Online bioscience course for grades 6-12 Fall 2009 bio 1.0
Class mechanics… <ul><li>Attend the online Office Hour on Tuesdays at 3 PM  </li></ul><ul><li>via  tokbox-Discuss previous...
Lecture 3:  Genes and proteins bio 1.0
Take Homes: <ul><li>What is a gene? </li></ul><ul><li>II.  Many genes code for proteins </li></ul><ul><li>III.  Genes are ...
What is a gene?: <ul><li>A gene is a discrete unit of heritable information </li></ul><ul><li>Genes are typically, but not...
Take Home I Genes are DNA sequences that encode a heritable trait… What is a gene? bio 1.0
http://en.wikipedia.org/wiki/Genetic_code How the genetic code works I: bio 1.0
How the genetic code works II: Transcribed strand mRNA Peptide (“protein”) bio 1.0
How the genetic code works III bio 1.0
Reading frames bio 1.0
Using a computer program to define a gene from a sequence: http:// www.ncbi.nlm.nih.gov/gorf/gorf.html bio 1.0
Step-by-step video showing how to  use the ORF Finder with our DNA  sequence to find out if it encodes a  protein… http://...
>EXPERIMENTAL DNA SEQUENCE I ATGGCTAGCAAAGGAGAAGAACTTTTCACTGGA GTTGTCCCAATTCTTGTTGAATTAGATGGTGAT GTTAATGGGCACAAATTTTCTGTCA...
So, our sequence contains the  Green Fluorescent Protein (GFP)  Gene sequence…  bio 1.0
http:// en.wikipedia.org/wiki/Green_fluorescent_protein bio 1.0
Cells “engineered” to express GFP: bio 1.0
Take Home II Many genes encode for the amino acid sequence of proteins… Many genes code for proteins bio 1.0
The lac Operon-an example of  how bacterial genes are turned  “ on” and “off”… http:// www.youtube.com/watch?v =oBwtxdI1zv...
Take Home III Genes are tuned “on” and “off” by complex interactions of factors and DNA sequences… Genes are regulated  bi...
Protein Functions in the Body  http:// www.youtube.com/watch?v =T500B5yTy58 bio 1.0
Take Home IV Proteins do most of the “work” in cells and most of the cell structure is made-up of proteins… The proteins e...
Protein Functions in the Body:  An example-ATP Synthase http:// www.youtube.com/watch?v =3y1dO4nNaKY bio 1.0
Looking at GFP at the  molecular level… bio 1.0
Download and install CN3D: http://www.ncbi.nlm.nih.gov/Structure/CN3D/cn3d.shtml bio 1.0
A look at GFP structure  with CN3D… http://www.screencast.com/t/oCq2i3YcX bio 1.0
Take Home V Proteins function according to their 3 Dimensional structures… How proteins work… bio 1.0
Virtual experiment: making bacteria  that glow green by giving them a GFP gene…  http://www.youtube.com/watch?v=Jyfi5e2JoY...
Next Week: The bacterial world How bacteria are structured and how they function… bio 1.0
instructor Mark E Minie PhD [email_address]   bio 1.0
Upcoming SlideShare
Loading in …5
×

Lecture 3 Genes And Proteins 10212009

486 views

Published on

Published in: Technology
  • Be the first to comment

  • Be the first to like this

Lecture 3 Genes And Proteins 10212009

  1. 1. Online bioscience course for grades 6-12 Fall 2009 bio 1.0
  2. 2. Class mechanics… <ul><li>Attend the online Office Hour on Tuesdays at 3 PM </li></ul><ul><li>via tokbox-Discuss previous week’s video lecture </li></ul><ul><li>Online video lecture e-mailed every Wednesday-view </li></ul><ul><li>lecture and prepare to discuss the following Tuesday </li></ul><ul><li>Comment on video lecture using website discussion </li></ul><ul><li>board </li></ul><ul><li>Online Final Exam given 12/9/2009 </li></ul>bio 1.0
  3. 3. Lecture 3: Genes and proteins bio 1.0
  4. 4. Take Homes: <ul><li>What is a gene? </li></ul><ul><li>II. Many genes code for proteins </li></ul><ul><li>III. Genes are regulated </li></ul><ul><li>IV. The proteins encoded by genes </li></ul><ul><li>shape the cell and do its work </li></ul><ul><li>V. How proteins work </li></ul>bio 1.0
  5. 5. What is a gene?: <ul><li>A gene is a discrete unit of heritable information </li></ul><ul><li>Genes are typically, but not always, encoded by DNA </li></ul><ul><li>Genes typically, but not always code for proteins </li></ul><ul><li>A protein gene is an “Open Reading Frame” (ORF) of codons </li></ul><ul><li>(but only for prokayotes…sorta…) </li></ul>bio 1.0
  6. 6. Take Home I Genes are DNA sequences that encode a heritable trait… What is a gene? bio 1.0
  7. 7. http://en.wikipedia.org/wiki/Genetic_code How the genetic code works I: bio 1.0
  8. 8. How the genetic code works II: Transcribed strand mRNA Peptide (“protein”) bio 1.0
  9. 9. How the genetic code works III bio 1.0
  10. 10. Reading frames bio 1.0
  11. 11. Using a computer program to define a gene from a sequence: http:// www.ncbi.nlm.nih.gov/gorf/gorf.html bio 1.0
  12. 12. Step-by-step video showing how to use the ORF Finder with our DNA sequence to find out if it encodes a protein… http:// www.screencast.com/t/gzxXnMwLWNI bio 1.0
  13. 13. >EXPERIMENTAL DNA SEQUENCE I ATGGCTAGCAAAGGAGAAGAACTTTTCACTGGA GTTGTCCCAATTCTTGTTGAATTAGATGGTGAT GTTAATGGGCACAAATTTTCTGTCAGTGGAGAG GGTGAAGGTGATGCTACATACGGAAAGCTTACC CTTAAATTTATTTGCACTACTGGAAAACTACCT GTTCCATGGCCAACACTTGTCACTACTTTCTCT TATGGTGTTCAATGCTTTTCCCGTTATCCGGAT CATATGAAACGGCATGACTTTTTCAAGAGTGCC ATGCCCGAAGGTTATGTACAGGAACGCACTATA TCTTTCAAAGATGACGGGAACTACAAGACGCGT GCTGAAGTCAAGTTTGAAGGTGATACCCTTGTT AATCGTATCGAGTTAAAAGGTATTGATTTTAAA GAAGATGGAAACATTCTCGGACACAAACTCGAG TACAACTATAACTCACACAATGTATACATCACG GCAGACAAACAAAAGAATGGAATCAAAGCTAAC TTCAAAATTCGCCACAACATTGAAGATGGATCC GTTCAACTAGCAGACCATTATCAACAAAATACT CCAATTGGCGATGGCCCTGTCCTTTTACCAGAC AACCATTACCTGTCGACACAATCTGCCCTTTCG AAAGATCCCAACGAAAAGCGTGACCACATGGTC CTTCTTGAGTTTGTAACTGCTGCTGGGATTACA CATGGCATGGATGAGCTCTACAAAT Test DNA Sequence: bio 1.0
  14. 14. So, our sequence contains the Green Fluorescent Protein (GFP) Gene sequence… bio 1.0
  15. 15. http:// en.wikipedia.org/wiki/Green_fluorescent_protein bio 1.0
  16. 16. Cells “engineered” to express GFP: bio 1.0
  17. 17. Take Home II Many genes encode for the amino acid sequence of proteins… Many genes code for proteins bio 1.0
  18. 18. The lac Operon-an example of how bacterial genes are turned “ on” and “off”… http:// www.youtube.com/watch?v =oBwtxdI1zvk bio 1.0
  19. 19. Take Home III Genes are tuned “on” and “off” by complex interactions of factors and DNA sequences… Genes are regulated bio 1.0
  20. 20. Protein Functions in the Body http:// www.youtube.com/watch?v =T500B5yTy58 bio 1.0
  21. 21. Take Home IV Proteins do most of the “work” in cells and most of the cell structure is made-up of proteins… The proteins encoded by genes shape the cell and do its work… bio 1.0
  22. 22. Protein Functions in the Body: An example-ATP Synthase http:// www.youtube.com/watch?v =3y1dO4nNaKY bio 1.0
  23. 23. Looking at GFP at the molecular level… bio 1.0
  24. 24. Download and install CN3D: http://www.ncbi.nlm.nih.gov/Structure/CN3D/cn3d.shtml bio 1.0
  25. 25. A look at GFP structure with CN3D… http://www.screencast.com/t/oCq2i3YcX bio 1.0
  26. 26. Take Home V Proteins function according to their 3 Dimensional structures… How proteins work… bio 1.0
  27. 27. Virtual experiment: making bacteria that glow green by giving them a GFP gene… http://www.youtube.com/watch?v=Jyfi5e2JoYc & http:// www.youtube.com/watch?v =7zJ-Xe9rZh8 bio 1.0
  28. 28. Next Week: The bacterial world How bacteria are structured and how they function… bio 1.0
  29. 29. instructor Mark E Minie PhD [email_address] bio 1.0

×