed frequent monitoring. One patient was suspected to have meningitis, one patient had pneumonia, and a patient with suspected histoplasmosis completed my assignment.
One of my post-op patients was Betty Smith, a young woman in her early thirties who had laparoscopic surgery late in the day. She had been transferred from the recovery room late in the evening shift and was very uncomfortable when I fi ...
1. Socrates - In your view, what was it about Socrates’ teachings AbbyWhyte974
1. Socrates - In your view, what was it about Socrates’ teachings that made him dangerous in the minds of the members of the ruling class of Athens; and what was it about his teachings that attracted his students to him?
2. Plato - Of his many ideas, which do you think has been his most influential, and why?
3. Aristotle - Share your own views on Aristotle's break with Plato on the question of private property and wealth accumulation. Is Aristotle's argument persuasive and superior? Or was it weak, and even dangerous?
4. Birth of Christianity as a Religion - Imagine the the Council of Nicaea ended with the Gospel of Mary being included in the New Testament. How might Western Civilization have developed differently if this book, and it's suggestion the Jesus’ closest disciple, the one he revered the most, was actually a woman? Do you think we might have inherited a less misogynistic society in which women are treated more as equals?
7. The encomienda system used by the Spaniards to enslave the indigenous peoples of the New World, especially as practiced in Mexico, became controversial in Spain. Describe the encomienda system and the arguments used for and against it.
8. Describe why it is that many historians argue that King Henry VIII of England played a critical role in the rise of capitalism.
9. By the time Adam Smith’s An Inquiry into the Nature and Causes of the Wealth of Nations was published in 1776, Europe had undergone a dramatic transformation from a feudal, largely agrarian society to an increasingly market-based commercial society. Discuss some of the more significant, transformative societal developments, and their implications, from 1492 to 1776.
10. Much has been written about the so-called “Adam Smith Problem;” the apparent dichotomy between his Theory of Moral Sentiments and An Inquiry into the Nature and Causes of the Wealth of Nations. Discuss whether these two works are reconcilable with one another. Do they reflect two very different imaginations of humans? Do they suggest that the author changed his mind after writing the first book? Might they represent a more complex and unifiable imagination of who we are or can be?
11. The garment industry is the second-most polluting in the world. A significant amount of this pollution is from “fast fashion” “disposable” clothing; a business model that relies on people, including children, making clothes under conditions that we would consider intolerable. Psychologists and marketers alike agree that our buying and consumption is largely driven by psychological impulses of which we may not be fully conscious. Indeed, as experts posit in the film The True Cost, consuming more can have a negative effect on our psyche. What social, ethical, economic and/or philosophical issues are raised by The True Cost documentary? Why do we tolerate such a system?
12. Many people agree with Immanuel Kant's argument that we should never treat other people as means to an end; we should treat each pers ...
1. Select a patient” (friend or family member) on whom to performAbbyWhyte974
1. Select a “patient” (friend or family member) on whom to perform a complete H&P.
2. NOTE: DO NOT USE REAL NAMES OR INITIALS OR OTHERWISE IDENTIFY YOUR “PATIENT.” FAILURE TO MAINTAIN PRIVACY WILL RESULT IN A FAILING SCORE.
3. Using the format specified below, write a 2 page SOAP note on your “patient.” The HPI should be presented in a paragraph, and the rest of the data including the ROS should be presented in a list format.
4. Collect only the information that is pertinent to the chief complaint of the patient to include in your SOAP note. Aim for a single page using normal margins and format.
5. The SOAP Note must contain all required elements as outlined in the rubric below.
6. You must self-score your SOAP note using the rubric and attach it to the assignment.
Criteria Ratings Points
Thread
Content
50 to >46.0 pts
Advanced
47 to 50 points All key
components of the
Discussion Board Forum
prompt are answered in
the thread. Major points
are supported by all of the
following: *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the
required 7 or more from
personal research, the
course readings, and the
integration of 1 biblical
principle.
46 to >43.0 pts
Proficient
44 to 46 points Some key
components of the
Discussion Board Forum
prompt are answered in the
thread. Major points are
supported by some of the
following): *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the required
7 or more from personal
research, the course
readings, and the
integration of 1 biblical
principle.
43 to >0.0 pts
Developing
Minimal key components of
the Discussion Board
Forum prompt are
answered in the thread.
Major points are supported
by some or none of the
following: *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the required
7 or more from personal
research, the course
readings, and the
integration of 1 biblical
principle
0 pts
Not
Present
50 pts
Replies
Content
41 to >39.0 pts
Advanced
Contribution made to
discussion with each reply
expounding on the thread.
Major points are supported
by all of the following:
*Reading & Study
materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Three
peer-reviewed source
citations in current APA
format, and the integration
of 1 biblical principle.
39 to >35.0 pts
Proficient
Marginal contribution made
to discussion with each
reply slightly exp ...
1. Review the HCAPHS survey document, by clicking on the hyperlinkAbbyWhyte974
1. Review the HCAPHS survey document, by clicking on the hyperlink.
2. Choose one of the questions on the survey and research an intervention to improve patient satisfaction on that question.
3. Drop a pdf of the article for your solution
4. Review the rubric to make sure you include all required information in your video assignment.
5. Create a video to present a systems-based solution, according to the research. (Do NOT include "increased staffing" as your solution.)
March 2017 1
HCAHPS Survey
SURVEY INSTRUCTIONS
You should only fill out this survey if you were the patient during the hospital stay
named in the cover letter. Do not fill out this survey if you were not the patient.
Answer all the questions by checking the box to the left of your answer.
You are sometimes told to skip over some questions in this survey. When this happens
you will see an arrow with a note that tells you what question to answer next, like this:
Yes
No If No, Go to Question 1
You may notice a number on the survey. This number is used to let us know if
you returned your survey so we don't have to send you reminders.
Please note: Questions 1-25 in this survey are part of a national initiative to measure the quality
of care in hospitals. OMB #0938-0981
Please answer the questions in this survey
about your stay at the hospital named on
the cover letter. Do not include any other
hospital stays in your answers.
YOUR CARE FROM NURSES
1. During this hospital stay, how often
did nurses treat you with courtesy
and respect?
1
Never
2
Sometimes
3
Usually
4
Always
2. During this hospital stay, how often
did nurses listen carefully to you?
1
Never
2
Sometimes
3
Usually
4
Always
3. During this hospital stay, how often
did nurses explain things in a way
you could understand?
1
Never
2
Sometimes
3
Usually
4
Always
4. During this hospital stay, after you
pressed the call button, how often did
you get help as soon as you wanted
it?
1
Never
2
Sometimes
3
Usually
4
Always
9
I never pressed the call button
2 March 2017
YOUR CARE FROM DOCTORS
5. During this hospital stay, how often
did doctors treat you with courtesy
and respect?
1
Never
2
Sometimes
3
Usually
4
Always
6. During this hospital stay, how often
did doctors listen carefully to you?
1
Never
2
Sometimes
3
Usually
4
Always
7. During this hospital stay, how often
did doctors explain things in a way
you could understand?
1
Never
2
Sometimes
3
Usually
4
Always
THE HOSPITAL ENVIRONMENT
8. During this hospital stay, how often
were your room and bathroom kept
clean?
1
Never
2
Sometimes
3
Usually
4
Always
9. During this hospital stay, how often
was the area around your room quiet
at night?
1
Never
2
Sometimes
3
Usually
4
Always
YOUR EXPERIENCES ...
1. Saint Leo Portal loginUser ID[email protected] AbbyWhyte974
1. Saint Leo Portal login
User ID:[email protected]
Saintleo\martha.ramsey
Password: Demonte5!!!
2. New Login for email through Okta
User ID: Martha.ramsey
Password: Demonte5!!!
3. What did you earn your first medal or award for?
Art class
4. Lion Share Courses
5. Research Method I
...
1. Reference is ch. 5 in the e-text, or ch. 2 in paper text...pleaAbbyWhyte974
1. Reference is ch. 5 in the e-text, or ch. 2 in paper text...please match the terms regarding political parties
polling data is based on this aspect of Parties
Rep. Senfronia Thompson filed for the role of Speaker of Texas House
In 2020, party delegates and executive committees voted to nominate presidential candidates via Zoom
a sector of a political party (ex. Trump Republican, conservative Democrat) is called
2. Which candidate’s office is chosen/nominated by delegate convention?
sheriff of Medina County
U.S. congressman from the 4th Texas congressional district
president of the United States
governor of Texas
3. Which statement best depicts the effect of redistricting on representative democracy?
Legislators represent the same number of Republicans and Democratic voters
representation is mostly based on geographic cohesion
representation is mostly based on the voting patterns of Texas residents
gerrymandering is a legitimate method of forming districts
4. The difference between absentee ballot and mail-in ballot is?
absentee is for people residing outside of their state
mail-in ballots are issued to people who can't go to polls
in some states there is no difference, as all ballots are mailed in
in Texas mail-in ballots require doctors note
5 Unlike the US, most democratic governments have _______ political systems with _______.
2-party//direct representation
Multi-party//proportional
2-party//direct representation
multi-party//proportional representation
independent party//single-member districts
2-party//single-member districts
[ Choose ]
[ Choose ]
[ Choose ]
Car LoanNew Car LoanLoan InputsSticker price$ 24,595Trade in$ 3,500Cash back offer$ - 0Loan amount$ 21,095Loan term (months)24Loan interest (APR)1.90%Loan payment$ 896.46Total cost of the car$ 21,515.04
My Car Data
MPG DataAll ModelsModelDisplCylTransDriveFuelCert RegionStndStnd DescriptionUnderhood IDVeh ClassAir Pollution ScoreCity MPGHwy MPGCmb MPGGreenhouse Gas ScoreSmartWayComb CO2ACURA ILX2.44AMS-82WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV02.4SH3small car62535297Yes309ACURA ILX2.44AMS-82WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV02.4SH3small car62535297Yes309ACURA MDX3.56SemiAuto-92WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61927225No404ACURA MDX3.56SemiAuto-92WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV62027235No391ACURA MDX3.56SemiAuto-92WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV61927225No404ACURA MDX3.56SemiAuto-92WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV62027235No391ACURA MDX3.56SemiAuto-94WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61826214No424ACURA MDX3.56SemiAuto-94WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61926225No404ACURA MDX3.56SemiAuto-94WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV61826214No424ACURA MDX ...
Embracing GenAI - A Strategic ImperativePeter Windle
Artificial Intelligence (AI) technologies such as Generative AI, Image Generators and Large Language Models have had a dramatic impact on teaching, learning and assessment over the past 18 months. The most immediate threat AI posed was to Academic Integrity with Higher Education Institutes (HEIs) focusing their efforts on combating the use of GenAI in assessment. Guidelines were developed for staff and students, policies put in place too. Innovative educators have forged paths in the use of Generative AI for teaching, learning and assessments leading to pockets of transformation springing up across HEIs, often with little or no top-down guidance, support or direction.
This Gasta posits a strategic approach to integrating AI into HEIs to prepare staff, students and the curriculum for an evolving world and workplace. We will highlight the advantages of working with these technologies beyond the realm of teaching, learning and assessment by considering prompt engineering skills, industry impact, curriculum changes, and the need for staff upskilling. In contrast, not engaging strategically with Generative AI poses risks, including falling behind peers, missed opportunities and failing to ensure our graduates remain employable. The rapid evolution of AI technologies necessitates a proactive and strategic approach if we are to remain relevant.
Unit 8 - Information and Communication Technology (Paper I).pdfThiyagu K
This slides describes the basic concepts of ICT, basics of Email, Emerging Technology and Digital Initiatives in Education. This presentations aligns with the UGC Paper I syllabus.
Macroeconomics- Movie Location
This will be used as part of your Personal Professional Portfolio once graded.
Objective:
Prepare a presentation or a paper using research, basic comparative analysis, data organization and application of economic information. You will make an informed assessment of an economic climate outside of the United States to accomplish an entertainment industry objective.
Read| The latest issue of The Challenger is here! We are thrilled to announce that our school paper has qualified for the NATIONAL SCHOOLS PRESS CONFERENCE (NSPC) 2024. Thank you for your unwavering support and trust. Dive into the stories that made us stand out!
Honest Reviews of Tim Han LMA Course Program.pptxtimhan337
Personal development courses are widely available today, with each one promising life-changing outcomes. Tim Han’s Life Mastery Achievers (LMA) Course has drawn a lot of interest. In addition to offering my frank assessment of Success Insider’s LMA Course, this piece examines the course’s effects via a variety of Tim Han LMA course reviews and Success Insider comments.
Safalta Digital marketing institute in Noida, provide complete applications that encompass a huge range of virtual advertising and marketing additives, which includes search engine optimization, virtual communication advertising, pay-per-click on marketing, content material advertising, internet analytics, and greater. These university courses are designed for students who possess a comprehensive understanding of virtual marketing strategies and attributes.Safalta Digital Marketing Institute in Noida is a first choice for young individuals or students who are looking to start their careers in the field of digital advertising. The institute gives specialized courses designed and certification.
for beginners, providing thorough training in areas such as SEO, digital communication marketing, and PPC training in Noida. After finishing the program, students receive the certifications recognised by top different universitie, setting a strong foundation for a successful career in digital marketing.
Operation “Blue Star” is the only event in the history of Independent India where the state went into war with its own people. Even after about 40 years it is not clear if it was culmination of states anger over people of the region, a political game of power or start of dictatorial chapter in the democratic setup.
The people of Punjab felt alienated from main stream due to denial of their just demands during a long democratic struggle since independence. As it happen all over the word, it led to militant struggle with great loss of lives of military, police and civilian personnel. Killing of Indira Gandhi and massacre of innocent Sikhs in Delhi and other India cities was also associated with this movement.
Home assignment II on Spectroscopy 2024 Answers.pdf
1 Dissertation Manuscript Submitted to North
1. 1
Dissertation Manuscript
Submitted to Northcentral University
Graduate Faculty of the School of Business
in Partial Fulfillment of the
Requirements for the Degree of
DOCTOR OF PHILOSOPHY
by
Walfyette Powell
Prescott Valley, Arizona
December 2016
3. 789 East Eisenhower Parkway
P.O. Box 1346
Ann Arbor, MI 48106 - 1346
10260269
10260269
2017
2
Approval Page
A Phenomenological Study of SAS No. 99 and Auditors'
Perception of the Fraud
Triangle Theory
By
Walfyette Powell
Approved by:
Ann Armstrong, EdD 1/30/2017
4. Chair: Ann Armstrong, EdD Date
Certified by:
1/30/17
Dean of School: Peter Bemski, PhD Date
3
Abstract
The fraud triangle theory is the underpinning principle of SAS
No 99 and it is utilized by
auditors to detect and assess the likelihood of fraud during a
financial statement audit.
Although the theory is relied upon to detect fraud many scholars
believe it is inadequate
in fraud detection. From 2002 to 2008, undetected fraud
increased from 5% to 7%. Based
on this claim it is evident that the fraud triangle theory has not
improved auditors’ ability
to detect fraud. The theory articulates three critical elements
5. that are present for a typical
individual who engages in fraud: opportunity, perceived
pressure, and rationalization.
The theory has gained recognition over the last forty years;
however, Kassem, Higson,
and Buchholz suggest that the fraud triangle is ineffective in
detecting fraud. They
suggest that a new fraud theory should be implemented that
includes motivation,
integrity, and capability because it would improve auditors’
ability to detect the
likelihood of financial statement fraud. The purpose of this
qualitative phenomenological
study was to understand and describe U.S. auditors’ perceptions
of the effectiveness of
fraud triangle theory and to determine if motivation, integrity,
and capability should be
included in fraud theory. The researchers suggest the fraud
triangle should be modified
and it should include motivation and capability which is
observable events and
rationalization should be removed because it is not an
observable event. Future research
on the fraud triangle theory should focus on two important
6. areas. First, future research
should identify techniques to determine if an employee has
rationalized their actions to
commit financial fraud and future research should focus on
modifying SAS No. 99.
Lastly, findings from this research may help auditors to perform
their duties to detect
whether financial statement fraud exists in an organization.
4
Acknowledgements
First and foremost, I would like to thank God my heavenly
father who has given
me the strength, fortitude and faith to successfully complete my
dissertation “I never
would have made it without you.” Next, I want to thank my
mother and sisters who have
always supported me in my endeavors, their words of
encouragement and faith in my
abilities inspired me throughout my dissertation journey. My
family’s love and support
7. gave me the tools I needed to achieve my goals. I know that I
am lucky to have such a
wonderful support-base - thanks for the love!
Lastly, I am forever grateful to Dr. Armstrong, my dissertation
chair. Your words
of support, Skype meetings, and telephone calls were
appreciated, and without your help,
this dissertation would not have been possible.
Faith
I can do all things through Christ which strengthens me
Philippians 4:13
5
Table of Contents
Chapter 1: Introduction
...............................................................................................
........ 7
Statement of the Problem
............................................................................................
11
8. Purpose of the Study
...............................................................................................
.... 12
Theoretical Framework
...............................................................................................
13
Research Questions
...............................................................................................
...... 15
Nature of the Study
...............................................................................................
...... 15
Significance of the Study
............................................................................................
16
Definition of Key Terms
.............................................................................................
17
Summary
...............................................................................................
...................... 19
Chapter 2: Literature Review
............................................................................................
21
Brainstorming
...............................................................................................
.............. 36
Professional Skepticism in Fraud Detection
............................................................... 39
Analytical Procedures
...............................................................................................
.. 42
SAS No. 99 and Internal Control
................................................................................ 45
9. The Evolution of Statements of Auditing Standards
.................................................. 49
Risk Assessment
...............................................................................................
.......... 55
Audit
Evidence............................................................................. ....
........................... 61
Chapter 3: Research Method
.............................................................................................
69
Research Methods and
Design(s)................................................................................
70
Population
...............................................................................................
.................... 71
Sample....................................................................................
..................................... 72
Materials/Instruments
...............................................................................................
.. 74
Data Collection, Processing, and Analysis
................................................................. 76
Assumptions
...............................................................................................
................. 82
Limitations
...............................................................................................
................... 83
Delimitations
...............................................................................................
................ 83
Ethical Assurances
13. year 5% of a
company’s revenue is lost due to fraud (Campanelli, 2016). This
number is staggering
because it equates to millions of dollars each year. In the worst-
case scenario, financial
statement fraud has destroyed billion-dollar companies, such as
Enron, Arthur Anderson,
and WorldCom. Because financial statement fraud has a
catastrophic effect on the
economy, it is a major concern to the Public Company
Accounting Oversight Board
(PCAOB), whose responsibility it is to protect the investing
public by ensuring that
financial statement fraud does not occur or that the impact of
financial statement fraud is
kept to a minimum.
To ensure that financial statement fraud is kept to a minimum,
the Public
Company Accounting Oversight Board (PCAOB) has specific
guidelines that auditors
must follow when an auditing a company’s financial statements
(http://pcaobus.org/Rules, 2016). Auditing is the process of
verifying accounting
14. information to ensure that the data is accurately presented.
However, because of the
increase in financial statement fraud, new regulations require
that auditors improve their
auditing procedures to detect the likelihood of fraud during an
audit (Kranacher et al.,
2011). To ensure auditors improve their ability to detect fraud,
The Statement on
Auditing Standard No. 99 (SAS No. 99) was enacted (AICPA,
2002). SAS No. 99
identifies the skills, provides the guidance, and identifies the
standards that auditors must
follow to plan and perform the audit to obtain reasonable
assurance about whether the
financial statements are free of material misstatement (AICPA,
1997). To obtain this
reasonable assurance, auditors must look for fraud throughout
the entire audit process.
8
Fraud is defined as an “intentional deception,” whether by
omission or co-
omission, that causes its victim to suffer an economic loss or
15. the perpetrator to realize a
gain (Kranacher, Wiley, & Wells, 2011, p. 5). Fraud can occur
in many forms, such as
check fraud, securities fraud, occupational fraud, and financial
statement fraud
(Kranacher, Wiley, & Wells). Financial statement fraud arises
from financial reporting
misstatements and from misappropriation of assets (Casabona &
Grego, 2003). To ensure
that public companies did not prepare fraudulent financial
statements, they are required to
have an annual audit that follows the policies and procedures of
SAS No. 99.
SAS No. 99, which was enacted in October 2002, and which
supersedes SAS No.
82 (Casabona & Grego, 2003). SAS No. 82 identified the
responsibilities of auditors in
evaluating the risk of material financial misstatements due to
fraud, whereas as SAS No.
99 identifies how auditors plan the audit in response to the risk
identified (Whittington, &
Landsittel, 2001). SAS No. 99 does not change the auditors’
responsibility to detect
fraud; nonetheless, it is an improved version of SAS No. 82
16. because it provides
additional guidance on how auditors should plan and perform
the audit to detect fraud
(AICPA, 2002).
One of the major components of SAS No. 99 is the fraud
triangle. The fraud
triangle was developed by Donald Cressey (1953), an American
criminologist and
sociologist who conducted extensive research on the mindset of
white-collar criminals.
Cressey’s research led him to develop the fraud triangle theory.
The theory articulates
three critical elements that must be present for a typical
individual to engage in fraud
(Kranacher et al., 2011). The three elements are perceived
opportunity, perceived
pressure, and rationalization (Kranacher et al., 2011).
9
Individuals can be pressured financially for many reasons, such
as poor credit,
living beyond one’s means, gambling, and drugs (Buchholz,
17. 2012). Individuals may
attempt to relive financial pressure by stealing from their
organization (Buchholz, 2012).
For example, the fraudster may obtain economic benefits by
stealing cash from an
organization. However, a fraudster cannot steal cash from the
company without having
the opportunity, which is another component of the fraud
triangle theory.
Opportunity is an element of the fraud triangle theory over
which companies have
the most control. Companies have control over opportunity
because the opportunity to
commit fraud is determined by the company’s internal control
structure. Therefore, if a
company creates a secure internal control structure, it will
reduce the opportunity for
fraud to occur. To create a secure internal control structure, a
company must design the
appropriate policies and procedures. If a company’s internal
controls are not properly
designed, these internal controls can be compromised
(Buchholz, 2012). To illustrate, if a
company keep checks or cash in an unsecure location, the
18. opportunity for an employee to
steal the cash or checks is present.
The last component of the fraud triangle theory is
rationalization, which is the
process of a fraudster justifying his or her actions for doing
wrong (Kranacher et al.,
2011). Rationalization may include thoughts such as
dissatisfaction with the company
because of poor working conditions, low wages, unreasonable
working hours, or lack of
health insurance. During rationalization, the fraudster comes to
believe that he or she is
entitled to steal because of dissatisfaction with the company
(Bucholz, 2012).
10
Background
The fraud triangle is a theory that auditors rely on when
assessing a company’s
vulnerability to financial statement fraud. The fraud triangle
19. theory is the underlying
principle of SAS No. 99; however, eleven years after the
implementation of SAS No. 99,
financial statement fraud still remains undetected. Claims have
proven that from 2002 to
2008, undetected fraud increased from 5% to 7% (Saksena,
2010). Based on this claim, it
is evident that fraud triangle theory has not improved auditors’
ability to assess a
company’s vulnerability to financial statement fraud. Therefore,
this study was important
because it will explain auditors’ perceptions of the effectiveness
of the fraud triangle
theory and clarify whether the fraud triangle theory should be
modified to include
motivation, integrity, and capability. If auditors are able to
detect fraud, it will improve
stakeholders; confidence in the financial statements they rely on
prior to investing in a
company.
The fraud triangle theory identifies opportunity, rationalization,
and pressure as
the underlying assumptions that auditors should consider when
assessing the likelihood
20. of fraud in an organization (Kranacher et al., 2011). Although
auditors rely on the fraud
triangle, some scholars believe that the theory is not sufficient
to determine the extent of
fraud in an organization (Dorminey et al., 2010; Kassem &
Higson, 2012; Kranacher et
al., 2011). The fraud triangle has deficiencies; therefore, it
should not be relied upon for
detecting financial statement fraud (Buchholz, 2012). One
deficiency is rationalization.
Rationalization is a deficiency because it cannot be observed,
meaning that an auditor
cannot observe how a person rationalizes their actions. The
fraud triangle lacks objective
11
criteria for identifying pressure and rationalization; therefore, it
is not effective in
determining fraud (Dorminey et al., 2010).
Kassem and Higson (2012) explained that because the fraud
triangle is ineffective
in detecting fraud, a new fraud triangle should be implemented.
21. To further study the fraud
triangle theory and its effectiveness, Kranacher, Riley, and
Wells (2011) wrote that to
improve auditor’s ability to detect the likelihood of fraud in a
company, the fraud triangle
should be expanded to include motivation. Kassem and Higson
(2012) suggested that the
fraud triangle is ineffective in detecting fraud and that a new
fraud triangle should be
implemented that includes motivation, integrity, and capability.
Statement of the Problem
SAS No. 99 was implemented on December 15, 2002 because of
scandals that
occurred at major corporations such as Enron and WorldCom
(Labaton, 2006). The
underlying principle of SAS No. 99 is the fraud triangle theory,
which is a framework
that assists auditors in analyzing a company’s vulnerability to
fraud. However, eleven
years after the implementation of SAS No. 99, much financial
statement fraud is still
undetected. Saksena (2010) claimed that from 2002 to 2008,
undetected fraud increased
22. from 5% to 7%, which results in billions of dollars in losses.
Based on this claim, it may
be that the fraud triangle theory has not improved auditor’s
ability to detect a company’s
vulnerability to financial statement fraud.
Buchholz (2012) explained that the fraud triangle has
importance for detecting
fraud in a financial statement audit, but that it also has
deficiencies and should not be
solely relied upon. Kassem and Higson (2012) suggested that
the fraud triangle is
ineffective for detecting fraud and that a new triangle should be
implemented that
12
includes motivation, integrity, and capability as additional
factors. The specific problem
that was the focus of this study, was the deficiencies in the
fraud triangle theory from
the perspective of U.S. auditors and what they believed should
be included for auditors to
better detect fraud. If this problem is not fixed financial
statement fraud will continue to
23. go undetected, which cost investors and creditors billions of
dollars of lost revenue.
Lastly, the economy will suffer if corporations do not have
access to cash to expand and
grow their business.
Purpose of the Study
The purpose of this qualitative phenomenological study was to
understand and
describe U.S. auditors’ perceptions of the effectiveness of fraud
triangle theory and to
explore whether the addition of new elements, such as
motivation, integrity, and
capability, would offer additional explanatory value to
understanding why fraud occurs.
Findings from the research questions may help auditors in
performing their duties to
detect whether financial statement fraud exists in an
organization.
The phenomenological study included face-to-face interviews.
The sample for this
study consisted of auditors who will be recruited from the
Georgia Society of CPAs,
Linked-in Group “Trendlines,” or from personal contacts. Data
24. was collected through in-
depth interviews with auditors who met the inclusion criteria for
the study. To ensure that
the questions were appropriate for this phenomenological study,
a colleague who is a
college professor and dissertation consultant was utilized. After
the questions were been
selected, interviews were conducted until data saturation
occurs; however, the minimum
number of interviews is six senior level auditors. Senior level
auditors are individuals
who have worked in auditing firms for a minimum of five years.
13
Theoretical Framework
The purpose of this phenomenological study was to understand
and describe U.S.
auditors’ perceptions of the effectiveness of the fraud tr iangle
in determining whether
fraud could exist in financial statements and to determine if
motivation, integrity, and
capability should be included in the fraud triangle. To
25. determine if financial statement
fraud has occurred, auditors must rely on the fraud triangle
theory, which is the
underlying principle of SAS No. 99 (Kranacher, Riley, & Wells,
2011). SAS No. 99
requires auditors to obtain reasonable assurance of whether the
financial statements
contain material misstatements (Casabona & Grego, 2003).
Cressey developed the fraud
triangle theory in 1953, and the theory has influenced the
development of accounting
fraud theory (Kranacher et al., 2011). The fraud triangle
identifies opportunity,
rationalization, and pressure as the underlying assumptions that
auditors should consider
when assessing the likelihood of fraud in an organization
(Kranacher et al., 2011).
Although auditors rely on the fraud triangle, some scholars
believe that the fraud
triangle is not sufficient to determine fraud in an organization
(Dorminey et al., 2010;
Kassem & Higson 2012; Kranacher et al., 2011) Buchholz
(2012) explained that the
fraud triangle has importance for detecting fraud in a financial
26. statement audit but that it
also has deficiencies and should not be solely relied upon. One
deficiency is
rationalization. Rationalization is a deficiency because it cannot
be observed, meaning
that an auditor cannot observe how a person rationalizes their
actions. The fraud triangle
lacks objective criteria for identifying pressure and
rationalization; therefore, the theory is
not effective in determining fraud (Dorminey et al., 2010). In
addition, Kassem and
14
Higson (2012) explained that because the fraud triangle is
ineffective in detecting fraud a
new fraud triangle should be implemented.
Currently, there is a contradiction in the literate on fraud
theory. Scholars such as
Dorminey et al. (2010), Kassem and Higson (2012), and
Kranacher et al. (2011) believe
that the fraud triangle is not sufficient to determine fraud in an
organization, whereas
27. Cressey (1953) believed fraud triangle theory to be effective in
detecting a company’s
vulnerability to financial statement fraud. Because of this
contradiction, further studies
are needed to understand auditors’ perceptions of the utility of
fraud triangle theory and if
motivation, integrity, and capability should be included in the
fraud theory.
To further study the fraud triangle theory and its effectiveness,
Kranacher, Riley,
and Wells (2011) wrote that to improve auditor’s ability to
detect the likelihood of fraud
in a company, the fraud triangle should be expanded to include
motivation. Kassem and
Higson (2012) suggested that the fraud triangle is ineffective in
detecting fraud and that a
new fraud triangle should be implemented that includes
motivation, integrity, and
capability.
To determine if financial statement fraud has occurred, auditors
must rely on the
fraud triangle theory, which is the underlying principle of SAS
No. 99. This
phenomenological study is a study of auditors’ perceptions of
28. the effectiveness of the
fraud triangle theory and if motivation, integrity, and capability
should be included in the
fraud triangle. Expanding research on auditors’ perceptions of
the fraud triangle theory is
important because it will benefit the auditing profession and the
approach that auditors
will use to determine if fraud exists in financial statements.
15
Research Questions
The purpose of this phenomenological study was to understand
auditors’
perceptions of the fraud triangle theory and if motivation,
integrity, and capability should
be included in the fraud theory. To accomplish this purpose, the
following research
questions were developed.
Q1. How do auditors perceive and describe their experiences
with fraud and the
use of the fraud triangle theory?
29. Q2. Do you think motivation, integrity, and capability should be
included in the
fraud triangle theory? If so, why?
Q3. Do you think there are other elements that auditors should
be include in the
fraud theory? If so, why?
Nature of the Study
The purpose of this phenomenological study was to understand
auditors’
perceptions of the fraud triangle theory. To accomplish this, a
phenomenological
approach was utilized to understand auditors’ lived experiences
of utilizing the fraud
triangle theory. As identified by Moustakas (1994),
phenomenology derives its meaning
from human experiences by exploring the structures of human
consciousness in those
experiences.
This phenomenological study on auditors’ experiences with
fraud included a
transcription of interviews and analysis (Van Manen, 1997). An
issue that is of major
debate in phenomenological research is how many participants
30. should be included in a
phenomenological study. In a phenomenological study, the
number of participants is not
as important as who has had a particular experience (Giorgi,
2009). A researcher should
16
use at least three participants because of the challenges
associated with using one or two
participants (Giorgi, 2009). It is important to have a “sufficient
number of variations
independent of the individual whose description is being
analyzed” (Giorgi, 2008, p. 36).
A researcher should recognize that data saturation occurs when
an increase in the
number of participants leads to diminished returns and lack of
new data (Giorgi, 2008).
Finally, a phenomenological study focuses on depth strategies
and should not be
confused with research based upon sampling strategies, which
includes a large number of
participants. An acceptable sample size for phenomenological
research is generally 2 to
31. 10 participants (Boyd, 2001; Giorgi, 2009).
For this phenomenological study, six certified public
accountants who worked for
various accounting firms were interviewed. The certified public
accountants was selected
and recruited at the Georgia Society of CPAs meetings, by the
Linked-in group
“Trendline,” or through relationships built with CPAs over the
last ten years. Data for this
study was gathered through face-to-face semi-structured
interviews, which is an
appropriate method when conducting a phenomenology study.
Semi-structured
interviews were selected for this study because structured
questions allow the scholars to
ask specific questions and unstructured interviews allow
participants to speak freely (Van
Manen, 1997). Speaking freely provides more richness and
breath, which provides more
richness to the data compared to structured interviews (Van
Manen, 1997).
Significance of the Study
Currently, no study was conducted to understand auditors'
32. experiences with fraud
and their perceptions of the of the fraud triangle theory, and if
auditors believe that
motivation, integrity, and capability should be added to the
fraud theory. Conducting this
17
study will benefit auditors because it will identify what auditors
should look for when
assessing the likelihood of financial statement fraud. This study
will also benefit
stakeholders such as investors and creditors because their
confidence in the reliability of
financial statements will increase if auditors are able to improve
their auditing procedures
to detect financial statement fraud.
If this study was not conducted, auditors may not detect whether
fraud exists,
which could cost investors, creditors, and accounting firms
billions of dollars. In addition,
legal action can be brought against auditors if fraudulent
financial statements are
33. undetected during an audit (AICPA, 2002). The discoveries
from this phenomenological
study will have a significant impact on how auditors assess the
likelihood of fraud during
a financial statement audit.
Definition of Key Terms
Understanding the key terms is important to this study;
therefore, a list of words
and definitions that are common to this study are included in
this section.
Analytical Procedures. Analytical Procedures is a diagnostic
sequential and
iterative process involving hypothesis generation, information
search, hypothesis
evaluation, and a final judgment (Koonce, 1993).
Audit evidence. Auditors conduct audits to obtain reasonable
assurance on
whether the financial statements are free of material
misstatements (Kranacher et al.,
2011).
Auditing. Auditing is an examination by auditors to determine if
financial
statements fairly present the company’s result and financial
34. position (Kranacher et al.,
2011).
18
Brainstorming. Brainstorming is a discussion by an audit team
to discuss the
probability that material misstatements could exist in a
company’s financial statements
(Alon & Dwyer, 2010).
Cressey’s Fraud Triangle. Cressey’s Fraud Triangle Is a theory
that identifies
the three conditions that is generally present when fraud occurs.
The three conditions are
perceived opportunity, perceived pressure, and rationalization
(Kranacher et al., 2011).
Financial Statement Fraud. Financial Statement Fraud is an
intentional
misrepresentation of financial or nonfinancial information to
mislead others who are
relying on it to make economic decisions (Kranacher et al.,
2011).
Fraud. Fraud is “an intentional deception, whether by omission
35. or co-omission,
that causes the victim to suffer an economic loss and/or the
perpetrator to realize a gain”
(Kranacher, Wiley, & Wells, 2011, p. 5).
Professional Skepticism. Professional Skepticism is an auditor’s
judgment and
decision that reflects a heightened assessment of the risk that an
assertion is incorrect or
conditional based on the information available to the auditors
(Nelson, 2009).
Risk assessment. In the literature, this refers to an
understanding that auditors
conduct audits to obtain reasonable assurance on whether
financial statements are free of
material misstatements (Kranacher et al., 2011).
Statement on Auditing Standards 99 (SAS No. 99). Statement on
Auditing
Standards 99 (SAS No. 99) is an auditing standard that states
that an audit should be
planned and performed to obtain reasonable assurance that
financial statements are free
of material misstatements, whether caused by error or fraud
(Kranacher et al., 2011).
36. 19
Summary
SAS No. 99 was implemented December 15, 2002 because of
scandals that
occurred at major corporations such as Enron and WorldCom.
The underlying principle
of SAS No. 99 is the fraud triangle theory, which is meant to
assist auditors in detecting a
company’s vulnerability to financial statement fraud. SAS No.
99 requires auditors to
obtain reasonable assurance on whether the financial statements
contain material
misstatements (Casabona & Grego, 2003). To obtain reasonable
assurance, auditors rely
on the elements of the fraud triangle theory; the three elements
are perceived opportunity,
perceived pressure, and rationalization (Kranacher et al., 2011).
Although the fraud
triangle theory is relied upon to detect fraud, many scholars
believe that the theory is
inadequate. University Professors Kassem and Higson (2012)
suggested that the fraud
37. triangle is ineffective in detecting fraud and that a new fraud
triangle should be
implemented that includes motivation. The problem is the
likelihood that auditors’
reliance on the fraud triangle will not detect fraud in an
organization, which could cost
investors and creditors billions of dollars. Currently, no study
was conducted to
determine auditors’ perceptions of the fraud triangle theory,
however. This study was
significant because it will explain auditors’ perceptions of the
fraud triangle theory,
which is important when conducting a financial statement audit.
Following is Chapter 2, which is a literature review. The
purpose of this literature
review was to establish a framework for the effectiveness of the
fraud triangle theory and
to determine if it should be modified to include additional
elements. Specifically, this
literature review discussed the fraud triangle theory, the
underlying principles of SAS
20
38. No.99, analytical procedures, professional skepticism,
brainstorming, risk assessment,
and audit evidence.
21
Chapter 2: Literature Review
The purpose of this phenomenological study is to understand
auditors’
perceptions of the effectiveness of the fraud triangle theory and
to determine if
motivation, integrity, and capability should be included in the
theory. This literature
begins with the identification of fraud triangle theory, which
emphasizes opportunity,
pressure, and rationalization, the underlying principles of SAS
No. 99. This is followed
by a discussion of the various viewpoints of scholars who
conducted extensive research
on the fraud triangle theory. Lastly, analytical procedures,
professional skepticism,
39. brainstorming, risk assessment, and audit evidence, which are
necessary to understand
SAS No. 99 and its affects the fraud triangle theory, are
explained.
Documentation
Research on SAS No.99 and the fraud triangle theory was
conduct utilizing online
resources and key words. The key word search for this study
was: the fraud triangle
theory, SAS No.99, brainstorming, Risk Assessment, Analytical
Procedures, Professional
Skepticism, Statement on Auditing Standards, internal control,
and Professional
Skepticism. To search for the keywords, online libraries were
utilized; the online libraries
included EBSCOhost and ProQuest databases. EBSCOhost
Business Source is a database
that provides full texts of more than 3,000 journals, including
more than 1,500 peer-
reviewed business publications, and full texts of over 10,000
market reports, SWOT
analyses, country and company reports, etc. The ProQuest
database contains full-text,
40. scholarly, peer-reviewed journals, trade publications,
magazines, and newspapers in the
areas of business, psychology, and education. In addition to
online libraries, professional
accounting websites such as the American Institute of CPAs and
the Fraud Examiner
22
Website were utilized. The information gathered from the online
libraries and
professional websites includes scholarly and peer-reviewed
documents, professional
journals, periodicals, textbooks, and the American Institute of
CPAs.
Fraud Triangle
Fraud is an intentional misstatement attained by manipulation or
falsification of
accounting data, misrepresentation or omission of accounting
transactions, and
intentional misapplication of accounting principles (Kranacher
et al., 2011). SAS No. 99
explains that auditors have a responsibility to detect fraud in an
organization and should
41. rely on the fraud triangle to do so (Kranacher et al., 2011).
Donald Cressey developed the
fraud triangle theory in 1953. Cressey identified three
conditions that are generally
present when fraud occurs in an organization. The three
conditions are perceived
opportunity, perceived pressure, and rationalization (Kranacher
et al., 2011; Romney,
Albrecht, & Cherrington, 1980).
Perceived pressure. Perceived pressure is considered a non-
observable event and
non-sharable problem. Perceived pressure is considered a non-
observable event because
it is difficult for an auditor to observe if an employee is under
pressure. Perceived
pressure is categorized as a non-sharable problem because a
fraudster may not want to
share his or her financial problems, such as gambling
addictions, alcohol addiction, or
work related pressures with family and friends (Dorminey et al.,
2010). The four major
categories of pressure are financial pressure, vice pressure, and
work related pressures.
42. Each of these four types of pressure will be discussed in detail.
Financial pressure can occur for various reasons. Fist, financial
pressure can occur
if an individual lives beyond their monetary means (Dorminey
et al., 2010; Kassem &
23
Higson, 2012; Kranacher, et al.). Living beyond one’s means
can ensue if the individual
purchases items such as a home and or a vehicle and their
monthly income are less than
their monthly expenses. As a result, the individual is under
financial pressure and may
resort to fraud to meet their monthl y expenses. As a previously
stated, individuals under
financial pressure generally do not want to share their problems
with family or friends;
for these reasons, financial pressure is often classified as a non-
sharable event (Dorminey
et al., 2010; Kassem & Higson, 2012; Kranacher et al., 2011).
Also, when financial
pressure stems from an individual living beyond their means, it
is categorized as an
43. unobservable event because auditors cannot observe if an
individual is living beyond
their means (Dorminey et al., 2010; Kassem & Higson, 2012;
Kranacher et al., 2011).
Vices such as gambling or drug addiction can also cause
individuals to have
financial pressure (Dorminey et al., 2010; Kassem & Higson,
2012; Kranacher, et al.,
2011). Indeed, vices such as drug addiction or gambling are the
worst types of financial
pressures, ones that often spiral out of control (Kassem &
Higson, 2011). Because of
addiction, it is very easy for an individual to excuse stealing
from their organization.
Again, this type of financial pressure is a non-sharable event
that a fraudster would not
want to share with family members because of the fear of being
judged or pressured into
seeking medical attention (Kassem & Higson, 2011). In
addition, this type of event is
considered a non-observable event because an auditor may not
be able to observe
whether an individual has a gambling problem or any other type
of addiction. However,
44. an auditor may be able to observe if an individual has an
alcoholic addiction if the
individual comes to work intoxicated during the audit.
24
In addition, work related pressure can cause and individual to
commit financial
statement fraud. Although not as common as financial pressures
such as living beyond
one’s means or vices, which include gambling or drug/alcohol
addictions, work related
pressures do occur in companies. Work related pressure happens
when employees are
disgruntled with their employers so they commit fraud as a form
or retaliation.
Employees may become disgruntled because they are passed up
for a promotion, did not
receive a raise, or have job dissatisfaction (Kassem & Higson,
2011). This type of
pressure is categorized as a non-observable event because an
auditor may not know that
an employee was overlooked for a promotion.
45. Lastly, management could be under pressure or have an
incentive to misstate
financial information because of factors outside their control
(Ramos, 2009). Factors
outside of management control are economic and industry
circumstances. To illustrate, if
a company is experiencing financial difficulties because the
economy is in a recession,
the fraudster may feel compelled to commit fraud. The fraudster
could be compelled to
commit fraud so that the company does not incur an operating
loss, which could lead to
corporate bankruptcy or a hostile takeover by stakeholders and
regulatory agencies
(Ramos, 2009).
In addition, management could be under extreme pressure to
meet or exceed the
expectations of current or future stakeholders. Current
stakeholders include investors who
expect the stock value to appreciate or creditors who expect the
company to be profitable
so that interest and loans can be repaid. Therefore, if
management is seeking debt
46. financing from a bank, management may feel pressured to
prepare fraudulent financial
statements (Ramos, 2009). Debt financing includes loans such
as bonds payables, notes
25
payable, or accounts payable that must be repaid. In addition,
management may feel
pressured to prepare fraudulent financial statements to meet
stock market demands
(Ramos, 2009). This pressure stems from the fact that
stockholders analyze a company’s
financial statements prior to investing in a company. Thus, if a
company does not appear
profitable, investors will not invest in the company or current
shareholders will sell their
stock in the company.
To conclude, management could have a personal incentive to
prepare fraudulent
financial statements because most corporations determine
management quarterly and
annual bonuses based on the company’s financial statements.
Lastly, bonuses that are
47. connected to a company’s financial performance are an
incentive for management to
engage in financial statement fraud ("Section 404(b) of
Sarbanes-Oxley Act of 2002").
Perceived Opportunity. Perceived opportunity is considered an
observable event
because opportunity relates to an organization’s internal control
structure, which can be
observed by auditors (Dorminey et al., 2010). A fraudster’s
opportunity could be the
result of poor training, poor supervision, poor policies and
procedures, or lack of anti-
fraud programs (Dorminey et al., 2010). For example, if an
auditor audits a company’s
cash disbursements and observes that multiple people can
disburse cash without
preparing proper documentation of who dispersed the cash, who
received the cash, and
the amount of the cash, the company is lacking good internal
controls over the cash
disbursements. Because the company lacks good internal
control, the employee has the
opportunity to commit fraud. Alexander (2012) states that the
laxer a company’s internal
48. control systems are, the better the opportunity for fraud to
occur. However, Alexander
(2012) also states that a secure internal control system does not
prevent fraud, but it will
26
reduce the likelihood of fraud or make it more difficult for a
fraudster to commit fraud.
This is an example of how the fraud triangle is ineffective in
detecting fraud, and it
supports Dorminey et al.’s (2010) suggestion that a new fraud
model be implemented.
Rationalization. Rationalization occurs when the fraudster
justifies his or her
behavior before or after committing the act (Dorminey et al.,
2010). This is considered a
non-observable event because an auditor cannot observe what a
fraudster is thinking. To
illustrate, the fraudster may rationalize stealing cash by saying,
“I will pay the cash
back.” Because pressure and rationalization cannot be observed,
the fraud triangle is
49. considered inadequate for deterring, preventing, and detecting
fraud (Dorminey et al.,
2010).
Fraud Triangle is Ineffective. The current literature states the
fraud triangle is
ineffective in detecting the likelihood of fraud in an
organization (Dorminey et al., 2010;
Kassem & Higson, 2012; Kranacher, et al., 2011; Alexander,
2012). Since the fraud
triangle is ineffective in detecting fraud, Kassem and Higson
(2012) designed a new
model for use in detecting fraud in an organization. They noted
that the new model
should be an extension of Cressey’s fraud triangle to include the
fraudster’s motivation,
integrity, and capabilities because these are observable events.
Integrity can be observed
by reviewing an individual’s decisions and decision-making
process, which help assess
the likelihood that an individual could commit fraud (Kassem &
Higson, 2011). To
illustrate, if an individual does not follow the company’s credit
policy when extending
credit to customers, that individual lacks integrity. Motivation
50. is also an event that can be
observed by examining an individual’s non-shareable financial
problems. The observable
non-sharable financial problems described by Kassem and
Higson (2012) include living
27
beyond one’s means, an overwhelming desire for personal gain,
high personal debt, a
close association with customers, and excessive gambling
habits. Lastly, Kassem and
Higson (2012) argued that fraud could not occur without the
person having the
capabilities to commit fraud. They suggested four observable
traits that give the fraudster
the capabilities: an authoritative position or function within the
organization, the capacity
to understand and exploit accounting systems, internal control
weaknesses, and the
capability to deal with the stress of being caught.
The Pathway that Leads to Fraud. In addition to the Kaseem and
Higson (2012)
51. model, Murphy and Dacin (2011) identified the pathway that
leads to fraud. The
psychological pathways focus on individuals who believe that
committing fraud is
wrong; the three components of the pathway that lead to fraud
are awareness, intuition
coupled with rationalization, and reasoning. The pathway that
leads to fraud is helpful
because it explains that individuals may commit fraud without
realizing it and rationalize
their acts to avoid the negative affect of their unethical behavior
(Murphy & Dacin,
2012). The pathway also states that awareness includes the
overpowering situations or
contexts in which the individual makes a decision to commit or
not commit the act; the
fraudster is aware of the fraudulent situation and decides
whether to commit fraud
(Murphy & Dacin, 2011). In other words, the individual may
commit the act and then
rationalize why it is okay to commit the act.
Intuition coupled with rationalization happens when the
fraudster is aware that the
conduct in question is fraudulent (Murphy & Dacin, 2011).
52. During this phase, an
individual makes a decision to commit the act or refrain from
committing the act based
28
on his or her feelings. If the individual decides to commit the
crime, the fraudster
immediately rationalizes why it is okay.
The third pathway to fraud is reasoning, which occurs when an
individual is
aware that the act is fraudulent (Murphy & Dacin, 2011).
During this phase, the fraudster
analyzes the situation and applies reasoning to why he or she
should or should not
commit the fraud. In addition, the fraudster may analyze the
situation. For example, the
fraudster may analyze the situation by performing a cost benefit
analysis to determine if
the benefit of the fraud outweighs the cost.
The M.I.C.E. Theory. Another point of view that differs from
the traditional
fraud triangle and the pathway that leads to fraud is the
53. M.I.C.E. theory (Kranacher,
2011). The fraud triangle does not explain the motivation of the
fraudsters, so to fully
understand motivation it should be expanded to include
M.I.C.E. theory (Dorminey et al.,
2012). M.I.C.E is an acronym that identifies what might
motivate the fraudster to commit
fraud:
M - Money. This means that an individual may commit fraud for
money.
I - Ideological. This means that an individual may commit fraud
because he or she
believes it for a greater cause (Dorminey et al., 2012). The
fraudster may not
personally benefit, but others will benefit. To illustrate,
individuals may commit
fraud by stealing cash and may give the cash to underprivileged
citizens. In this
this case, the fraudster committed fraud to benefit a greater
cause.
C – Coercion. This occurs when an individual is unwillingly
pressured into a
fraud scheme (Dorminey et al., 2012). To illustrate, an
accounting manager may
54. be forced by his or her manager to write checks to a supplier
who does not exist.
29
E – Ego. In these situations, individuals will commit fraud to
maintain an image
or lavish lifestyle (Dorminey et al., 2012). For example, an
individual may
purchase an expensive automatable on company credit to
maintain his or her
image.
Krancher states that money and ego are the main reasons
fraudsters are motivated to
commit fraud (Dorminey et al., 2012).
The fraud triangle lacks the ability to detect pressure and
rationalization, so
Dorminey et al. (2010) referred to a new fraud triangle
consisting of the act, the
concealment, and the conversion (Dorminey et al., 2010). The
new fraud triangle should
focus on establishing whether the act committed constitutes
fraud, which can be
55. determined by gathering evidence of the intent to deceive and
by proving that the victim
incurred economic damages (Dorminey et al., 2010). Because
the fraud triangle was
unable to detect fraud, the fraud scale and the fraud diamond
were introduced. The fraud
scale and fraud diamond include additional variables that are
not included in Cressey’s
Fraud triangle (Kranacher et al., 2011; Wolfe & Hermanson,
2004).
The Fraud Scale. The fraud scale is applicable to financial
statement fraud,
where sources of pressure are observable. The only difference
between the fraud triangle
and the fraud diamond is an individual’s capabilities.
Capabilities refer to an individual’s
traits and abilities to commit the crime (Wolfe & Hermanson,
2004). Capabilities may
overlap with opportunity, but the two are different because
opportunity focuses on
weaknesses in internal control while capabilities focus on
whether the employee is
capable of committing the act (Wolfe & Hermanson, 2004). To
illustrate, if a company
56. has cash transactions and there is a weakness in the internal
control system, the
30
opportunity for fraud exists and a capable person may steal the
cash. In this example, the
employee’s capabilities coupled with a weak internal control
system could lead the
employee to commit fraud. Wolfe and Hermanson (2004)
identified five traits that make
an individual capable of committing fraud, as follows:
1. The person(s) must be smart enough to understand internal
control weaknesses
and use this knowledge to exploit the system.
2. The right person must have the ego and confidence to believe
that he or she will
not be discovered or the confidence to believe that, if
discovered, he or she will be
able to talk their way out of trouble.
3. The right person must be able to coerce others to commit or
conceal fraud.
57. 4. The right person can lie effectively and consistently.
5. The right person can deal with stress.
Wolfe and Hermanson (2004) believed that auditors must
understand the
fraudster’s capabilities when assessing the likelihood of fraud
in an organization and that
without such assessment fraud may go undetected. Based on the
research of Wolfe and
Hamason (2004), the fraud triangle should include capabilities
when determining the
likelihood of fraud in an organization.
Dorminey et al. (2010) disagreed that the fraud triangle is
effective in determining
fraud, but Hogan, Rezaee, Riley, and Velury (2008) stated that
there is a significant
amount of literature that supports the fraud triangle. The
authors explained that red flags
and analytical procedures should be used with the fraud triangle
to detect fraud in an
organization (Mcfarland, 2009). They stated that auditors
should use a checklist as a
starting point to detect fraud but that it should be used with
caution because a checklist is
58. 31
not indicative of fraud. Some researchers support the use of
checklists as decision tools
(Hogan, Rezaee, Riley, & Velury, 2008) and some suggest that
the use of checklists
limits the auditors’ ability to increase their thinking beyond the
checklist (Pincus, 1989).
For example, Pincus's (1989) findings suggest that the use of a
checklist was
dysfunctional for fraud findings because red flags may be low
in frequency and minor in
amount in the early stages of fraudulent financial reporting.
Wilks and Zimbelman (2004)
agreed with Picus (1989), stating that the checklist inhibits
strategic reasons due of the
following:
1. Long checklists tend to be inaccurate in assessing fraud risk;
2. Auditors are insensitive to new evidence;
3. Auditors overweigh clues about management that are likely to
be wrong; and
4. Auditors use procedures that are based on prior audits, which
59. make audits
predictable and less effective.
Given the findings of Pincus (1989) and Wilks and Zimbelmam
(2004), Hogan’s (2008)
recommendation of the use of a checklist in financial statement
audits is a controversial
topic.
Hurley and Boyd (2007) suggested another element for fraud,
which is the
perception of impunity. Impunity is the fraudster’s belief that
he or she can commit fraud
without the fraud being detected and that he or she is excused
from punishment. The
attitude of impunity leads to another element of fraud, which is
manipulation (Giroux,
2008; Hurley & Boyd, 2007). Manipulation is the fraudster’s
belief that if the fraud is
detected he or she will be able to convince others that he or she
is innocent (Giroux,
2008).
32
60. Buchholz (2012) conducted research deconstructing the
underlying principles of
the fraud triangle, which are opportunity, rationalization, and
pressure. Upon
deconstruction, the author identified the pitfalls that auditors
encounter when assessing
fraud in an organization. The author concluded by stating that
practitioners should not
rely solely on the Cressey’s Fraud triangle as the basis for
assessing and detecting
potential fraud in the audit of financial statements. The results
of Buchholz’s (2012)
research are consistent with the results of the studies of
Dorminey et al. (2010), Kassem
and Higson (2012), and Kranacher et al. (2011), who also stated
that the fraud triangle is
ineffective in determining the likelihood of fraud in an
organization.
Donald Cressey - Trust Violators. Donald Cressey, a
criminologist, was
interested in why people commit fraud, so he conducted a five-
month study in which he
interviewed over 250 criminals who had committed financial
fraud (Cressey, 1973). The
61. participants selected for the study was criminals who met the
following two criteria
(Cressey, 1973):
1. The fraudster had a job position of trust and good faith; and
2. The individual violated the trust.
Cressey defined a trust violator as follows:
Trusted persons become trust violators when they conceive of
themselves as
having a financial problem which is non-shareable, are aware
this problem can be
secretly resolved by violation of the position of financial trust,
and are able to
apply to their own conduct in that situation verbalizations which
enable them to
adjust their conceptions of themselves as trusted persons with
their conceptions of
themselves as users of the entrusted funds or property. (Cressey,
1973, p. 30).
33
Most trust violators have a non-shareable problem (Cressey,
62. 1973). A non-sharable
problem means that the fraudsters believe they cannot share
their problem(s) with family
or friends because they would lose respect of family and friends
or their prestige in the
community (Cressey, 1973). To illustrate, if a fraudster has the
image of being a great
leader, financially successful, and well respected in the
community, the fraudster may not
want to share his or her financial problems with family or
friends in fear of losing his or
her image of a successful person. To avoid losing this image,
the fraudster will not share
his or her financial problems and will resort to illegal activity
to resolve them (Clinard,
1954).
A trust violator is an individual with three characteristics: non-
sharable problems,
technical knowledge/skills, and verbalization (Cressey, 1973).
Non-shareable problems
are problems that a trust violator does not want to share with
family or friends. Non-
sharable problems lead to fraud, whereas shareable problems do
not lead to fraud
63. (Cressey, 1973). Shareable problems generally do not lead to
fraud because the individual
under pressure is willing to share their problems, which
indicates that the individual is
willing to seek help to resolve financial problems.
Another characteristic of a trust violator is that the trust
violator must have the
technical knowledge to carry out the fraud. The trust violator
believes that their non-
shareable financial problems could be resolved covertly, and no
one learns of these
financial problems because of their technical knowledge of the
company (Clinard, 1954;
Cressey, 1950). To gain this knowledge to perpetrate the fraud,
the fraudster must have
work experience in the company and must understand the work
environment (Cressey,
1950). To illustrate, if an individual works in the accounting
department and understands
34
the accounts payable system and the vendor system, he or she
64. could set-up fictitious
vendors and send payments to a bank account that he or she has
access to.
The final characteristic of a trust violator is rationalization,
which is how the trust
violators mentally justify their actions. Rationalization is
necessary for the trust violator
to perform the fraud because, without rationalization, the trust
violator will be reluctant to
perform the fraud. To illustrate, if individuals believe that
stealing from their company is
wrong, they may not steal unless they can rationalize the
stealing. Rationalization could
include such thoughts as, I am not paid enough money, so the
company owes me this
money, I will return the money on my next paycheck, or The
company will not miss the
money. Lastly, trust violators rationalize their actions to avoid
accepting the fact that
their actions are theft and constitute a crime.
The three characteristics of trust violators are known as the
fraud triangle theory.
Whenever all three of the characteristics are present, fraud can
occur, and if one of the
65. characteristics is missing, the trust violator will not commit
fraud (Cressey, 1973).
Although Cressey’s fraud triangle is embraced by many
scholars, some disagree with the
fraud triangle theory because pressure and rationalization
cannot be observed. To
illustrate, pressure is an emotion that an individual has, and
auditors cannot observe
pressure because it is a state of mind. In addition,
rationalization is how a person thinks
about a crime and justifies their actions prior to committing the
crime. Again,
rationalization is a state of mind and, therefore, unobservable
by auditors. Most trust
violators know their conduct is illegal and wrong, but they
convince themselves into
thinking that their actions are not illegal (Cressey, 1973).
Because pressure and
35
rationalization cannot be observed, the fraud triangle theory is
flawed and, therefore,
66. should not be relied upon (Cressey, 1973)
Pressure and rationalization cannot be observed; however,
opportunity can be
(Cressey, 1973). Opportuni ty can be observed because it relates
to a company’s internal
control structure, which can be observed by auditors. Internal
control is the policy and
procedures that companies have in place to safeguard their
assets and to reduce the
probability of a trust violator stealing from their company. The
probability of a trust
violator stealing from a company depends on whether the
company has a strong or weak
internal control structure. A weak internal control structure
generally occurs when a
company has poor training, poor supervision, or lack of anti -
fraud programs (Dorminey
et al., 2010).
The Public Accounting Oversight Board states that companies
must design
policies and procedures for internal control over financial
reporting to provide reasonable
assurance concerning the accuracy of a company’s financial
statements. To provide
67. reasonable assurance that the financial statements are prepared
accurately, the financial
statements must meet the following requirements:
1. Financial transactions provide accurate information on the
transactions and
disposition of assets;
2. Provide reasonable assurance that accounting transactions
such as revenues,
expenses, assets, liabilities, and capital are recorded as
necessary and in
accordance with generally accepted accounting principles;
3. Provide reasonable assurance that the company has
procedures in place to
prevent or identify any unauthorized purchases of assets, uses
of assets, or
36
disposal of assets that have a material impact on the company’s
financial
records (PCAOB, 2007).
Lastly, if managers fail to follow any of the three requirements
68. previously
mentioned when preparing financial statements, the financial
statements cannot be relied
upon. As a result, there is a weakness in the internal control
structure over financial
reporting that should be reviewed (PCAOB, 2007).
Following is an example of a transaction where there was a
weakness in a
company’s internal control structure. If a company has a policy
that requires all purchases
over 25,000 to be approved by senior management and a
manager makes a purchase for
30,000 without senior management approval, this is an
indication that there was a
weakness in the internal control structure and that the
transaction violates PCAOB, 2007,
which states that companies must have procedures in place to
prevent and identify any
unauthorized purchases of assets, uses of assets, or disposal of
assets that have a material
impact on the company’s financial records. Therefore, to
prevent unauthorized purchase
from occurring, every purchase should require the signature of
at least two mangers,
69. which helps prevent unauthorized purchases from occurring.
Brainstorming
SAS No. 99 requires auditors to obtain reasonable assurance
through
brainstorming that financial statements are free of material
misstatements. Brainstorming
in a financial statement audit involves the audit team discussing
the probability that
material misstatements due to fraud are present in the financial
statements (Alon &
Dwyer, 2010). SAS No. 99 specifically states that the audit
team should brainstorm
during the initial audit to assess the probability that material
misstatements due to fraud
37
could be present ("Section 404(b) of Sarbanes-Oxley Act of
2002 "). Brainstorming also
encourages auditors to share client data and experiences to gain
a better understanding of
the possibility that fraud could be present in the financial
70. statements (Alon & Dwyer,
2010). Brainstorming is defined as a “generation of ideas by one
or more individuals
given a specific task to brainstorm, listing all of the risks that
are relevant for a given
case” (Carpenter, Reimers, & Fretwell, 2011).
Although brainstorming is required by SAS No. 99, some critics
believe that
brainstorming is not effective. Brainstorming could waste time
if procedures are not in
place for conducting brainstorming sessions (Sandberg, 2006).
However, some
researchers believe that no matter how well the brainstorming
session is planned, group
brainstorming is not as effective as individual brainstorming.
For example, Paulus, Larey,
and Ortega (1995) conducted a study on brainstorming in groups
and individuals
brainstorming alone. The results of the study indicated that
brainstorming in groups was
50% less effective than an individuals’ performing alone
(Sandberg, 2006). Interactive
groups (brainstorming groups) provide fewer ideas than nominal
groups (Osborn, 1957;
71. Sandberg, 2006).
In recent years, most of the brainstorming literature has
concentrated on the
inferiority of interacting with groups in an effort to understand
why productivity losses
occurred in groups. Three characteristics that cause inferiority
of interacting in groups are
the following: production blocking, evaluation apprehension,
and free riding or social
loafing (Dennis & Valacich, 1993). Production blocking occurs
because only one
member can communicate at once (Dennis & Valacich, 1993).
For example, if a member
is communicating and other members are listening, the listening
members may forget
38
their ideas before they get the opportunity to speak. Evaluation
apprehension involves a
group member’s concern over the appraisal by other members in
the group (Dennis &
Valacich, 1993). To illustrate, if a group member has an idea
72. that he or she is not sure of,
the member may be afraid to share that idea because of
apprehension of what other group
members may think. Finally, free riding, or social loafing,
occurs when group members
are qualified to contribute to the brainstorming session but
choose not to contribute
(Dennis & Valacich, 1993). This may occur because individuals
are relying on others to
contribute or members are socializing about issues unrelated to
the problem.
As previously stated, research indicates that brainstorming in
groups was 50%
less effective than an individual who performed brainstorming
alone. In addition, groups
provided fewer ideas than did individuals brainstorming alone
(Osborn, 1957; Sandberg,
2006). However, other researchers believe that brainstorming
groups are effective and
can benefit auditors. Landis and Braswell (2008) noted that
brainstorming groups are
useful and can generate better ideas than individuals who
brainstorm alone. The
assumption is that brainstorming groups are given an ample
73. amount of time to
brainstorm. Landis and Braswell (2008) argued that if
brainstorming groups are allowed
enough time for a given topic, they are capable of generating as
many ideas as individuals
who brainstorm alone.
Landis and Braswell (2008) indicated that brainstorming
sessions are most
effective when they occur during the beginning of the audit
because they allow auditors
to plan and modify the audit as needed. However, SAS No. 99
requires brainstorming
sessions to occur throughout the audit to ensure any potential
areas of fraud are identified
and discussed. Brainstorming should be included throughout the
audit process and not
39
just during the initial phase of the audit because auditors may
become aware of
information that was not available during the initial audit
(Robert & Hahn, 2011).
74. Although there are contradictions in the literature on
brainstorming sessions, Landis and
Braswell (2008) stated that brainstorming sessions could be
particularly useful tools for
auditors to provide reasonable assurance that financial
statements do not have material
misstatements due to fraud or error.
Professional Skepticism in Fraud Detection
SAS 82 was created to help auditors to detect fraud in an
organization; however,
as a result of accounting scandals that occurred with Enron and
WorldCom, SAS No. 99
was implemented ("Section 404(b) of Sarbanes-Oxley Act of
2002 "). SAS No. 99 states
that auditors should plan and perform their audits to obtain
reasonable assurance that the
financial statements are free of material misstatements caused
by error or fraud (Patrick
& Michael, 2003). SAS No. 99 suggests that auditors should use
professional skepticism
when conducting a financial statement audit. Professional
skepticism means that the
auditor assumes neither that management is dishonest nor
75. assumes unquestioned honesty
(Nelson, 2009).
Professional skepticism relates to auditors’ decisions and
judgments that reflect a
valuation of risk that an assertion is conditional or incorrect
based on the information
available to the auditors (Nelson, 2009; Payne & Ramsay,
2005). Auditor traits,
knowledge, and sensitivities produce judgments that determine
an auditor’s professional
skepticism (Nelson, 2009). Also, given a judgment that reflects
some level of
professional skepticism, the judgment combined with auditor
knowledge, traits, and
incentives produce actions that reflect professional skepticism;
without such, financial
40
statement fraud could go undetected (Nelson, 2009). The
viewpoint of Nelson is shared
by Payne and Ramsay (2005), who held that professional
skepticism is important and
76. insisted that auditors should have ongoing training to ensure
that they have the right skills
and professional skepticism to detect fraud in an organization.
To achieve professional skepticism, auditors must consider the
following four
categories: skepticism scales, problem-solving ability,
ethics/moral reasoning, and
problem-solving ability (Nelson, 2009). Problem solving
focuses on raw intelligence and
assists auditors in identifying potential misstatements in
financial statements (Nelson,
2009). Ethics or moral reasoning holds that auditors with high
moral standards are more
sensitive to information about client competence and integrity
and that moral
development increases with time (Nelson, 2009). Nelson (2009)
stated that skepticism is
difficult to assess because scales varied by the researcher. To
illustrate, Wrightsman
(1974) believed that people are trustworthy and independent;
however, Shaub (1996)
found no significant relationship between scores on
independence and trustworthiness.
While Nelson (2009) and Payne and Ramsay (2005) argued that
77. professional
skepticism is indicated by auditor judgments and decisions,
Hurtt (2010) noted that
auditors’ judgment could result in the auditors becoming too
skeptical. Nelson (2009)
acknowledged the Hurtt scale, which states that auditors could
become too skeptical and
over audit or too lax and perform inefficient audits.
To illustrate, if an auditor becomes skeptical of the accounting
manager, that
auditor may perform additional procedures to ensure the
financial statements are not
fraudulent. However, if the auditor is not skeptical, he or she
may perform an inefficient
audit, which could potentially result in fraudulent financial
statements going undetected.
41
Because of the possibility of auditors being too skeptical or not
skeptical enough, Hurtt
(2010) designed a 30-item psychological scale. The purpose of
the psychological scale is
78. to measure the level of skepticism possessed by an individual
auditor to determine if an
auditor will over audit or perform an inefficient audit. The
psychological scale is based
on the following six characteristics: a questioning mind, a
suspension of judgment, a
search for knowledge, interpersonal understanding, self-esteem,
and autonomy (Hurtt,
2010). Following is a brief discussion of the six characteristics
to measure an auditor’s
level of skepticism.
The first characteristic requires an ongoing questioning mind on
whether the
information and evidence obtained suggests that a material
misstatement due to fraud has
occurred ("Section 404(b) of Sarbanes-Oxley Act of 2002"). A
questioning mind is not a
lack of belief, but it initiates inquiry and leads to the formation
of beliefs (Hurtt, 2010).
The second characteristic is a suspension of judgment, meaning
that auditors
should withhold judgment until there is evidence on which to
base the judgment (Hurtt,
2010). This means that auditors must evaluate all available
79. evidence before making a
judgment on an organization’s financial statements.
The third characteristic is the search for knowledge, which
differs from a
questioning mind because the search for knowledge is
determined by an auditor’s
curiosity and urge to develop knowledge whereas a questioning
mind is based on an
auditor’s inquiry to form a belief (Hurtt, 2010).
The fourth characteristic is interpersonal understanding, which
focuses on the
individuals who provide evidence to auditors (Hurtt, 2010). In
other words, individuals
who have committed fraud may provide misleading evidence to
the auditor. Therefore,
42
the auditor must understand the integrity and motivation of the
individuals who provide
evidence.
The fifth characteristic is self-esteem, which affects an
individual’s ability to rely
80. on his or her own judgment. Hurtt (2010) stated that individuals
with low self-esteem
lack the ability to rely on their own judgments. The sixth and
last characteristic is
autonomy, meaning that auditors should thoroughly examine
evidence before rendering
an opinion on a company’s financial statements (Hurtt, 2010).
Analytical Procedures
SAS No. 99 requires auditors to obtain information to identify
the risk of material
misstatements due to fraud (SAS No. 99). To identify the r isk of
material misstatements,
auditors must perform analytical procedures. Analytical
procedures are diagnostic,
sequential, and iterative processes involving hypothesis
generation, information search,
hypothesis evaluation, and a final judgment (Koonce, 1993).
Analytical procedures
should be performed during a financial statement audit to
determine if there are
transactions that appear to be unreasonably high or low (Hayes,
2011). For example, if
accounts receivables in prior years were three million and the
81. current account receivables
are seven million, this could be an indication that the
organization is overstating accounts
receivables and revenue. During this phase, the auditor should
perform analytical
procedures to determine if the high account balance is related to
controls that could have
been overridden (Hayes, 2011).
As previously stated, Casabona and Grego (2003) agreed with
Hayes (2011) that
analytical procedures may be an indication of material
misstatements in financial
reporting. However, Casabona and Grego (2003) believed that
the information might
43
only provide a broad indication about whether a material
misstatement is present in
financial statements. This occurs because data is gathered at a
high level when auditors
initially perform analytical procedures. Casabona and Grego
(2003) argued that because
82. analytical produces are performed at a high level during the
planning stage, auditors
should perform reviews that are more detailed and that focus on
revenue recognition.
Casabona and Grego (2003) asserted that auditors should focus
on revenue
recognition because it is a major focus of SAS No. 99. SAS No.
99 states that auditors
should perform analytical procedures relating revenue to
unusual or unexpected
relationships involving revenue accounts ("Section 404(b) of
Sarbanes-Oxley Act of
2002"). Patrick and Michael (2003) conducted a study on
analytical procedures and
agreed with Casabona and Grego (2003) that auditors should
focus on revenue
recognition when performing analytical procedures.
Revenue recognition is of major concern because the Committee
of Sponsoring
Organizations Report revealed that 50% of frauds involve
overstated revenues, either by
reporting revenues prematurely or by creating fictitious revenue
transactions (Hogan,
Rezaee, Riley, & Velury, 2008). As SAS No. 99 explains,
83. Improper revenue recognition is presumed to be a fraud risk for
all industries and
for all companies. Therefore, audit engagement teams should
consider how
fraudulent revenue recognition might occur and, based on such
assessment, tailor
the audit procedures to address the specific identified risk
related to revenue
recognition (SAS No. 99, as cited in Casabona & Grego, 2003).
Alexander (2012) agreed with Casabona and Grego (2003) and
noted that during
the audit planning stage and final reporting, the auditor should
focus on any material
44
transactions, such as revenue. Revenue recognition is a major
concern during an audit;
however, this area can be very challenging for auditors because
it is a relatively new area,
and revenue transactions can be very challenging as well.
Revenue recognition is a new
category of fraud risk, one which requires auditors to perform
84. additional procedures to
understand revenue recognition transactions, especially if these
are complex and unusual
(Patrick & Michael, 2003).
SAS No. 99 states that if analytical procedures identify
improper revenue
recognition, the auditors should plan their audit to identify such
risks (Patrick & Michael,
2003). If there is an identified risk of material misstatements
due to improper revenue
recognition, the auditor should perform analytical procedures
using disaggregated data to
determine if fraud actually exists (Casabona & Grego, 2003). To
illustrate, analytical
procedures on revenue are normally performed at a high level;
however, if material
misstatements exist, then revenue data should be disaggregated
on a month-by-month
basis or a product line basis. Such analytical procedures would
allow the audit team to
identify major changes in months or product line, which could
be an indication of fraud.
In conclusion, the new requirements of SAS No. 99 and revenue
recognition
85. procedures will have a major effect on the planning of an audit
and will require additional
control testing on journal entries involving revenue. In addition,
the new requirements
will call for additional procedures to understand how
management can override controls.
Patrick and Michael (2003) concluded by stating that the new
requirements of SAS No.
99 will change the scope of the audit, as well as the time
requirements, and add to the
cost of implementing SAS No. 99. However, the backlash
against SAS No. 99 is the
increased cost that auditors charge corporations.
45
SAS No. 99 and Internal Control
SAS No. 99 requires that auditors rely on the fraud triangle
theory to detect a
company’s vulnerability to financial statement fraud (Kranacher
et al., 2011). The fraud
theory states that three conditions are present for an individual
86. to commit fraud: pressure,
rationalization, and opportunity (Kranacher et al., 2011;
Romney, Albrecht, &
Cherrington, 1980). Pressure relates to an individual’s financial
position, rationalization
relates to how an individual thinks about their act of crime, and
opportunity relates to a
company’s internal control system (Kranacher et al., 2011;
Romney, Albrecht, &
Cherrington, 1980). Opportunity is of importance when
understanding the fraud theory
because a company’s management team can control it. An
organization’s management
team can control opportunity because it relates to a company’s
internal control system,
which is designed, created, and enforced by management
(Murphy & Dacin, 2011; Wells,
2011), whereas rationalization and pressure are not designed,
created, or enforced by a
company. Internal controls are a system of procedures designed
by executive
management to meet the objectives of safeguarding assets
(Harrison et al., 2011). To
safeguard assets, a company must design policies that encourage
87. operational efficiency,
ensures that accounting transactions are accurately prepared,
and comply with the legal
requirements of the Sarbanes Oxley Act (Harrison et al., 2011)
If a company has a good system of internal controls, the
possibility for a fraudster
to commit fraud diminishes (Harrison et al., 2011). The
possibility will diminish even if
the fraudster is under financial pressure or can rationalize their
actions. This is true
because all three elements of the fraud triangle theory must be
present for a fraudster to
commit fraud (Harrison et al., 2011). Since internal control is
an important facet of fraud,
46
it is imperative that a discussion on internal controls is
addressed in this literature review.
The following discussion on internal controls will elaborate on
the three elements of a
good system of internal control. These three elements are the
control environment, risk
88. assessment, information and communication, control activities,
and monitoring (Murphy
& Dacin, 2011; Wells, 2011).
Control Environment
The control environment is the environment in which the
business operates. The
control environment is what determines the actions of the
employees when deciding
whether to do right or wrong. For example, if a company’s
leadership team encourages
employees to follow company’s procedures to record accounting
transactions and if there
are consequences for not following procedures, the company is
creating a positive control
environment. When management creates a positive control
environment and reprimands
employees who do not follow the company’s procedures, the
likelihood of employees
committing fraud diminishes for two reasons. First, the
employees know that accounting
transactions are reviewed by management. Second, employees
understand that there will
be consequences for failure to follow the company’s policies.
Also, if a company has a
89. good control environment, it will improve the auditor’s risk
assessment, which is an
easement of how a company safeguards their assets and follows
policies and procedures
(Murphy & Dacin, 2011; Wells, 2011).
Risk Assessment Process
The risk assessment process is a systematic process for
recognizing and assessing
events that occur within the company. The events can represent
risk and opportunists that
could affect a company’s financial statements. The events can
be caused by the external
47
environment or the internal environment. A good system of
internal controls does not
wait for risk or opportunism to occur; instead, a company
assesses the likelihood of the
events (Murphy & Dacin, 2011; Wells, 2011).
By assessing the likelihood of events, a company can prepare
for such events to
90. minimize the impact of negative risk on financial statements or
to maximize events that
could have a positive impact on the company’s financial
statements. Risk assessment is
necessary for a company to maximize stakeholder’s investment
and to succeed in an
unpredictable economy (Wells, 2011).
Information and Communication
It is vital that auditors gather the necessary information on a
company’s financial
statements to ensure that information was properly classified,
measured, recorded,
analyzed, and reported on the financial statement data in a
timely manner. In addition, it is
important that a company’s financial statements be properly
communicated because
information that is not communicated in a timely manner lacks
creditability and its
usefulness to stakeholders diminishes (Murphy & Dacin, 2011).
To illustrate, if financial
data is prepared three months late, it is not useful to a bank
because banks are interested in
a company’s current financial position. In addition, if an
organization is unable to produce
91. timely data, it loses it creditability because potential
stakeholders will question a
company’s ability to operate efficiently. For these reasons, it is
imperative that financial
information is communicated in a timely manner.
Control Activities
Control activities are designed by management to ensure that
financial data is
prepared truthfully and accurately and that the information is
reliable. If a company has
48
good control procedures in place, the likelihood for employees
to commit fraud decreases
(Harrison et al., 2011). The control activities that a company
has in place can vary by
organization; however, two types of controls can be found in an
organization. The two
types are preventive activities and detective activities.
Preventive activities are designed
to stop or deter fraud from occurring (Wells, 2012). To
illustrate, a bank understands that
92. it is possible for employees to steal money, so the bank has
preventive activities in place.
The preventive activities may include cameras to watch
employees, periodic counting of
cash in the drawer, and checking employee’s personal items
when leaving work. If a
company has good controls activities in place, fraud decreases
(Harrison et al., 2011).
The second type of control to decrease fraud is detective
activities. Detective
activities identify fraudulent activities that have already
occurred in an organization.
When management identifies fraudulent activities that have
already occurred, immediate
actions are taken to prevent the activity from occurring in the
future. To illustrate, if
management discovers that inventory is missing from the
stockroom, management will
immediately implement a new policy and procedures to prevent
further theft. The new
policy could include installing cameras in the storeroom or
counting supplies on a routine
or surprise basis. Control activities will deter employees from
stealing from their
93. organization if they know cameras or routine counts of
inventory will occur on a regular
basis (Harrison et al., 2011).
Monitoring
The last component that a company needs to have a good system
of internal
control is monitoring. Monitoring is a review conducted by
management to ensure that
the company’s internal control procedures are operating as
planned and to identify any
49
deficiencies that may exist. Monitoring a company’s internal
control can include separate
evaluations or ongoing evaluations (McNally, n.d.). Separate
evaluations are conducted
on a routine basis, but are not built into the organization’s
internal control structure,
whereas ongoing activities are built into a company’s internal
control structure.
Ongoing activities are conducted on a systematic basis and
include analyzing
94. data, reconciling accounts, and other transactions that can
verify the credibility and
reliability of the financial data. Ongoing activities and separate
activities can be
performed manually with the use of software or a combination
of both methods
(McNally, n.d.). However, using software to evaluate internal
controls procedures offers
benefits that can be achieved with manual evaluations of
internal control (McNally, n.d.).
The use of software allows management to immediately identify
and correct control
deficiencies. To illustrate, internal control software
immediately identifies transitions that
are not properly recorded or have an unusually high transaction
balance.
The Evolution of Statements of Auditing Standards
Financial statement fraud has been in existence since the stock
market crash of
1923. As a result of the stock market crash, the federal
government stepped in to provide
protection to investors and creditors who rely on financial
statements when making
95. investing decisions. To protect investors and creditors, public
companies are required to
have their financial statements audited by accounting firms. The
purpose of the audit is to
provide reasonable assurance on whether the financial
statements are free from material
misstatements. To ensure financial statements are free from
material misstatements,
auditors exercise due professional care during an audit. To
provide due professional care,
50
auditors must follow specific guidelines that are set forth by the
Statement of Auditing
Standards (SAS).
The Statement of Auditing Standards has evolved over time, and
so have the
responsibilities of auditors. The first auditing standard to
protect investors and creditors
was SAS No. 53. SAS No 53, which explains that the auditor’s
responsibility is to
identify and report irregularities (Mancino, 1997). Since the
96. issuance of SAS No. 53, the
subject of fraud has continued to draw the interest of ever -
growing constituencies, and
independent auditors have been the target of litigation and
criticism. Independent auditors
were the target of litigation and criticism because there was a
misconception regarding
the public view on the level of responsibilities that auditors
have in detecting financial
statement fraud and what auditors can do to detect fraud.
Because of these
misconceptions, the SEC developed SAS No. 82 (Dezoort &
Thomas, 1998; Mancino,
1997).
The most important difference between SAS No 53 and SAS No.
82 were changes
made to the auditor’s responsibility to detect fraud (Dezoort &
Thomas, 1998; Mancino,
1997). The first difference is SAS No. 82, which does not use
the term irregularities;
instead, it uses the term fraud and it emphasizes that auditors
have a responsibility to
detect fraud during the planning stage of the audit and during
the performance of the
97. audit (Dezoort & Thomas, 1998; Mancino, 1997). However,
SAS No. 53 used the term
errors, which are defined as unintentional misstatements or
omissions in financial
statements (Dezoort & Thomas, 1998; Mancino, 1997). Another
important difference
between SAS No. 53 and SAS No. 82 is that SAS No. 82
required auditors to assess and
document the risk or likelihood of misstatements in the
financial statements (Dezoort &
51
Thomas, 1998; Mancino, 1997). The purpose of this
documentation was to serve as proof
that auditors had done their due diligence in assessing and
detecting the possibility of
financial statement fraud, whereas SAS No. 53 did not require
auditors to assess or
document the risk or the likelihood of misstatements in the
financial statements (Dezoort
& Thomas, 1998; Mancino, 1997).
The purpose of the assessment and documentation of SAS No.
98. 82 is to protect
auditors in the event of a lawsuit from financial statement users.
Lastly, the accounting
standard board believed that the implementation of SAS No. 82
would force auditors to
increase their audits procedures in regards to testi ng and
reviewing financial statement
accounts (Dezoort & Thomas, 1998; Mancino, 1997). Testing
and reviewing accounts is
important because it reduces the time it takes auditors to detect
fraud. Without testing and
reviewing accounts, it could take auditors up to five years to
determine if fraud exists in
an account.
Due to the accounting scandals that occurred at major
corporations such as
Enron and WorldCom, a major change in the Statement of
Auditing Standards occurred
(Labaton, 2006). The new standard requires auditors to obtain
reasonable assurance
through brainstorming that financial statements are free of
material misstatements
(Labaton, 2006). The new standard is termed SAS No. 99 and it
is more detailed than
99. SAS No. 82 because it requires that auditors document activities
that occur during the
audit (Ramos, 2003). First, auditors must document when
brainstorming meetings
occurred and who attended them (Ramos, 2003). Second, SAS
No. 99 requires that
auditors document the steps they performed to gather
information to assess if fraud could
exist in the financial statements (Ramos, 2003). Third, auditors
must include a discussion
52
on revenue recognition and whether there is a possibility that
fraud could exist in the
financial statements (Ramos, 2003). If fraud does exist, auditors
must estimate the
amount of the possible misstatement.
Other important components of SAS No. 99 are the likelihood
that management
could override internal controls (Alexander, 2012; Dorminey et
al., 2010). Internal
controls are the policies and procedures companies have in
100. place to prevent fraud from
occurring (Dorminey et al., 2010). SAS No. 99 also focuses on
the analytical procedures
that auditors perform to determine if additional auditors would
be necessary to conduct
the audit (Ramos, 2003). Analytical procedures are a diagnostic
sequential and iterative
process involving hypothesis generation, information search,
hypothesis evaluation, and a
final judgment (Hayes, 2011). Lastly, management must discuss
any issues of fraud with
management. It is important that management communicate the
information to the right
individuals within the organization.
Auditors’ responsibility to detect errors refers to material
unintentional
transactions or the omission of transactions that are or are not
recorded in the financial
statements. Errors could occur in the following cases (Hayes,
2011):
1. Accounting data is incorrectly gathered or processed when
the transaction was
recorded. To illustrate, an accountant to could fail to gather
accounts payable data
101. and a payment to a creditor could be omitted from the financial
statements. This
type of error would cause net income or liabilities to be over
stated.
2. Miscalculations of accounting estimates because of oversight
or misinterpretation
of facts. To illustrate, if an accountant does not adequately
determine the amount
of the depreciation expense, it would affect the income
statement, which could be
53
overstated or understated. Income could be overstated if the
transaction was not
recorded or if the amount of the deprecation was too low.
Lastly, the income
statement could be overstated if the amount of the depreciation
expense was too
low.
3. Misrepresentation in applying generally accepted accounting
principles for the
classification or presentation of an asset, liability, equity,
102. revenue, or expense. To
illustrate, generally accepted accounting principles require that
a company record
any contingent liability in the financial statements if it is
probable that a loss will
be incurred and if the amount of the contingent loss can be
determined. If
management fails to record a contingency, the company has
misrepresented the
application of generally accepted accounting principles.
Unfortunately, there have been misconceptions from
stakeholders, such as investors and
creditors, in regards to these errors. Stakeholders believe that
auditors should be
responsible to detect all errors; however, in reality, it is not
possible to detect all errors
because auditors do not verify every transaction that occurs in a
company’s financial
statements. However, if the amount is material, then auditors
have a responsibility to
detect the error.
The term irregularities differ from the term errors because
errors are
103. unintentional, whereas irregularities are considered intentional
misstatements or
omissions in financial statements. Irregularities occur when
financial statements are
deliberately misstated and the misstatements are generally
initiated by management
(Bariyima & Akenbor, 2008). Financial statements irregularities
are also named
54
management fraud, defalcations, or asset misappropriations, and
they may involve the
following types of transactions:
1. Manipulation, falsification, or alteration of accounting
records or supporting
documents from which financial statements are prepared.
2. Misrepresentation or intentional omission of events,
transactions, or other
significant information.
3. Intentional misapplication of accounting principles relating
to amounts,
classification, manner of presentation, or disclosure. (Bariyima
104. & Akenbor,
2008)
To illustrate, if an accountant records a $1,000 transacti on for
$1,000,000, it should be
detected by the auditor because auditors have a responsibility to
verify all material
transactions and a $1,000,000 transaction is a material amount.
However, not all errors in
financial statement will be detected, even if the amount is
material, because of
management override of internal controls. Management override
of internal controls
occurs because management has access to accounting data and
computer passwords to
change or modify transactions without anyone’s approval
(Dorminey et al., 2010;
Kassem & Higson, 2012). To illustrate, because of
management’s ability to a enter a
transaction without the approval of another manager, a manager
could enter a $5,000,000
revenue transaction in the financial statements without the
approval of another manager
The three components of the fraud triangle theory are
rationalization, opportunity,
105. and pressure, and all three must be present for an individual to
commit fraud (Cressey,
1953). However, the opportunity for an individual to commit
fraud can be controlled,
managed, or monitored if a company has a good system of
internal control (Alexander,
55
2012; Harrison et al., 2011) A good system of internal control is
determined by an
organization, whereas rationalization and pressure cannot be
controlled by an
organization.
Rationalization is based on how an individual thinks, which
cannot be controlled
by an organization, and pressure is an emotion that individuals
have and that cannot be
controlled by a company (Dorminey et al., 2010; Kassem &
Higson, 2012; Kranacher, et
al., 2011). Therefore, corporations should focus their efforts on
opportunities to reduce
fraud; this can be accomplished by developing a good system of
106. internal control
(Alexander, 2012; Harrison et al., 2011). As previously stated,
all three components of
the fraud triangle theory must be present for an individual to
commit fraud. Thus, if a
company can eliminate one of the components of the fraud
triangle theory, the possibility
for an individual to commit fraud decreases dramatically
(Murphy & Dacin, 2011; Wells,
2011). The component that companies should focus on to reduce
fraud is opportunity,
because it relates to a company’s internal control structure,
which can be controlled by an
organization (Murphy & Dacin, 2011; Wells, 2011).
Risk Assessment
Management can mitigate fraud at their organization if they
focus their efforts on
internal control; this can be accomplished by performing a risk
assessment and designing
a risk model for their organization (Edward, 2010; Harris, 2011;
Wells, 2011). A
company’s risk assessment should include an understanding of
the company’s assets,
107. which includes employees, property, equipment, and company
software. Understanding a
company’s assets is the first and most critical step when an
assessing a company’s risk
because assets cannot be protected if they are not identified
(Edward, 2010).
56
Identifying assets allows management to categorize the assets
according to the
likelihood of fraud occurring. If a company can identify and
describes the responsibilities
of employees who work in the accounting department,
management could predict the
likelihood of fraud by assessing the company’s internal control
structure (Edward, 2010;
Harris, 2011; Wells, 2011). To illustrate, if an employee in the
accounting department is
responsible for handling cash, there is a possibility that the
employee could steal cash. In
this example, the risk assessment should be set high because
there is a possibility that the
employee could steal cash. However, the possibility does not