SlideShare a Scribd company logo
1 of 29
Online bioscience course for grades 6-12 Fall 2009 bio 1.0
Class mechanics… ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],bio 1.0
Lecture 3:  Genes and proteins bio 1.0
Take Homes: ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],bio 1.0
What is a gene?: ,[object Object],[object Object],[object Object],[object Object],[object Object],bio 1.0
Take Home I Genes are DNA sequences that encode a heritable trait… What is a gene? bio 1.0
http://en.wikipedia.org/wiki/Genetic_code How the genetic code works I: bio 1.0
How the genetic code works II: Transcribed strand mRNA Peptide (“protein”) bio 1.0
How the genetic code works III bio 1.0
Reading frames bio 1.0
Using a computer program to define a gene from a sequence: http:// www.ncbi.nlm.nih.gov/gorf/gorf.html bio 1.0
Step-by-step video showing how to  use the ORF Finder with our DNA  sequence to find out if it encodes a  protein… http:// www.screencast.com/t/gzxXnMwLWNI bio 1.0
>EXPERIMENTAL DNA SEQUENCE I ATGGCTAGCAAAGGAGAAGAACTTTTCACTGGA GTTGTCCCAATTCTTGTTGAATTAGATGGTGAT GTTAATGGGCACAAATTTTCTGTCAGTGGAGAG GGTGAAGGTGATGCTACATACGGAAAGCTTACC CTTAAATTTATTTGCACTACTGGAAAACTACCT GTTCCATGGCCAACACTTGTCACTACTTTCTCT TATGGTGTTCAATGCTTTTCCCGTTATCCGGAT CATATGAAACGGCATGACTTTTTCAAGAGTGCC ATGCCCGAAGGTTATGTACAGGAACGCACTATA TCTTTCAAAGATGACGGGAACTACAAGACGCGT GCTGAAGTCAAGTTTGAAGGTGATACCCTTGTT AATCGTATCGAGTTAAAAGGTATTGATTTTAAA GAAGATGGAAACATTCTCGGACACAAACTCGAG TACAACTATAACTCACACAATGTATACATCACG GCAGACAAACAAAAGAATGGAATCAAAGCTAAC TTCAAAATTCGCCACAACATTGAAGATGGATCC GTTCAACTAGCAGACCATTATCAACAAAATACT CCAATTGGCGATGGCCCTGTCCTTTTACCAGAC AACCATTACCTGTCGACACAATCTGCCCTTTCG AAAGATCCCAACGAAAAGCGTGACCACATGGTC CTTCTTGAGTTTGTAACTGCTGCTGGGATTACA CATGGCATGGATGAGCTCTACAAAT Test DNA Sequence: bio 1.0
So, our sequence contains the  Green Fluorescent Protein (GFP)  Gene sequence…  bio 1.0
http:// en.wikipedia.org/wiki/Green_fluorescent_protein bio 1.0
Cells “engineered” to express GFP: bio 1.0
Take Home II Many genes encode for the amino acid sequence of proteins… Many genes code for proteins bio 1.0
The lac Operon-an example of  how bacterial genes are turned  “ on” and “off”… http:// www.youtube.com/watch?v =oBwtxdI1zvk bio 1.0
Take Home III Genes are tuned “on” and “off” by complex interactions of factors and DNA sequences… Genes are regulated  bio 1.0
Protein Functions in the Body  http:// www.youtube.com/watch?v =T500B5yTy58 bio 1.0
Take Home IV Proteins do most of the “work” in cells and most of the cell structure is made-up of proteins… The proteins encoded by genes shape the cell and do its work… bio 1.0
Protein Functions in the Body:  An example-ATP Synthase http:// www.youtube.com/watch?v =3y1dO4nNaKY bio 1.0
Looking at GFP at the  molecular level… bio 1.0
Download and install CN3D: http://www.ncbi.nlm.nih.gov/Structure/CN3D/cn3d.shtml bio 1.0
A look at GFP structure  with CN3D… http://www.screencast.com/t/oCq2i3YcX bio 1.0
Take Home V Proteins function according to their 3 Dimensional structures… How proteins work… bio 1.0
Virtual experiment: making bacteria  that glow green by giving them a GFP gene…  http://www.youtube.com/watch?v=Jyfi5e2JoYc & http:// www.youtube.com/watch?v =7zJ-Xe9rZh8 bio 1.0
Next Week: The bacterial world How bacteria are structured and how they function… bio 1.0
instructor Mark E Minie PhD [email_address]   bio 1.0

More Related Content

Similar to Lecture 3 Genes And Proteins 10212009

Biopython programming workshop at UGA
Biopython programming workshop at UGABiopython programming workshop at UGA
Biopython programming workshop at UGAEric Talevich
 
Annotated biology technology resources
Annotated biology technology resourcesAnnotated biology technology resources
Annotated biology technology resourcesMarilyn Brouette
 
Introduction to NCBI
Introduction to NCBIIntroduction to NCBI
Introduction to NCBIgeetikaJethra
 
Protein Analysis
Protein AnalysisProtein Analysis
Protein AnalysisSyed Lokman
 
TheUniProtKBpptx__2022_03_30_13_07_41.pptx
TheUniProtKBpptx__2022_03_30_13_07_41.pptxTheUniProtKBpptx__2022_03_30_13_07_41.pptx
TheUniProtKBpptx__2022_03_30_13_07_41.pptxPRIYANKAZALA9
 
B.sc biochem i bobi u 2 database
B.sc biochem i bobi u 2 databaseB.sc biochem i bobi u 2 database
B.sc biochem i bobi u 2 databaseRai University
 
What Synthetic Biology Can Do For You
What Synthetic Biology Can Do For YouWhat Synthetic Biology Can Do For You
What Synthetic Biology Can Do For YouEric Ma
 
CRI - Teaching Through Research - Melanie Stegman - Immune Defense
CRI - Teaching Through Research - Melanie Stegman - Immune DefenseCRI - Teaching Through Research - Melanie Stegman - Immune Defense
CRI - Teaching Through Research - Melanie Stegman - Immune DefenseLeadershipProgram
 
Collaboratively Creating the Knowledge Graph of Life
Collaboratively Creating the Knowledge Graph of LifeCollaboratively Creating the Knowledge Graph of Life
Collaboratively Creating the Knowledge Graph of LifeChris Mungall
 
Biotechnology Chapter Five Lecture- Proteins (part b)
Biotechnology Chapter Five Lecture- Proteins (part b)Biotechnology Chapter Five Lecture- Proteins (part b)
Biotechnology Chapter Five Lecture- Proteins (part b)Mary Beth Smith
 
Working with Chromosomes
Working with ChromosomesWorking with Chromosomes
Working with ChromosomesIoanna Leontiou
 
Novozymes Enzyme Stability Prediction
Novozymes Enzyme Stability PredictionNovozymes Enzyme Stability Prediction
Novozymes Enzyme Stability PredictionIttrainingIttraining
 
InterPro and InterProScan 5.0
InterPro and InterProScan 5.0InterPro and InterProScan 5.0
InterPro and InterProScan 5.0EBI
 

Similar to Lecture 3 Genes And Proteins 10212009 (20)

Biopython programming workshop at UGA
Biopython programming workshop at UGABiopython programming workshop at UGA
Biopython programming workshop at UGA
 
Bio4j
Bio4jBio4j
Bio4j
 
Synthetic Biology
Synthetic BiologySynthetic Biology
Synthetic Biology
 
簡報1
簡報1簡報1
簡報1
 
Annotated biology technology resources
Annotated biology technology resourcesAnnotated biology technology resources
Annotated biology technology resources
 
Biopharma VS Small Molecules Therapeutic
Biopharma VS Small Molecules TherapeuticBiopharma VS Small Molecules Therapeutic
Biopharma VS Small Molecules Therapeutic
 
Introduction to NCBI
Introduction to NCBIIntroduction to NCBI
Introduction to NCBI
 
Protein Analysis
Protein AnalysisProtein Analysis
Protein Analysis
 
ED 205 IPP
ED 205 IPPED 205 IPP
ED 205 IPP
 
Biopharmaceutical
Biopharmaceutical Biopharmaceutical
Biopharmaceutical
 
Neo4j and bioinformatics
Neo4j and bioinformaticsNeo4j and bioinformatics
Neo4j and bioinformatics
 
TheUniProtKBpptx__2022_03_30_13_07_41.pptx
TheUniProtKBpptx__2022_03_30_13_07_41.pptxTheUniProtKBpptx__2022_03_30_13_07_41.pptx
TheUniProtKBpptx__2022_03_30_13_07_41.pptx
 
B.sc biochem i bobi u 2 database
B.sc biochem i bobi u 2 databaseB.sc biochem i bobi u 2 database
B.sc biochem i bobi u 2 database
 
What Synthetic Biology Can Do For You
What Synthetic Biology Can Do For YouWhat Synthetic Biology Can Do For You
What Synthetic Biology Can Do For You
 
CRI - Teaching Through Research - Melanie Stegman - Immune Defense
CRI - Teaching Through Research - Melanie Stegman - Immune DefenseCRI - Teaching Through Research - Melanie Stegman - Immune Defense
CRI - Teaching Through Research - Melanie Stegman - Immune Defense
 
Collaboratively Creating the Knowledge Graph of Life
Collaboratively Creating the Knowledge Graph of LifeCollaboratively Creating the Knowledge Graph of Life
Collaboratively Creating the Knowledge Graph of Life
 
Biotechnology Chapter Five Lecture- Proteins (part b)
Biotechnology Chapter Five Lecture- Proteins (part b)Biotechnology Chapter Five Lecture- Proteins (part b)
Biotechnology Chapter Five Lecture- Proteins (part b)
 
Working with Chromosomes
Working with ChromosomesWorking with Chromosomes
Working with Chromosomes
 
Novozymes Enzyme Stability Prediction
Novozymes Enzyme Stability PredictionNovozymes Enzyme Stability Prediction
Novozymes Enzyme Stability Prediction
 
InterPro and InterProScan 5.0
InterPro and InterProScan 5.0InterPro and InterProScan 5.0
InterPro and InterProScan 5.0
 

More from meminie

2010 may bioit class syllabus 572010
2010 may bioit class syllabus 5720102010 may bioit class syllabus 572010
2010 may bioit class syllabus 572010meminie
 
Lecture 1 bioscience overview 592010 post without videos
Lecture 1 bioscience overview 592010 post without videosLecture 1 bioscience overview 592010 post without videos
Lecture 1 bioscience overview 592010 post without videosmeminie
 
Lecture 1 bioscience overview 592010 post
Lecture 1 bioscience overview 592010 postLecture 1 bioscience overview 592010 post
Lecture 1 bioscience overview 592010 postmeminie
 
Lecture 1 bioscience overview 592010 post with videos
Lecture 1 bioscience overview 592010 post with videosLecture 1 bioscience overview 592010 post with videos
Lecture 1 bioscience overview 592010 post with videosmeminie
 
Lecture 1 bioscience overview 592010 post
Lecture 1 bioscience overview 592010 postLecture 1 bioscience overview 592010 post
Lecture 1 bioscience overview 592010 postmeminie
 
Lecture 9 The Ecosystem
Lecture 9 The EcosystemLecture 9 The Ecosystem
Lecture 9 The Ecosystemmeminie
 
Lecture 8 Biomedicine
Lecture 8 BiomedicineLecture 8 Biomedicine
Lecture 8 Biomedicinememinie
 

More from meminie (8)

2010 may bioit class syllabus 572010
2010 may bioit class syllabus 5720102010 may bioit class syllabus 572010
2010 may bioit class syllabus 572010
 
Lecture 1 bioscience overview 592010 post without videos
Lecture 1 bioscience overview 592010 post without videosLecture 1 bioscience overview 592010 post without videos
Lecture 1 bioscience overview 592010 post without videos
 
Lecture 1 bioscience overview 592010 post
Lecture 1 bioscience overview 592010 postLecture 1 bioscience overview 592010 post
Lecture 1 bioscience overview 592010 post
 
Lecture 1 bioscience overview 592010 post with videos
Lecture 1 bioscience overview 592010 post with videosLecture 1 bioscience overview 592010 post with videos
Lecture 1 bioscience overview 592010 post with videos
 
Lecture 1 bioscience overview 592010 post
Lecture 1 bioscience overview 592010 postLecture 1 bioscience overview 592010 post
Lecture 1 bioscience overview 592010 post
 
Lecture 9 The Ecosystem
Lecture 9 The EcosystemLecture 9 The Ecosystem
Lecture 9 The Ecosystem
 
Lecture 8 Biomedicine
Lecture 8 BiomedicineLecture 8 Biomedicine
Lecture 8 Biomedicine
 
Ugenex
UgenexUgenex
Ugenex
 

Recently uploaded

Driving Behavioral Change for Information Management through Data-Driven Gree...
Driving Behavioral Change for Information Management through Data-Driven Gree...Driving Behavioral Change for Information Management through Data-Driven Gree...
Driving Behavioral Change for Information Management through Data-Driven Gree...Enterprise Knowledge
 
Understanding Discord NSFW Servers A Guide for Responsible Users.pdf
Understanding Discord NSFW Servers A Guide for Responsible Users.pdfUnderstanding Discord NSFW Servers A Guide for Responsible Users.pdf
Understanding Discord NSFW Servers A Guide for Responsible Users.pdfUK Journal
 
08448380779 Call Girls In Diplomatic Enclave Women Seeking Men
08448380779 Call Girls In Diplomatic Enclave Women Seeking Men08448380779 Call Girls In Diplomatic Enclave Women Seeking Men
08448380779 Call Girls In Diplomatic Enclave Women Seeking MenDelhi Call girls
 
IAC 2024 - IA Fast Track to Search Focused AI Solutions
IAC 2024 - IA Fast Track to Search Focused AI SolutionsIAC 2024 - IA Fast Track to Search Focused AI Solutions
IAC 2024 - IA Fast Track to Search Focused AI SolutionsEnterprise Knowledge
 
Finology Group – Insurtech Innovation Award 2024
Finology Group – Insurtech Innovation Award 2024Finology Group – Insurtech Innovation Award 2024
Finology Group – Insurtech Innovation Award 2024The Digital Insurer
 
🐬 The future of MySQL is Postgres 🐘
🐬  The future of MySQL is Postgres   🐘🐬  The future of MySQL is Postgres   🐘
🐬 The future of MySQL is Postgres 🐘RTylerCroy
 
Partners Life - Insurer Innovation Award 2024
Partners Life - Insurer Innovation Award 2024Partners Life - Insurer Innovation Award 2024
Partners Life - Insurer Innovation Award 2024The Digital Insurer
 
TrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law DevelopmentsTrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law DevelopmentsTrustArc
 
Presentation on how to chat with PDF using ChatGPT code interpreter
Presentation on how to chat with PDF using ChatGPT code interpreterPresentation on how to chat with PDF using ChatGPT code interpreter
Presentation on how to chat with PDF using ChatGPT code interpreternaman860154
 
ProductAnonymous-April2024-WinProductDiscovery-MelissaKlemke
ProductAnonymous-April2024-WinProductDiscovery-MelissaKlemkeProductAnonymous-April2024-WinProductDiscovery-MelissaKlemke
ProductAnonymous-April2024-WinProductDiscovery-MelissaKlemkeProduct Anonymous
 
Evaluating the top large language models.pdf
Evaluating the top large language models.pdfEvaluating the top large language models.pdf
Evaluating the top large language models.pdfChristopherTHyatt
 
08448380779 Call Girls In Greater Kailash - I Women Seeking Men
08448380779 Call Girls In Greater Kailash - I Women Seeking Men08448380779 Call Girls In Greater Kailash - I Women Seeking Men
08448380779 Call Girls In Greater Kailash - I Women Seeking MenDelhi Call girls
 
What Are The Drone Anti-jamming Systems Technology?
What Are The Drone Anti-jamming Systems Technology?What Are The Drone Anti-jamming Systems Technology?
What Are The Drone Anti-jamming Systems Technology?Antenna Manufacturer Coco
 
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024The Digital Insurer
 
Exploring the Future Potential of AI-Enabled Smartphone Processors
Exploring the Future Potential of AI-Enabled Smartphone ProcessorsExploring the Future Potential of AI-Enabled Smartphone Processors
Exploring the Future Potential of AI-Enabled Smartphone Processorsdebabhi2
 
Artificial Intelligence: Facts and Myths
Artificial Intelligence: Facts and MythsArtificial Intelligence: Facts and Myths
Artificial Intelligence: Facts and MythsJoaquim Jorge
 
GenCyber Cyber Security Day Presentation
GenCyber Cyber Security Day PresentationGenCyber Cyber Security Day Presentation
GenCyber Cyber Security Day PresentationMichael W. Hawkins
 
A Domino Admins Adventures (Engage 2024)
A Domino Admins Adventures (Engage 2024)A Domino Admins Adventures (Engage 2024)
A Domino Admins Adventures (Engage 2024)Gabriella Davis
 
08448380779 Call Girls In Civil Lines Women Seeking Men
08448380779 Call Girls In Civil Lines Women Seeking Men08448380779 Call Girls In Civil Lines Women Seeking Men
08448380779 Call Girls In Civil Lines Women Seeking MenDelhi Call girls
 
Workshop - Best of Both Worlds_ Combine KG and Vector search for enhanced R...
Workshop - Best of Both Worlds_ Combine  KG and Vector search for  enhanced R...Workshop - Best of Both Worlds_ Combine  KG and Vector search for  enhanced R...
Workshop - Best of Both Worlds_ Combine KG and Vector search for enhanced R...Neo4j
 

Recently uploaded (20)

Driving Behavioral Change for Information Management through Data-Driven Gree...
Driving Behavioral Change for Information Management through Data-Driven Gree...Driving Behavioral Change for Information Management through Data-Driven Gree...
Driving Behavioral Change for Information Management through Data-Driven Gree...
 
Understanding Discord NSFW Servers A Guide for Responsible Users.pdf
Understanding Discord NSFW Servers A Guide for Responsible Users.pdfUnderstanding Discord NSFW Servers A Guide for Responsible Users.pdf
Understanding Discord NSFW Servers A Guide for Responsible Users.pdf
 
08448380779 Call Girls In Diplomatic Enclave Women Seeking Men
08448380779 Call Girls In Diplomatic Enclave Women Seeking Men08448380779 Call Girls In Diplomatic Enclave Women Seeking Men
08448380779 Call Girls In Diplomatic Enclave Women Seeking Men
 
IAC 2024 - IA Fast Track to Search Focused AI Solutions
IAC 2024 - IA Fast Track to Search Focused AI SolutionsIAC 2024 - IA Fast Track to Search Focused AI Solutions
IAC 2024 - IA Fast Track to Search Focused AI Solutions
 
Finology Group – Insurtech Innovation Award 2024
Finology Group – Insurtech Innovation Award 2024Finology Group – Insurtech Innovation Award 2024
Finology Group – Insurtech Innovation Award 2024
 
🐬 The future of MySQL is Postgres 🐘
🐬  The future of MySQL is Postgres   🐘🐬  The future of MySQL is Postgres   🐘
🐬 The future of MySQL is Postgres 🐘
 
Partners Life - Insurer Innovation Award 2024
Partners Life - Insurer Innovation Award 2024Partners Life - Insurer Innovation Award 2024
Partners Life - Insurer Innovation Award 2024
 
TrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law DevelopmentsTrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
 
Presentation on how to chat with PDF using ChatGPT code interpreter
Presentation on how to chat with PDF using ChatGPT code interpreterPresentation on how to chat with PDF using ChatGPT code interpreter
Presentation on how to chat with PDF using ChatGPT code interpreter
 
ProductAnonymous-April2024-WinProductDiscovery-MelissaKlemke
ProductAnonymous-April2024-WinProductDiscovery-MelissaKlemkeProductAnonymous-April2024-WinProductDiscovery-MelissaKlemke
ProductAnonymous-April2024-WinProductDiscovery-MelissaKlemke
 
Evaluating the top large language models.pdf
Evaluating the top large language models.pdfEvaluating the top large language models.pdf
Evaluating the top large language models.pdf
 
08448380779 Call Girls In Greater Kailash - I Women Seeking Men
08448380779 Call Girls In Greater Kailash - I Women Seeking Men08448380779 Call Girls In Greater Kailash - I Women Seeking Men
08448380779 Call Girls In Greater Kailash - I Women Seeking Men
 
What Are The Drone Anti-jamming Systems Technology?
What Are The Drone Anti-jamming Systems Technology?What Are The Drone Anti-jamming Systems Technology?
What Are The Drone Anti-jamming Systems Technology?
 
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024
 
Exploring the Future Potential of AI-Enabled Smartphone Processors
Exploring the Future Potential of AI-Enabled Smartphone ProcessorsExploring the Future Potential of AI-Enabled Smartphone Processors
Exploring the Future Potential of AI-Enabled Smartphone Processors
 
Artificial Intelligence: Facts and Myths
Artificial Intelligence: Facts and MythsArtificial Intelligence: Facts and Myths
Artificial Intelligence: Facts and Myths
 
GenCyber Cyber Security Day Presentation
GenCyber Cyber Security Day PresentationGenCyber Cyber Security Day Presentation
GenCyber Cyber Security Day Presentation
 
A Domino Admins Adventures (Engage 2024)
A Domino Admins Adventures (Engage 2024)A Domino Admins Adventures (Engage 2024)
A Domino Admins Adventures (Engage 2024)
 
08448380779 Call Girls In Civil Lines Women Seeking Men
08448380779 Call Girls In Civil Lines Women Seeking Men08448380779 Call Girls In Civil Lines Women Seeking Men
08448380779 Call Girls In Civil Lines Women Seeking Men
 
Workshop - Best of Both Worlds_ Combine KG and Vector search for enhanced R...
Workshop - Best of Both Worlds_ Combine  KG and Vector search for  enhanced R...Workshop - Best of Both Worlds_ Combine  KG and Vector search for  enhanced R...
Workshop - Best of Both Worlds_ Combine KG and Vector search for enhanced R...
 

Lecture 3 Genes And Proteins 10212009

  • 1. Online bioscience course for grades 6-12 Fall 2009 bio 1.0
  • 2.
  • 3. Lecture 3: Genes and proteins bio 1.0
  • 4.
  • 5.
  • 6. Take Home I Genes are DNA sequences that encode a heritable trait… What is a gene? bio 1.0
  • 8. How the genetic code works II: Transcribed strand mRNA Peptide (“protein”) bio 1.0
  • 9. How the genetic code works III bio 1.0
  • 11. Using a computer program to define a gene from a sequence: http:// www.ncbi.nlm.nih.gov/gorf/gorf.html bio 1.0
  • 12. Step-by-step video showing how to use the ORF Finder with our DNA sequence to find out if it encodes a protein… http:// www.screencast.com/t/gzxXnMwLWNI bio 1.0
  • 13. >EXPERIMENTAL DNA SEQUENCE I ATGGCTAGCAAAGGAGAAGAACTTTTCACTGGA GTTGTCCCAATTCTTGTTGAATTAGATGGTGAT GTTAATGGGCACAAATTTTCTGTCAGTGGAGAG GGTGAAGGTGATGCTACATACGGAAAGCTTACC CTTAAATTTATTTGCACTACTGGAAAACTACCT GTTCCATGGCCAACACTTGTCACTACTTTCTCT TATGGTGTTCAATGCTTTTCCCGTTATCCGGAT CATATGAAACGGCATGACTTTTTCAAGAGTGCC ATGCCCGAAGGTTATGTACAGGAACGCACTATA TCTTTCAAAGATGACGGGAACTACAAGACGCGT GCTGAAGTCAAGTTTGAAGGTGATACCCTTGTT AATCGTATCGAGTTAAAAGGTATTGATTTTAAA GAAGATGGAAACATTCTCGGACACAAACTCGAG TACAACTATAACTCACACAATGTATACATCACG GCAGACAAACAAAAGAATGGAATCAAAGCTAAC TTCAAAATTCGCCACAACATTGAAGATGGATCC GTTCAACTAGCAGACCATTATCAACAAAATACT CCAATTGGCGATGGCCCTGTCCTTTTACCAGAC AACCATTACCTGTCGACACAATCTGCCCTTTCG AAAGATCCCAACGAAAAGCGTGACCACATGGTC CTTCTTGAGTTTGTAACTGCTGCTGGGATTACA CATGGCATGGATGAGCTCTACAAAT Test DNA Sequence: bio 1.0
  • 14. So, our sequence contains the Green Fluorescent Protein (GFP) Gene sequence… bio 1.0
  • 16. Cells “engineered” to express GFP: bio 1.0
  • 17. Take Home II Many genes encode for the amino acid sequence of proteins… Many genes code for proteins bio 1.0
  • 18. The lac Operon-an example of how bacterial genes are turned “ on” and “off”… http:// www.youtube.com/watch?v =oBwtxdI1zvk bio 1.0
  • 19. Take Home III Genes are tuned “on” and “off” by complex interactions of factors and DNA sequences… Genes are regulated bio 1.0
  • 20. Protein Functions in the Body http:// www.youtube.com/watch?v =T500B5yTy58 bio 1.0
  • 21. Take Home IV Proteins do most of the “work” in cells and most of the cell structure is made-up of proteins… The proteins encoded by genes shape the cell and do its work… bio 1.0
  • 22. Protein Functions in the Body: An example-ATP Synthase http:// www.youtube.com/watch?v =3y1dO4nNaKY bio 1.0
  • 23. Looking at GFP at the molecular level… bio 1.0
  • 24. Download and install CN3D: http://www.ncbi.nlm.nih.gov/Structure/CN3D/cn3d.shtml bio 1.0
  • 25. A look at GFP structure with CN3D… http://www.screencast.com/t/oCq2i3YcX bio 1.0
  • 26. Take Home V Proteins function according to their 3 Dimensional structures… How proteins work… bio 1.0
  • 27. Virtual experiment: making bacteria that glow green by giving them a GFP gene… http://www.youtube.com/watch?v=Jyfi5e2JoYc & http:// www.youtube.com/watch?v =7zJ-Xe9rZh8 bio 1.0
  • 28. Next Week: The bacterial world How bacteria are structured and how they function… bio 1.0
  • 29. instructor Mark E Minie PhD [email_address] bio 1.0